Team:INSA-Lyon/Project/Stage3/Strategy/curli promoter
From 2010.igem.org
Design of Curli promoter
One microbiology team of our university works actively on the characterization and regulation of the curli promoter. Thanks to their works, we had the complete sequence of the intergenic region between csgD and csgB. The curli promoter is localized in this region, and is regulated by the csgD protein.
We wanted to only synthesize the promoter with the site of regulation by csgD. After analyzing the sequence, we decided to begin our promoter 20bp before the csgD box, and to finish it on the +1bp of transcription. It corresponds to 71 bp. We added a non-CDS (non coding sequence) prefix and suffix to our sequence, to fit with iGEM standards.
The final length of the biobrick is 129 pb synthesized by Mr gene.
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGAACTAAAAAAGAAAAATACAACGCGCGGGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCCATCGTACTAGTAGCGGCCGCTGCAGGAAGAA
The red sequence is the non-CDS prefix, the purple one is the curli promoter and the green one the non-CDS suffix.