Team:Freiburg Bioware/NoteBook/Labjournal/July

From 2010.igem.org

(Difference between revisions)

Latest revision as of 21:36, 27 October 2010

=> Back to Notebook overview

NoteBook Navigator

Juli

46.Labortag 01.07.2010

qPCR

Investigators: Hanna, Chris W. (guided by Sven)

Protocol will be inserted :)

Thawing HT1080 cells

Investigators: Adrian, Bea, Patrick

HT1080 cells were thawed following standard protocols
HT1080 passage 3
Incubation at 37°C

Investigation of the Kleinschmidt sequencing

Investigator: Volker

The sequence data from VM_2_30.06.-CMV-F and VM_3_30.06.-CMV-F arrived and showed as expected a homologous region with the ORFs of the corresponding VPs.

The process of VPex1, VPex2 and VPex3 sequencing is nearly finished. For further progress the oligos that prime at different locations in the Rap/Cap ORFs are required. The actual progress of the sequencing is shown in the image on the right side:

For the sequencing of VPex1 and VPex2 one further read will be required to achieve a continuous contig.
The sequencing of VPex3 is completed but contains two point mutations.

The investigation of the point mutations revealed that the:

first mutation (TAC=>TAT) is silent and codes for Tyrosine. The original codon TAC has a codon usage of 58% in Homo sapiens and 25% in E. coli where as the new codon TAT has a codon usage of 42% in H. sapiens and 75% in E. coli. There for this mutation could be an optimisation of the sequence for an approach to express the VP in E.coli.
second mutation (CCG=>CCA) is silent and codes for Proline. The original codon CCG has a codon usage of 11% in H. sapiens and 77% in E.coli weher as the new codon CCA has a codon usage of 27% in H. sapiens and 15%. This mutation would lead to an optimiced expression in human cells.

Therefor the combination of these two "optimized" codon does not make any sense in this combination.

47.Labortag 02.07.2010

Fluoroscence Pictures of Transduction 3

Investigators: Chris W, Patrick

total celldeath!
Looks like we should not transduce 3x10^5 cells with 1000 µl (or more) of our viral solution because almost all cells died in all approaches and the medium indicator was yellow. So we can not say if resuspendig the cells with the viral soultion is a useful alteration of the standart protocol.

@Chris and Patrick: The cells which has not been resuspended died aswell?? yes (Patrick) ... so u think the volume (1000µL) of the viral stock solution is too high and cell death is not caused by the "rough" reuspension? yes (Patrick) ... Could u maybe upload some pictures even though it did not work, but to documentate it properly!! thx Bea ... No, already thrown away and we could not take good pictures because of very thick bunches of dead cells, results confirmed by Sven (Patrick)

Media:Freiburg10 Massacre.jpg

Seeding and Splitting HEK

Investigators: Johannes, Kira, Patrick, Chris W

4 Petri dishes (each 10ml DMEM, 1,5*10^6 cells) and one 75 cell culture bottle (20ml DMEM, 1,5*10^6 cells). The cell density was not sufficient so we could not seed 3x10^6 in the 10 cm dishes as planed initially.
New DMEM Medium was made (10% FCS,). We received a Sodium-Pyruvat stock solution (100x).

New ologos/primers arrived

Investigator: Patrick

ST00147058: long pITR right for, labeled with number 31
ST00147059: long pITR right rev, labeled with number 32
ST00147606: long pITR left for, labeled with number 33
ST00147061: long pITR lef rev, labeled with number 34

An additional 1:10 working dilution was made with each oligo.

@ Achim: plz write it down into our oligo excel sheet.

Annotation of the 453 insertion site

The integration site between G453 and T454

Investigators: Patrick & Volker

The 453 insertion site is acoording to [Boucas et al., 2009] a promising alternative to the 585/588 integration site. The Peptides were integrated between the 453 Glycine and the 454 Threonine. This risidues were annotated in the gene maps (Genious) and visualized in the 3D structure (PyMOL).

Searching new restriction sites in the 585/588 WT loop

Investigator: Volker

The sequence of the major site for peptide integration into the capsid proteins was extracted from the viral sequence and pasted into the program DNA 2.0. In an first atempt the 4 amino acids that form the loop (5' - RGNR - 3') were used with the two flanking amino acids from the wild type sequence on each side. The goal of this theoretical investigation is to use alternative codons to insert restriction sites into the wild type loop to make later cloning easier. This was repeated in an second atempt with five flanking amino acids but did not reveal additional useful restriction sites.

Informations for the restriction enzymes were looked up in the [http://www.neb.com/nebecomm/products/category1.asp?#2 NEB Product catalogue].

Search for restriction sites in the 585/588 WT loop sequence

The three restriction sites are:

BbvI restriction site: Recognized sequence:
5'- GCAGC(N)8^ -3'
3'- CGTCG(N)12^ -3'
Sites found in pAAV_RC at position:

17 times in the ORFs of Rep & Cap => can't be used

BstEII restriction site: Recognized sequence:
5'- G^GTNACC -3'
3'- CCANTG^G -5'

There is only one BstEII restriction site in the vector that we want to use to insert the fragment (x-x)
The cutting site could be removed => theoretically useful restriction site.
Location fits nearly perfect because peptids ae usually integrated before the R585.

PstI restriction site Recognized sequence:
5'- CTGC^AG -3'
3'- G^ACGTC -5'

PStI is part of the iGEM standard and can't be used for this purpose.

Searching new restriction sites in the 585/588 KO loop

Search for restriction sites in the 585/588 KO loop sequence

Investigator: Volker

PstI restriction site Recognized sequence:
5'- CTGC^AG -3'
3'- G^ACGTC -5'

PStI is part of the iGEM standard and can't be used for this purpose.

Summary: There is no codon combination availible to encode the promising BstEII restriction site in this R585A_R588A_KO sequence.

Searching new restriction sites in the 453 loop

Search for restriction sites in the 453 loop sequence

Investigator: Volker

KpnI restriction site Recognized sequence:
5'- GGTAC^C -3'
3'- C^CATGG -5'
Sites found in pAAV_RC at position:

1721 and 3973
first restriction site could be replace without problem becauce it lies in the region that will be synthesized to replace the three iGEM restriction sites in the Rep ORF.
Restriction site is potentially useful

AvaI restriction site Recognized sequence:
5'- C^YCGRG -3'
3'- GRGCY^C -5'
Sites found in pAAV_RC at position:

six times in the ORFs of Rep and Cap => can't be used

DraIII restriction site Recognized sequence:
5'- TTT^AAA -3'
3'- AAA^TTT -5'
Sites found in pAAV_RC at position:

1181 (Rep ORF)
2893 (Cap ORF)
4463 (short after the Cap ORF)
4930 (f1 ORI)

AvaII restriction site Recognized sequence:
5'- G^GWCC -3'
3'- CCWG^G -5'
Sites found in pAAV_RC at position:

eight times in the ORFs of Rep and Cap => can't be used

Summary: The KpnI restriction site seems to be a good possibility to make the 453 insertion site ready for easy integration of peptides.
Especially the position where the cut is performed is ideal for our purpose because peptides are usually integrated after the Glycine 453 as described for example in [Boucas et al.; 2009].

48.Labortag 03.07.2010

Planing the gene synthesis to replace the three restriction sites in the rep ORF

Investigator: Volker

The construct pAAV_RC that we have bougth from Stratagene will be a central part of our Virus construction kit and therefor it has to be cleared from restriction sites that are used in the iGEM-standard.
There are five iGEM restriction sites in the pAAV-RC:

PstI at position (310)
EcoRI at position (1578)
PstI at position (1773)
EcoRI at position (1796)
PstI at position (4073)

The relative location to each other and other planed modifications in this sequence make it reasonable to replace the PstI (310) and PStI (4073) with site directed mutagenesis and to order a synthesis of the region with the three other restriction sites.

The primers for the site directed mutagenesis were designed:

Designed Primer: SDM PstI (310)

PstI at position (310)
- Recognized sequence: 5'- CTGC^AG -3'
- The codon 5'- CTG - 3' will be replaced by 5'- CTC -3'
- Both codons encode Leucine. The condon usage in H. sapiens decreases from 36% to 20%

5'- CTGACCGTGGCCGAGAAGCTCCAGCGCGACTTTCTGACGGA - 3'

Designed Primer: SDM PstI (4073)

- Recognized sequence: 5'- CTGC^AG -3'
- The codon 5'- CTG - 3' will be replaced by 5'- CTC -3'
- Both codons encode Leucine. The condon usage in H. sapiens decreases from 36% to 20%

5'- CGTGGAGATCGAGTGGGAGCTCCAGAAGGAAAACAGCAAACGCTGG -3'

Restriction sites of the RFC25 standard located in the Rep ORF shown in dark blue and single cuting restriction endunucleases shown in light blue

The region with the three restriction sites that are located near to each other is show in the picture above. The restriction sites indicated in light blue are single cutters and can therefor be use to clone the synthesized fragment into the original sequence of pAAV-RC.
For this purpose the restriction sites BstBI (1435) and SwaI (2004) will be used because they are availible in the lab stock and have 100% fidelity in one of the NEB buffers.
The required construct with four flanking base pairs on each side will be 583 bp long.

EcoRI at position (1578)
- Recognized sequence: 5'- G^AATTC -3'
- The codon 5'- GAA -3' will be replaced by 5'- GAG -3'
- Both codons encode Glutamic acid. The codon usage in H.sapiens increases from 41% to 59%.

PstI at position (1773)
- Recognized sequence: 5'- CTGC^AG -3'
- The codon 5'- TGC - 3' will be replaced by 5'- TGT -3'
- Both codons encode Cysteine. The condon usage in H. sapiens decreases from 58% to 42%

EcoRI at position (1796)
- Recognized sequence: 5'- G^AATTC -3'
- The codon 5'- AAT -3' will be replaced by 5'- AAC -3'
- Both codons encode for Asparagine. The codon usage in H. sapiens increases from 44% to 56%.

This are all the restriction sites in the ORFs for the Rep and Cap proteins. In the backbone of the pAAV_RC there are more restriction sites in the iGEM standard. These restriction sites should not cause any problems when the insert in cloned into a standard iGEM vector. An other interesting question is what has been changed in the regulatory region p5. This will be important to determine the sequence that is required for the functional expression of the pAAV-RC.

Modification of the Cap genes

Investigator: Volker

The HSPG-binding-motif can be knocked out by the two mutations R585A and R588A.

The sequence 5'-CTC CAG AGA GGC AAC AGA CAA -3' codes in the pAAV-RC construct for the amino acids LQRGNRQ.
In order to achieve the recommanded mutation the sequence has to be changed to: 5'-CTC CAG GCT GGC AAC GCT CAA -3'
which codes for LQAGNAQ.

The problem is that in this R585A R588A KO version there is no possible codon usage to encode a BstEII restriction site that would make it possible to integrate peptides in an easy fashion.
An R585A R588L KO version would contain the BstEII restriction site and could be a possible alternative to the R585A R588A KO version.

Questions to adress on monday:

Is the proposed R585A_R588L_KO mutation possible?
Are iGEM standard vectors availible that do not contain KpnI and BstEII?

Cellculture

Investigators: Patrick, Chris W.

HT1080 cells were split. Deviations from the standart protocol: The cells were centrifuged with 2000 G instead of 200 G. Then the cells were put into the incubator for 4 hours and then examined again. It seems that most of them survived this mistake.

The 293 cells were checked for cell density. They will be >70% confluent tomorrow and therefore transfected.

49.Labortag 04.07.2010:

Transfection nr.3

Investigators: Chris W, Patrick
Transfection with P41 was performed according standart protocol. Two transfektions where carried out with 10µg (3,33 µg each plasmid) DNA and the other two with 20µg DNA (6,66 µg each plasmid).

50.Labortag 05.07.2010:

Sequencing of pAAV_iGEM-mVenus-YFP

Investigator: Hanna
Alignment of sequenced hGH region with pAAV_iGEM_mVenus-YFP delivered following picture:

There seemed to be a nucleotide insertion. But by having a closer look, we recognized that Geneious mis-interpreted the signal at this point. Further on we could validate that YFP was also successfully cloned into this clone. Unfortunately the sequencing of the gene of interest didn't work - neither with the forward, nor with the reverse primer. Their sequences were checked on the order form: Everything OK!
To do: Repeat sequencing of GOI!

Dirty and fancy method for ITR BioBrick production

Investigator: Hanna
A new strategy for ITR BioBrick production was figured out. This method does NOT require any PCR steps! :)
We want to take advantage of the fact, that the ITRs are flanked by NotI and PstI.
"Short version" of the strategy:

Digestion of pAAV_MCS with AlwNI. Result: one large fragment (2982 bp) with right ITR; one small fragment (1674 bp) with left ITR.
Separate fragments via gel run.
Digest them with NotI and PstI.
Präfix and suffix oligos were designed. They need to be hybridized and ligated to the left and right ITR with several intermediate steps (subcloning into pSB1C3 etc.). The oligos posess compatible overhangs to the PstI and NotI restriction sites of the ITR but do not generate new restriction sites after ligation!
For detailed instruction, check up here: File:Freiburg10 ITRBioBrick dirty fancy.pdf

Beta-globin BioBrick production

Investigator: Hanna
The beta-globin sequence (pAAV_MCS) contains no iGEM-restriction sites. Therefore we decided NOT to order the sequence, but to perform a PCR with RFC10 overhang primers:

hGH BioBrick production

Investigator: Hanna
The hGH sequence (pAAV_MCS) contains no iGEM-restriction sites. Therefore we decided NOT to order the sequence, but to perform a PCR with RFC10 overhang primers:

Splitting HT and HEK cells

Investigators: Adrian, Bea
HEK Cells: over 100% confluent!!!
HT-cells: over 90% confluent!!!

Preparation of HT1080 3x6er dishes for Transduction

Investigators: Adrian, Bea
3x 6well dishes got prepared with 3ml DMEM and 300.000 cells (0,0375ml of our Cell-falcon)
Transduction on 6.7.2010

Preparation of 6x10cm petri dishes HEK293

Investigator: Adrian
6x 10cm petri dishes with 10ml with 3.000.000 cells (0,344ml of cell-falcon)
Transfection on 7.7.2010

Repetition of ITR restriction site modification via PCR

Investigator: Achim, Chris

experiment date: 5.7.2010

Because the previous attempt to replace the PSTI and NOTI restriction sites in the ITRs with the IGEM standard were unsucessful, new, longer primers were designed an ordered.
a new pcr reaction with higher annealing temperatures was prepared:

components	v(pAAV_fragment left ITR, 0% DMSO) /µl	v(pAAV_fragment left ITR, 10% DMSO) /µl	v(pAAV_fragment right ITR, 0% DMSO) /µl	v(pAAV_fragment right ITR, 10% DMSO) /µl	positive control from Gerrit: XBL PMA DBSA (106 bp)
10xThermoPol buffer	5	5	5	5	5
dNTP mix	1	1	1	1	1
Primer for	1,5	1,5	1,5	1,5	1,5
Primer rev	1,5	1,5	1,5	1,5	1,5
DNA Template	0,513	0,513	0,415	0,415	0,345
MgSO4	1	1	1	1	1
DMSO	0	5	0	5	0
Vent Polymerase	0,5	0,5	0,5	0,5	0,5
H2O	38,99	33,99	39,09	34,09	39,16
Volume total	50	50	50	50	50

PCR program:

Cycles	Temperature	Time
	95°C	3"
	95°C	30"
10x	62+-2°C	22"
	72°C	12"
	95°C	30"
15x	66+/-2°C	22"
	72°C	12"
1x	72°C	5'
Hold 4°C

The PCR was run

2% agarose gel was prepared. Running the gel at 110 V for 45 minutes.

No bands were observed on the gel -> pcr didn't work.
Possible reasons: *Old Vent polymerase -> New polymerase ordered

Mg concentration could be optimized
Template okay? Template will be loaded on gel as well next time

Search for restriction sites in the sequence LQA/RGQA/RQA

Investigator: Volker

The idea to use a R588L mutation instead of the R588A that is published in the literature was discussed with the supervisers. It was proposed to search for other amino acid exchanges that alter the loop less drastically. For this reason the mutation N587Q was examined for possible restriction sites.

Search for restriction sites in the 585/588 KO loop sequence

:)

Results sequencing alignment of GMK_TK30

Investigator: Bea

Result: The obtained sequencing results indicate that the DNA we received from Amor contains the GMK_TK30 fusion enzyme, but tk30 contains some restriction sites.

Sequence alignment of GMK_TK30

To do (06.07.2010): Order primers for BioBrick Fusionenzyme and order genes of GMK and TK (wtTK, TK30, sr39????)
remove iGEM restriction sites

51.Labortag 6.07.2010:

Harvesting AAVs from 4 10cm dishes, Transduction of 3x6er dishes

Investigators: Adrian, Anna, Bea, Kerstin

We want to investigate which of the following approaches yields a better transduction efficiency.

Half of the transfected cells were exposed 3 cycles of thawing and freezing and then centrifuged (15 ml falcon, 2100G). The supernatant was transfered into a new 15 ml falcon and used for transduction.
The other half was centrifuged at 300 G for 5min . The supernatant was transfered into another 15 ml falcon and the pellet was resuspended with 5 ml of DMEM. The content of these two falcons was also exposed to 3 cycles of thawing and freezing and then used for transduction.

We have got 2 10 cm cellculture dishes with 10µg and 2 dishes with 20µg DNA used for transfection.

Approach with standart protocol (one dish with 10 and the other with 20µg Plasmids)(2100 G and 3 cycles of freezing and thawing)

Deviations from the standart protocol:

The cells were centrifuged at 2100 G instead of 10.000 G
The viruses were harvested after 44 hours
3 cycles of freezing and thawing

Search for restriction sites before and after the insertion sites 453 and 585/588

Investigator: Volker

Transduction of 3x6er dishes

Investigators: Adrian Bea

used plasmids: 10µg, 20µg YFP
we have 10µg and 20µg from standard protocol => SV
we have 10µg and 20µg from standard protocol pellet => Pellet
we have 10µg and 20µg from standard protocol suspension => Super
amount of 500µl

1. Plate I(A is up)

10µg dropped Super	10µg dropped Super gently resuspending	10µg dropped Super gently resuspending
10µg Super gently resuspending Super	20µg dropped Super gently resuspending 1:10 dilution	control

2. Plate I(A is up)

10µg dropped Super	10µg dropped Super gently resuspending	10µg dropped Super gently resuspending
10µg Super gently resuspending Super	20µg dropped Super gently resuspending 1:10 dilution	control

3. Plate I(A is up)

10µg dropped Pellet	10µg dropped Pellet gently resuspending	10µg dropped Pellet gently resuspending
10µg Super gently resuspending Pellet	20µg dropped Pellet gently resuspending 1:10 dilution	control

Search for restriction sites around the 453 and 585/588 integration sites

Investigator: Volker

For this purpose a list of all commercially availible restriction enzymes was created that do not match in the ORFs of pAAV-RC.

Search for restriction sites in the sequence LQA/RGQA/RQA

Investigator: Volker

The idea to use a R588L mutation instead of the R588A that is published in the literature was discussed with the supervisers. It was proposed to search for other amino acid exchanges that alter the loop less drastically. For this reason the mutation N587Q was examined for possible restriction sites.

bla Bla bla

.

52.Labortag 07.07.2010:

Sequencing of GIO

Investigator: Hanna
Comments: Neither sequencing with forward nor with reverse primer (O29 + O30) worked. Therefore P40 (pAAV_iGEM_mVenus-YFP) was sent for sequencing once again.

Name: Hanna P40
V (P40) = 11 µL + 19 µL H2O
Name of primer forward: Hanna 1 (O30)
Name of primer reverse: Hanna 2 (O29)
V(primer) = 3 µL + 27 µL H2O

Interview with Bild der Wissenschaft

Adrian did a good job ;-)
The article will be send to us next week
For additional question, Jessica will be send an email

Transfection

Investigators: Adrian, Bea

Transfection of AAV-293 cells with pAAV_iGEM-mVenus_YFP

New pcr run with new polymerase and different MgSO4 concentrations

While this time the positive control was actually positive, no pcr product could be seen. The reasons are unclear. (Secondary structures, primer binding...)

Checking the results of the following sequencing reactions for the expression constructs from the DKFZ

Investigator: Volker

pKEX-VP1ex: sequence confirmed as described in [Name et al.,] with two pointmutations (ACG=>GCG) and (ATG=>CTG) to avoid the translation of VP2 and VP3.

pKEX-VP2ex: sequence confirmed as described in [Name et al.,] with one mutation (ATG=>CTG) to avoid the translation of VP3 and a second mutation (AAGACG=>CATATG) to switch to the main start codon ATG and to introduce a restriction site (which one??) before the start codon.

pKEX-VP3ex: sequence confirmed as described in [Name et al.,] with two silent pointmutations and a second mutation to introduce a restriction site before the start codon.

pKEX-Rep40ex: Sequence as expected until now, further sequencing reaction required with the primer: GATC_std_pTeSp-1

pKEX-Rep52ex: Point mutation directly at the beginning of the exon sequence, perhaps functionality in this context? At the end of the sequence some umcertainities. For the beginning further sequencing reaction required with the primer: GATC_std_pTeSp-1

pKEX-Rep68ex: One point mutation in the second condon that changes the coded amino acids from P to A, a second mutation (ATG=>GGG) at the beginning of the Rep40/Rep52 ORFs to avoid the translation of these sequences and a silent mutation. One further sequencing reaction is required with the primer: GATC_std_pcDNA1.1-RP.

pKEX-Rep78ex: One point mutation in the second condon that changes the coded amino acids from P to A, a second mutation (ATG=>GGG) at the beginning of the Rep40/Rep52 ORFs to avoid the translation of these sequences, a silent mutation and the same point mutation at the beginning of the exon as seen before in pKEX-Rep52ex.

53.Labortag 08.07.2010:

Final planing of the Cap modifications

Investigator: Volker

Freiburg Final integration site 453 planing.png

Freiburg Final integration site 585 588 planing.png

BbvCI
50|100|10|100 37°
File:Freiburg10 BbvC-I-cutsite 1 v1 000007.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

KpnI
100|75|0|50 37°C + BSA
File:Freiburg10 Kpn-I-cutsite 1 v1 000021.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

SalI
10|100|100|100 37°C
File:Freiburg10 Sal-I-cutsite 1 v1 000016.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

AarI
|||
File:Freiburg10 .gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

ScaI
100|100|10|100 37°C
File:Freiburg10 Sca-I-cutsite 1 v1 00001.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3: 2

BamHI
75|100|100|100 37°C + BSA
File:Freiburg10 BamH-I-cutsite 1 v1 000025.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

PvuII
100|100|100|100 37°C
File:Freiburg10 Pvu-II-cutsite 1 v1 000013.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3: 1

EagI
10|25|100|10 37°C
File:Freiburg10 Eag-I-cutsite 1 v1 000021.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3: 2

54.Labortag 09.07.2010:

Investigators: Anissa, Kerstin, Anna

New DMEM-Medium was prepared (10% FCS). Investigators: Bea, Patrick
HT and 293 cells were split into 4 flasks, 2 flasks each. Investigator: Kira
AAV stocks were prepared, put into the -80°C freezer and labeled with the date, name, AAV, the amount of DNA used for transfection and drop/resuspend to make clear whether the DNA was just pippeted dropwise to the 293 cells or gently mixed with the cells. The numbers on the 15 ml falcons refer to DNA amount and DNA administration, too. Investigator: Patrick

PCR of hgH

PCR program: Unnamed

components	volume of vector /µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
hgH_primer_for	2,5
hgH_primer_rev	2,5
DNA template	0,38
DMSO	-
Phusion polymerase	0,5
H2O	33,1
Total volume (e.g. 50 µl)	50

Agarose-Gel:

0,625 g Agarose, 50 ml TAE (1,25%), 3 µl GELRED (3-6µl), at 110 Volt, running time: 60 minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size (Geneious)
p47: hgH	50 µl	10 µl	488 bp

Marker: GeneRuler ladder mix

	Marker (8 µl)	Sample 50 /µl
Lane	1	4

Gelextraction

Gel measurement:

Sample	weight
p47: hgH	0,13 g

DNA concentration (hgH): 19,83 ng/µl

Comments: PCR was succesful:-) to do: Ligation of PCR product into standard plasmid which we´ve received wihthin the DNA distrivution kit of iGEM-HQ .

Order oligos for GMK_TK30

Investigator: Bea
Oligos have been ordered at sigmaaldrich in order to insert prefix and suffix to fusionenzyme mGMK_TK30 in RFC25.

Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010.jpg

Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010 page2.jpg

Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010 page3.jpg

to do: Order gene tk30 and part of gene sr39

Quickchange for the PstI restriction sites in pAAV-RC

Investigators: Kira and Volker
Quick change, Gel and test digestion with PstI. (more precise informations will be added)
@Kira and Volker: did the Quickchange actually work? Could you please add the information onto the wiki!! Thx!

PCR program: PstI

components	volume in µl
10x Phusion HF buffer	2.5 µl
10 mM dNTP mix	0.5 µl
__310 ____primer_for (1:10 dilution)	0,39 µl
__310____primer_rev (1:10 dilution)	0,39 µl
DNA template (1:40 dilution)	0,5 µl
DMSO	0 µl
Phusion polymerase	0.5 µl
H2O	20,22 µl
Total volume (e.g. 50 µl)	25 µl

components	volume in µl
10x Phusion HF buffer	2.5 µl
10 mM dNTP mix	0.5 µl
__4073____primer_for (1:10 dilution)	0.33 µl
___4073___primer_rev (1:10 dilution)	0.33 µl
DNA template (1:40 dilution)	0.5 µl
DMSO	0 µl
Phusion polymerase	0.5 µl
H2O	20.32 µl
Total volume (e.g. 50 µl)	25 µl

cycles	temperature	time
1	95 C	2 min
20	95 C	30 sec
	66 C	1 min
	68 C	5 min

The PCR-products were digested with DpnI (1µl instead of 0.5 µl)
aragose gel revealed for both samples very distinct bands

TEST DIGESTION

components	volume /µl
DNA	10
BSA (10x)	2
Buffer 3 (10x)	2
Enzyme (no.Lab: 48)	1
H2O	5
Total volume	20

agarose gel was performed with digested samples and revealed 3 distinct bands, while only 1-2 bands have been expected. Because of the density of the bands it might be that the digestion with DpnI did not work properly, thus additional 1 µl of DpnI was added to each sample. Incubation @ 37 C lasted 1 h.

55.Labortag 11.07.2010

Splitting of HT1080 cells

Investigator: Patrick
HT 1080 and HEK 293 cells were split.
@ Kira: fetch new trypsin if it is not sufficient for the next splitting !

56.Labortag 12.07.2010:

Cloning CFP into pSB1C3

Investigator: Anna, Kerstin, Anissa

Practical Cloning:

experiment date: 12.07.2010 ; time: 11.00
plasmid: pSB1c3_CFP (p48)
- Vector: name: pSB1c3 number:- production date: - origin: iGEM
- Insert: name: pMA_CFP number:- production date: - origin: Sven
new vector name: pSB1c3_CFP (p48)
buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:28) EcoRI ; Enzyme 2 (no.Lab:48) PstI ;Enzyme 3 (no.Lab:77) DpNI
DNA concentration (vector): 25 µg/µl ; DNA concentration (insert): 436,8 µg/µl

Comments:Third enzyme was only used to digest template from vector pcr

Digestion

components	volume of vector /µl	volume of insert /µl
DNA	4	5
BSA (100x)	0,2	2
Buffer ____ (10x)	1,5	2
Enzyme 1 (no.Lab:23)	0,5	1
Enzyme 2 (no.Lab:48)	0,5	1
Enzyme 3 (no.Lab:77)	0,5	1
H2O	7,8	9
Total volume (e.g. 15,20,25,30 µl)	15	20

Incubation: 1h

Agarose-Gel:

0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED (3-6µl), at 110 Volt, running time:45 minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)	Expected size 3 (Geneious)	Expected size 4 (Geneious)
2	20 µl	3,3 µl	732 bp (Insert)	2074 bp (Vector)	____ bp	____ bp

Marker: GeneRuler ladder mix

	Marker	Sample 23,3 µl
Lane	1	3

Gelextraction

Gel measurement:

Sample	weight
2 (Insert)	0,14g

Ligation

	Insert	Vector
Volume/µl	6,77 µl	2,23 µl

TRAFO-EVALUATION

Unfortunately the agar plate with p48, pSB1c3_CFP [XL1B, Cm, A.B.] does not contain any colonies. Thus, the plate was incubated @ 37 C for another 5 hours. Still no detectable colonies. This was double checked by Sven.

Seeding HT1080 + Passage

Investigators: Adrian, Patrick
3* 6well dishes

3*10^5 cells	3*10^5 cells	3*10^5 cells
3*10^5 cells	3*10^5 cells	3*10^5 cells

The amount of cells was doubled in first place and diluted in following steps (for further information ask patrick and adrian)

PCR of beta-globin:

Investigator: Achim
PCR program: BETA...(?)

components	volume of vector /µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
beta-globin_primer_for	2,5
beta-globin_primer_rev	2,5
DNA template	8 ng
DMSO	-
Phusion polymerase	0,5
H2O	33,2
Total volume (e.g. 50 µl)	50

Agarose-Gel:

0,625 g Agarose, 50 ml TAE (1,25%), 3 µl GELRED (3-6µl), at 115 Volt, running time: 30 minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size (Geneious)
p49: beta-globin	50 µl	10 µl	509 bp

Marker: GeneRuler ladder mix

	Marker (8 µl)	Sample 50 /µl
Lane	1	4

Gelextraction

Gel measurement:

Sample	weight
p49: hgH	0,21 g

DNA concentration (hgH): 34,87 ng/µl

Comments: PCR was succesful:-)
to do: Ligation of PCR product into standard plasmid which we´ve received wihthin the DNA distrivution kit of iGEM-HQ .

Midi-Prep preparation pAAV_RC

Investigator: Bea

200mL LB-Medium and 200µl Amp
inoculated with glycerol stock containing pAAV_RC
20:00 p.m.: put intp 37°C room on shaker

First steps in producing ITR BioBricks via Fancy Method

Investigators: Hanna, Chris W.

Digestion of pGA14_Cerulean-CFP

1. Digestion with EcoRI and NotI:

components	volume of vector /µl
DNA	3.5
BSA (10x)	2
Buffer 3 (10x)	2
Enzyme EcoRI (no.Lab:23)	1
Enzyme NotI (no.Lab:46)	1
H2O	10.5
Total volume	20

Incubation: 1.5 hours, 37°C

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 0.15 g
Gel extraction was performed following the standard protocol.

DNA concentration: 26.8 ng/µL

1. Digestion with XbaI and PstI:

components	volume of vector /µl
DNA	3.5
BSA (10x)	2
Buffer 3 (10x)	2
Enzyme XbaI (no.Lab:63)	1.25
Enzyme PstI (no.Lab:48)	0.75
H2O	10.5
Total volume	20

Incubation: 1.5 hours, 37°C

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 0.17 g
Gel extraction was performed following the standard protocol.

DNA concentration: 22.9 ng/µL

Digestion of pAAV_MCS (P9) with AlwNI

components	volume of vector /µl
DNA	11.6
BSA (10x)	-
Buffer 4 (10x)	2.5
Enzyme AlwNI (no.Lab:120)	2.5
H2O	8.4
Total volume	25

Incubation: 1 hours + 20 minutes, 37°C

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment sizes: 2982 bp = right ITR and 1674 bp = left ITR

Gel extraction:

Sample: right ITR = 0.15 g
Sample: left ITR = 0.12 g

Gel extraction was performed following the standard protocol.

DNA concentration:

right ITR: 44.5 ng/µL
left ITR: 32.8 ng/µL

Digestion of ITR fragments with NotI and PstI

Digestion of both fragments was performed as follows:

components	volume of vector /µl
DNA	19 µL
BSA (10x)	1.5
Buffer 3 (10x)	2.5
Enzyme NotI (no.Lab:46)	1
Enzyme PstI (no.Lab:48)	1
H2O	-
Total volume	25

Incubation: 1 hours + 15 minutes, 37°C

Gel run:

due to the small fragment sizes, we prepared a 2% agarose gel: 1.3 g agarose + 65 ml TAE buffer
25 µL of each sample + 5 µL loading dye (6x); 8µL marker
Expected fragment sizes: ~ 150 bp (both)
Big problem: Small fragments and little amounts -> 150 bp fragments were nearly not visible. In addition to that, the right ITR sample delivered 2 fragments in the referring range. Therefore two gel extractions ("right ITR oben" and "right ITR unten") were performed.

Gel extraction:

Sample: right ITR oben = 0.11 g
Sample: right ITR unten = 0.12 g
Sample: left ITR = 0.2 g

Gel extraction was performed with special columns provided from Sven. In order to elute the samples 12 µL EB were used, columns were placed for 2 minutes into 50°C water bath and then centrifuged at 13200 rpm for 1 minute.

DNA concentration:

right ITR oben: 23.9 ng/µL
right ITR unten: 13.8 ng/µL
left ITR: 4.46 ng/µL

Hybridization of ITR-Präfix-Oligos

left ITR:

10 µL Oligo 1 (O43 = Präfix_for)
10 µL Oligo 2 (O44 = Präfix_rev)
4 µL 100 mM TrisHCl pH8
8 µL 5 mM MgCl2
8 µL H2O

Total: 40 mL

right ITR:

10 µL Oligo 1 (O47 = Präfix_for)
10 µL Oligo 2 (O48 = Präfix_rev)
4 µL 100 mM TrisHCl pH8
8 µL 5 mM MgCl2
8 µL H2O

Total: 40 mL

Because some of the oligos produce strong secondary structures, we used the ORIGAMI1 program:
1) initial denaturation: 99°C, 7 minutes
2) 99°C, 1 minute
3) 73 x repetition of 2) -> -1°C, R = 0.3 °C/sec
4) hold 4°C

Ligation of pGA14 + ITR + Präfix

1. right ITR oben:

Präfix: 1 µL
ITR: 7 µL
vector (pGA14): 9 µL
buffer: 2 µL
T4 ligase: 1 µL

Total volume: 20 µL

2. right ITR unten:

Präfix: 1 µL
ITR: 7 µL
vector (pGA14): 9 µL
buffer: 2 µL
T4 ligase: 1 µL

Total volume: 20 µL

3. left ITR:

Präfix: 1 µL
ITR: 7 µL
vector (pGA14): 9 µL
buffer: 2 µL
T4 ligase: 1 µL

Total volume: 20 µL

Samples will be incubating over night at 16°C.

Ordering genes for the replacement of Rep and Cap parts

Investigator: Volker guided by Sven & Tobi

The replacement for the Rep ORF from base 1510 to base 2008 and for the Cap ORF from base 3064 to base 3985 was ordered from Mr. Gene.

File:Freiburg10 Rep Cap Replacement.pdf

Sequencing of GOI

Investigator: Hanna
This time the sequencing delivered good results:

Conclusion: The designed primers can always be used in order to sequence any gene of interest!!!

57.Labortag 13.07.2010:

Endotoxin-free Midi Prep of pAAV_RC

Investigators: Chris, Stefan, Patrick
Deviations from the Standard Protocol:
As the lysate was applied to the column filter, about 1/5 of the lysate was spilled.
Result of the Midi-prep: about 18 ng/µl => waste
A new Midi-Pred will be prepared for tomorrow: 200 ml LB, 0,2 ml Amp, E.coli XL-1-blue (with pAAV_RC plasmid).

HEK-293 cells

The cells were split according to the standard protocol. Investigator: Patrick

Oligos pMGMK_TK30 arrived

New Oligos arrived for inserting RFC25 to thymidinkinase_gmk construct!(number O60 to O65). They were resuspended in water and a 1:10 dilution was done. They were put in Primer Box 2.

to do: perform PCR tomorrow and clone PCR product into pAAV_RFC25

Transduction

Investigators: Adrian, Patrick

3 Plates got transduced

1. Plate I(A is up) completely 10 µg

300µl dropped	300µl resuspended	450µl resuspended
600µl dropped	600µl resuspended	control

2. Plate II(A is up)completely 18 µg

300µl dropped	300µl resuspended	450µl resuspended
600µl dropped	600µl resuspended	control

3. Plate III(A is up) completely 24 µg

300µl dropped	300µl resuspended	450µl resuspended
600µl dropped	600µl resuspended	control

Results of Trafo of cloning CFP into pSB1C3

Investigator: Bea
Results: no clones on trafo plate even after longer incubation at 37 °C
Solution: perform digestion of linearized plasmid pSB1C3 and pMA_CFP again!!!

Repetition of cloning of CFP into pSB1C3

Investigator: Bea

experiment date: 13.07.2010 ; time: 16:00
- Vector: name: pSB1c3 number: do not have any number production date: - origin: iGEM HQ sent per DNA distribution kit
- Insert: name: pMA_CFP number:- production date: - origin: iGEM 2009
new vector name: pSB1c3_CFP (P48)
buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab: 23) EcoRI ; Enzyme 2 (no.Lab: 48) PstI ;Enzyme 3 (no.Lab: 77) DpnI
DNA concentration (vector: pSB1C3): 25 ng/µl ; DNA concentration (insert pMA_CFP): 436,8 µg/µl

Comments:The standard plasmid vector (pSB1C3) received from the iGEM HQ is linearized (PCR product) and need to be cut with EcoRI, PstI and optionally with DpnI to digest the DNA template.

Digestion of pSB1C3 and pMA_CFP

components	volume of pSB1C3 /µl	volume of pMA_CFP /µl
DNA	4	4,6
BSA (100x)	1,5	2
Buffer 3 (10x)	1,5	2
Enzyme EcoRI (no.Lab:23)	0,5	1
Enzyme PstI (no.Lab:48)	0,5	1
Enzyme DpnI (no.Lab:77)	0,5	-
H2O	6,5	9
Total volume (e.g. 15,20,25,30 µl)	15	20
Incubation	30 min at 37°C in PCR cycler	45min at 37°C in PCR cycler
commment	after digestion: 80°C 20 min heat kill	load on agarose gel

Load pMA_CFP digestion reaction onto 1% agarose gel

1% Agarose-Gel

0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED (3-6µl), at 110 Volt, running time:45 minutes

Sample	Sample/µl]	Loading dye (/6x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
pMA_CFP	20 µl	4 µl	732 bp (Insert)	2974 bp (Vector)

Loading plan for agarose gel:
Marker used: GeneRuler ladder mix (Fermentas)

	Marker	Sample 24 µl
Lane	1	3

Results: Expected bands too high, but lower band (= CFP) was cut out and gel extraction have been performed folowing standard protocol.

Gel extraction

has been performed and Nanodrop measurement reveals following concentraion of the insert CFP:

c(CFP)= 6,75ng/µL

Ligation ratio of vector/insert was calculated with LabTools
v(pSB1C3)= 4,4 µL
v(CFP)= 4,6 µL
vQuickligase Buffer (2x)= 10µL
vQuickLigase = 1µL

Transformation

used bacterial strain: XL-1B
2µL of DNA (pSB1C3_CFP)
Trafo plate in 37°C room for incubating at 23:00

TRANSFORMATION of Quickchange PstI

Investigator: Kira

Transfection was performed according to the standard protocol with XL1B cells.

58.Labortag 14.07.2010

Trafo evaluation of Quickchange PstI

Investigator: Kira
Both plates contained lots of colonies, while 8-10 colonies are considered for inoculation to perform a mini prep and an additional test digestion. However, the experiment has to be repeated.

Quickchange for the PstI restriction sites in pAAV-RC (modified)

Investigators: Kira

PCR program: PstI

components	volume in µl
10x Phusion HF buffer	2.5 µl
10 mM dNTP mix	0.5 µl
__310 ____primer_for (1:10 dilution)	0,39 µl
__310____primer_rev (1:10 dilution)	0,39 µl
DNA template (1:40 dilution)	0,5 µl
DMSO	0.5 µl
Phusion polymerase	0.5 µl
H2O	19.72 µl
Total volume (e.g. 50 µl)	25 µl

components	volume in µl
10x Phusion HF buffer	2.5 µl
10 mM dNTP mix	0.5 µl
__4073____primer_for (1:10 dilution)	0.33 µl
___4073___primer_rev (1:10 dilution)	0.35 µl
DNA template (1:40 dilution)	0.5 µl
DMSO	0.5 µl
Phusion polymerase	0.5 µl
H2O	19.82 µl
Total volume (e.g. 50 µl)	25 µl

cycles	temperature	time
1	95 C	2 min
20	95 C	30 sec
	68 C	7 min

PCR products were digested with 0.5 µl and incubated @ 37 C for 1 h

TRANSFORMATION

The transformation of XL1B was performed according to the standard protocol but with DYT instead of LB.

Results of trafo cloning pSB1C3_CFP

Investigator: Bea
Comments: experiment have been repeated because no clones were grown after the last trafo!

There have been clones grown on the trafo plate. Four clones were picked and inoculated on LB_Medium containing Cm (Chloramphenicol).
18:00: 37°C room on shaker. Incubating over night!

Seed AAV-293

Investigators: Adrian ,Bea

2x75cm2 culture flasks
after counting via neubauer chamber (2,2*20*10000*(x/4))= should be around 3,xxx so it would be possible to prepare 4x10cm petri dishes with 3.000.000 cells per plate and passage 1.500.000 cells to a 75cm.

DAAD Timetable

Investigators: Adrian, Kerstin Prepared timetable for DAAD

Summary

Investigators: all

have not been done yet! to do for tomorrow! deadline of submitting project descrpition is 16th of july!! (Bea)

Ordering ITR+TK/GMK

Investigators: Bea, Sven

It has been ordered the TK30 with NgoMIV add-on prefix and ageI and SpeI add-on suffix combined with the wt_left_ITR in the RFC10 standard.

Endotoxoin free Midi prep mAAV_RC

Investigator: Chris W.
Midi prep done with the Qiagen-Kit
OD of the Bacteria: 3.07
concentration: 429,8 and 378,5 ng/µl
Labeled as P50 and stored in the -20° Freezer

MGMK_TK30:PCR with iGEM restriction-sites and cloning into pAAV_RFC25

Investigators: Achim,Bea,Anissa

PCR:

PCR program:mGMK_TK30

components	volume in µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
pMGMK_TK30_RFC25_prefix_for (060) (1:10 dilution)	2,5 (0,5 µM)
pMGMK_TK30_RFC25_suffix_rev (063) (1:10 dilution)	2,5 (0,5 µM)
DNA template	~8 ng
DMSO	-
Phusion polymerase	0,5
H2O	fill up to 50 µl
Total volume (e.g. 50 µl)	50

Comments:Oligos with add-on tails (prefix and suffix), but TK30 still contains three iGEM restriction sites (TK30 without restriction sites was ordered today)

Practical Cloning:

- Vector: name:pAAV_RFC25 number:p42
- Insert: name: MGMK_TK30 (after PCR with iGEM standard) number:-
new vector name: pAAV_RFC25_MGMK_TK30
buffer used:4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:149) AgeI ; Enzyme 2 (no.Lab:63) XbaI
DNA concentration (vector):321,5 ng/µl ; DNA concentration (insert):

Comments:_____

Digestion

components	volume of vector /µl	volume of insert (=PCR product) /µl
DNA	3,1 (1 µg)	30 (0,691 µg)
BSA (100x)	2	5 µl
Buffer 4 (10x)	2	5µl
AgeI (no.Lab:149)	1	2 µl
XbaI(no.Lab:63)	0,75	1 µl
H2O	11,15	7 µl
Total volume (e.g. 15,20,25,30 µl)	20	50 µl

Incubation: Vector: 1h; PCR product: 2h

Agarose-Gel:

0,5 g Agarose, 50 ml TAE (1%), 3 µl GELRED (3-6µl), at 110 (PCR); 115 (vector) Volt, running time:____ minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size (Geneious)
PCR product	50 µl	10 µl	~1692 bp
vector	20 µl	4 µl	4646 bp

Marker: GeneRuler ladder mix

	Marker	Sample 60 /µl
Lane	8 µl	PCR

Marker: GeneRuler ladder mix

	Marker	Sample 24 /µl
Lane	8 µl	vector

Comments: two gels were made, one for the vector, one for the pcr product

Gel extraction was carried out according to standard protocol
Nanodrop:
- pAAV_rfc 25 Digestion: 15,07 ng/µl
- mgmk tk30 pcr product: 23,04 ng/µl

Puricifation using Quiagen QIAquick PCR Purification Kit Protocol
- c(mgmk_tk30) = 8,1ng/µL
Ligation of mgmk tk30 and pAAV_rfc 25
- v(vector) = 2,97 µL
- v(insert) = 6,03 µL

Trafo
put in 37°C room at 22:00

Ordering of Oligos

Investigator:Volker

The following four Oligos were ordered:

SDM BamHI (729) for
SDM BamHI (729) rev
SDM SalI (1110) for
SDM SalI (1110) rev

59.Labortag 15.07.2010

Picking clones for mini-prep

Investigators: Adrian, Chris, Stefan

4 clones (1-4) of pAAV_RFC25_mgmk_tk30 where picked according to protocol for mini-prep (tomorrow).
Antibiotic: Amp
Time: 18:30
Investigators: Stefan, Patrick
New millipore H2O, LB + Agar and DMEM medium were prepared

Splitting of HT1080 cells

Investigators: Chris, Patrick
HT 1080 cells were split according to the standard protocol

PstI Quickchange Trafo from 14.07

Investigator: Kira
Trafo evaluation: Unfortunately no colonies are present.

MINI PREP (PstI Quickchange Trafo from 13.07)

Investigator: Kira

@Kira: ich habe die Clone benannt: SDM310 Nr. 1 ist jetzt P58 und sdm4073 nr 1 ist jetzt P59. Bitte eintragen.

TEST DIGESTION (PstI Quickchange Trafo from 13.07)

Investigator: Kira

FACS

Investigators: Kerstin, Anna

FACS analysis of different treated HT1080 cells was done (18 samples)

The first percentage refers to the living and fluorescent cells and the second percentage to the total amout of living cells.

The data are listed this way:

1. Plate I(A is up)

A1	A2	A3
B1	B2	B3

1= Plate 1 A1 : 0% YFP-positive Cells (there were only a few cells in this sample)
2= Plate 1 A2 : 27,7% YFP-positve Cells from 73,3%
3= Plate 1 A3 : 17,3% " from 63,1%
4= Plate 2 A1 : 32,9% " from 75,3%
5= Plate 2 A2 : 27,2% " from 76,5%
6= Plate 2 A3 : 30,7% " from 73,4%
7= Plate 3 A1 : 26,8% " from 76,0%
8= Plate 3 A2 : 30,5% " from 74,2%
9= Plate 3 A3 : 30,7% " from 75,2%
10= Plate 1 B1 : 6,25% " from 36,1%
11= Plate 1 B2 : 6,42% " from 68,4%
12= Plate 1 B3 : 0,05% " from 89,5%
13= Plate 2 B1 : 20,5% " from 72,5%
14= Plate 2 B2 : 15,7% " from 73,6%
15= Plate 2 B3 : 0,02% " from 85,4%
16= Plate 3 B1 : 19,5% " from 73,3%
17= Plate 3 B2 : 20,8% " from 75,7%
18= Plate 3 B3 : 0,07% " from 84,8%

The calculated value written into the table describes the fluorescent amount of cells from the living cells. Example: 1 A2 : 27,7% YFP-positve cells of 73,3% living cells : 27,7/73,3 = 0,378

1. Plate I(A is up) completely 10 µg

300µl dropped 0,00	300µl resuspended 0,378	450µl resuspended 0,274
600µl dropped 0,173	600µl resuspended 0,094	control 5,6x10^-4

2. Plate II(A is up)completely 18 µg

300µl dropped 0,437	300µl resuspended 0,356	450µl resuspended 0,418
600µl dropped 0,283	600µl resuspended 2,1x10^-3	control 2,3x10^-4

3. Plate III(A is up) completely 24 µg

300µl dropped 0,353	300µl resuspended 0,411	450µl resuspended 0,408
600µl dropped 0,266	600µl resuspended 0,275	control 8,3x10^-4

Conclusions

Higher amounts of Plasmids (24, 30µg) seems to have no obvious effect on YFP expression
Theres no difference in YFP expression comparing resuspended samples to not resuspended samples
The amount of dead HT cells is about 25%, it is not clear if it is either AAV induced or mechanic stress (Trypsin, washing procedure)

Next steps:

does the amount of GOI (ng plasmids) has an effect on YFP expression
compare transduced to non transduced cells (vitality), or in other words is the mechanic stress responsible for 25% dead cell ratio?
comparison of transduction efficiency of different virus stock production routines

Plasmid Mini-Prep of pSB1C3_CFP

Investigators: Kerstin, Anissa

experiment date: 15.07.2010 ; time:10.00
new vector name:pSB1C3_CFP

Glycerol Stocks

	Clone 1	Clone 2	Clone 3	Clone 4
Bacteria strain	XL1 blue	XL1 blue	XL1 blue	XL1 blue
Plasmidname	pSB1C3_CFP	pSB1C3_CFP	pSB1C3_CFP	pSB1C3_CFP
Date	15.7.2010	15.7.2010	15.7.2010	15.7.2010
given glycerol-stock no.	B38	B39	B40	B41
given plasmid no.	p48	p51	p52	p53

Test digestion

buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:48)PstI ; Enzyme 2 (no.Lab:23) EcoRI
Plasmid
- Given Plasmid-Number: p48; DNA concentration: 195,1 ng/µl ;
- Given Plasmid-Number: p51; DNA concentration: 230,1 ng/µl;
- Given Plasmid-Number: p52; DNA concentration: 134,1 ng/µl;
- Given Plasmid-Number: p53; DNA concentration: 244,1 ng/µl;

Comments:p48 and p51 were sequenced

Components	Volume/µL	Mastermix
DNA	Variable (800-1000 ng)	-
BSA (100x)	1,5	7,5
Buffer no.3 (10x)	1,5	7,5
Enzyme 1 (no. Lab:48 )	0,5	2,5
Enzyme 2 (no. Lab:23 )	0,5	2,5
H2O	variable	-
Total volume	15	-

Sample	Volume sample/ µl	Volume H2O / µl
p48	5	6
p51	4	7
p52	7	4
p53	4	7

Incubation: 1h

Agarose-Gel:

0,5 g Agarose, 50 TAE (1%), 3GELRED (3-6µl), at 110Volt, running time:30 minutes

Sample	Sample/µl]	Loading dye (6x)/µl	Expected size (Geneious)
p48	15 µl	3 µl	700 bp
p51	15 µl	3 µl	700 bp
p52	15 µl	3 µl	700 bp
p53	15 µl	3 µl	700 bp

Marker: GeneRuler ladder mix

	Marker	Sample p48 /µl	Sample p51 /µl	Sample p52 /µl	Sample p53 /µl
Lane	8 µl	18µl	18µl	18µl	18µl

Comments: Gel was leaky, therefore two samples "flew through". Plasmid p48 and p51 were sent for sequencing.

2nd try: First steps in producing ITR BioBricks via Fancy Method

Investigator: Hanna

Unfortunately it turned out, that the digestion step of the 1st try didn't work: After the transformation very much colonies grew on the plates. Sequencing delivered, that survival of the bacteria was due to re-ligated vector... Therefore the whole experiment will be performed again today.

Digestion of pGA14_Cerulean-CFP

1. Digestion with EcoRI and NotI:

components	volume of vector /µl
DNA	3.4
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme EcoRI-HF	1
Enzyme NotI-HF	1
H2O	10.6
Total volume	20

Incubation: 1.5 hours, 37°C in thermocycler

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 0.31 g
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C.

DNA concentration: 43 ng/µL

1. Digestion with XbaI and PstI:

components	volume of vector /µl
DNA	3.4
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme XbaI	1
Enzyme PstI-HF	1
H2O	10.6
Total volume	20

Incubation: 1.5 hours, 37°C in thermocycler

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 0.31 g
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C.

DNA concentration: 38.6 ng/µL

Digestion of pAAV_MCS with AlwNI

components	volume of vector /µl
DNA	17.86 = 5 µg
BSA (10x)	-
Buffer 4 (10x)	3
Enzyme AlwNI (no.Lab:120)	3
H2O	6.14
Total volume	30

Incubation: 1.5 hours , 37°C in thermocycler

Gel run: 30 µL sample + 6 µL loading dye (6x); 8µL marker
Expected fragment sizes: 2982 bp = right ITR and 1674 bp = left ITR

Gel extraction:

Sample: right ITR = 0.19 g
Sample: left ITR = 0.17 g

Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C. Further on 30 µL EB-buffer was used.

DNA concentration:

right ITR: 59.8 ng/µL
left ITR: 46.2 ng/µL :)

Digestion of ITR fragments with NotI and PstI

Digestion of right ITR fragment:

components	volume of vector /µl
DNA	30 µL
BSA (100x)	0.5
Buffer 4 (10x)	3.74
Enzyme NotI-HF	1.5
Enzyme PstI-HF	1.5
H2O	-
Total volume	37.4

Incubation: 50 minutes, 37°C in thermocycler

Digestion of left ITR fragment:

components	volume of vector /µl
DNA	30 µL
BSA (100x)	0.5
Buffer 4 (10x)	3.72
Enzyme NotI-HF	1.5
Enzyme PstI-HF	1.5
H2O	-
Total volume	37.2

Incubation: 50 minutes, 37°C in thermocycler
Gel run:

due to the small fragment sizes, a 2% agarose gel was prepared.
5 µL loading dye was added to the whole volume of each sample; 8µL marker
115 V, 40 minutes
Expected fragment sizes: ~ 150 bp (both)
Problem: Small fragments, little amounts, blurred 150 bp bands -> fragments were cut out broad-minded.

Gel extraction:

Sample: right ITR oben = 0.4 g
Sample: left ITR = 0.36 g

Gel extraction was performed following standard protocol. After applying EB buffer to the columns, they were placed for 2 minutes into 50°C water bath and then centrifuged at 13200 rpm for 1 minute.

DNA concentration:

right ITR: 4 ng/µL
left ITR: 4 ng/µL

Hybridization of ITR-Präfix-Oligos

left ITR:

10 µL Oligo 1 (O43 = Präfix_for)
10 µL Oligo 2 (O44 = Präfix_rev)
4 µL 100 mM TrisHCl pH8
8 µL 5 mM MgCl2
8 µL H2O

Total: 40 mL

right ITR:

10 µL Oligo 1 (O47 = Präfix_for)
10 µL Oligo 2 (O48 = Präfix_rev)
4 µL 100 mM TrisHCl pH8
8 µL 5 mM MgCl2
8 µL H2O

Total: 40 mL

Because some of the oligos produce strong secondary structures, we used the ORIGAMI1 program:
1) initial denaturation: 99°C, 7 minutes
2) 99°C, 1 minute
3) 73 x repetition of 2) -> -1°C, R = 0.3 °C/sec
4) hold 4°C

Ligation of pGA14 + ITR + Präfix

1. right ITR

Präfix: 2 µL
ITR: 10 µL
vector (pGA14): 5 µL
buffer: 2 µL
T4 ligase: 1 µL

Total volume: 20 µL

2. left ITR

Präfix: 2 µL
ITR: 10 µL
vector (pGA14): 5 µL
buffer: 2 µL
T4 ligase: 1 µL

Total volume: 20 µL

3. control 1:

vector 1 (pGA14, digested with EcoRI + NotI): 5 µL
buffer: 2 µL
T4 ligase: 1 µL
H2O: 12 µL

Total volume: 20 µL

4. control 2:

vector 2 (pGA14, digested with XbaI + PstI): 5 µL
buffer: 2 µL
T4 ligase: 1 µL
H2O: 12 µL

Total volume: 20 µL

Samples will be incubating over night at 16°C. To do: Trafo (Agar plates were already prepared.)

60.Labortag 16.07.2010

Continuation of Fancy ITR-method

Investigator: Hanna

Trafo

Trafo was performed following standard protocol. Aberration: Instead of 2 µL, 3 µL DNA was added to BL21 bacteria (50 µL).

right ITR

It turned out, that the strategy by digesting pGA14 with XbaI and PstI cannot work. pGA14 needs to be digested with EcoRI and PstI:

Digestion of pGA14_Cerulean-CFP with EcoRI and PstI

components	volume of vector /µl
DNA	3.4
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme EcoRI-HF	1
Enzyme PstI-HF	1
H2O	10.6
Total volume	20

Incubation: 1 hour, 37°C in thermocycler

Gel run: 1% gel, 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 170 mg
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C.

DNA concentration: 26.8 ng/µL

Digestion of pAAV_MCS with NotI and PstI

In order to create ITRs with NotI and PstI restriction sites, the AlwNI-digestion step was skipped. Therefore 50% of the constructs will also contain the left ITR... this means: picking more colonies and sequencing!

components	volume of vector /µl
DNA	10.71
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme EcoRI-HF	1
Enzyme PstI-HF	1
H2O	3.29
Total volume	20

Incubation: 1 hour, 37°C in thermocycler

Gel run: 2% gel, 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 150 bp
Gel run delivered no satisfying results. Therefore the gel was discarded and the strategy changed: The residual right ITR solution of yesterday's elution will be taken for ligation.

Ligation of right ITR + Präfix + pGA14

ITR: 7 µL
pGA14: 7 µL
Präfix: 1.5 µL
Buffer: 2 µL
T4 ligase: 1 µL
H2O: 1.5 µL

Total: 20 µL

pGA14: 7 µL
Buffer: 2 µL
T4 ligase: 1 µL
H2O: 10 µL

Total: 20 µL

The ligation-solution will be incubating over night.

To do:

Mini-Prep of pGA14_präfix_leftITR
Trafo of pGA14_präfix_rightITR
Midi-Prep of pGA14

Results sequencing of pSB1C3_CFP

Investigator: Bea
Plasmid: pSB1C3_CFP
Primer used: VR2
Plasmid names: P48_KK and P51_AB
Comments: Sequencing results of cloning experiment performed at 14.-15.07.2010.

Results: Sequencing reads are good. Cloning of CFP into pSB1C3 can be confirmed. There are no insertions, transitions or deletions in the sequence or the iGEM restriction sites. Using this plasmid in order to create our iGEM BioBricks in RFC10 standard can be confirmed.

Sequencing results of pSB1C3_CFP (plasmid number P48). There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).

Sequencing results of pSB1C3_CFP (plasmid number P51). There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).

BioBrick production with hGH and beta-globin by cloning it into pSB1C3

Investigator: Bea
Plasmid: pSB1C3_CFP
Plasmid names: pSB1C3 (P51 or P48) and PCR prdouct of hGH and beta-globin

Comments: While cloning theoretically the hGH PCR product into the vector pSB1C3, it was recognized that the primers that were used for PCR for

hGH RFC10 production and
beta-globin intron RFC10 production

do not contain the required "G" at the end of the prefix and the "T" in the suffix add-on in the RFC10 standard. They were already used by performing a PCR with the add-on prefix and suffix primer, but we did not clone it into the pSB1C3 because of the wrong add-on tails. Therefore new primers were designed and ordered.

Freiburg10 BioBrick beta-globin missing G.jpg

Ordered oligos:

hGH

suffix (reverse)
prefix (forward)

beta-globin

suffix (reverse)
prefix (forward)

CMV

suffix (reverse)
prefix (forward)

TK_GMK

tk_gmk_prefix for
tk_gmk_suffix_rev
gmk_suffix_rev

To do: Upload cloning strategy of tk_gmk and BioBrick production

--Bea 15:21, 16 July 2010 (UTC)
Comment: reverse beta-globin primer is correct!? (Hanna)

Transfection

Investigator: Adrian
30µg Plasmid were used (pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30)
VIRUS nix:pHelper + pAAV_RC
VIRUS 1 :pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30 clone 1 : P54
VIRUS 2 :pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30 clone 2 : P55
VIRUS 3 :pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30 clone 3 : P56

Mini Prep of pAAV_RFC25_mgmk_TK30

Investigator: Adrian 4ml were preparated

pAAV_RFC25_mgmk_TK30 clone1 conc: 291,43 ng/µl : P54
pAAV_RFC25_mgmk_TK30 clone2 conc: 243,99 ng/µl : P55
pAAV_RFC25_mgmk_TK30 clone3 conc: 247,00 ng/µl : P56
pAAV_RFC25_mgmk_TK30 clone4 conc: 246,01 ng/µl : P57

Test digestion of all four plasmids to check if the mgmg_TK30 insert is present. Investigator: Patrick, Chris
Each digestion sample:

0,2 µl BSA (I picked the wrong tube. It should have been 2 µl BSA)
2 µl Buffer 4
0,5 µl XbaI
0,5 µl SpeI
13,8 µl H2O
3 µl DNA

Digestion: 65 minutes, 37°C. Results: No mgmk_TK30 insert detectable. I will try it again on saturday or sunday.

Preparation of 50x TAE and 0,5M EDTA

Investigators: Chris W., Patrick

1 L TAE (50x)

242 g tris base
57.1 ml glacial acetic acid
100 ml 0.5 M EDTA
ad 1 L Milipor

1 L EDTA (0.5 M)

146,13 g Ethylendiamintetraessigsäure
ad 800 ml Milipor
~20 g NaOH
pH mit NaOH auf 8 einstellen
ad 1 L Milipor

Test digestion of the QuickChange for PstI (310) and PstI (4073)

Investigator: Kira & Volker

The digestion showed two bands with apropirate lengt for each of the 6 clones as they were expected.
The constructs were sent to GATC for sequencing.

pAAV_RC_SDM_PstI(310) with the primer GATC_std_QE-FP
pAAV_RC_SDM_PstI (4073) with the primer GATC_std_M13_FP

Primers to convert the expression constructs into the iGEM standard were ordered

Investigator: Volker

Praefix VP1ex
Praefix VP2ex
Praefix VP3ex
Suffix VP123ex
Praefix Rep68_78ex
Praefix Rep 40_52ex
Praefix AAPex
Suffix Rep 40_68ex
Suffix Rep 52_78ex
Suffix AAPex

61.Labortag 17.07.2010:

Picking clones of pGA14_Präfix-leftITR Trafo

Investigator: Hanna

Bacteria also grew on control plates. Control means: Ligation of digested vector (pGA14_Cerulean) without insert (Präfix and left ITR). Therefore it seemed that somehow pGA14 religated (Can't be if vector digested completely). Therefore 10 colonies were picked, in order to increase the chance to get a successfully ligated plasmid.

Mini-Preps of pGA14_Präfix-lITR cultures

Investigator: Hanna

No glycerol stocks were prepared, because I'm going to perform the test digestion today.

10 Mini-Preps were performed following the standard protocol.

Test digestion of pGA14_Präfix-lITR (Ligation)

Investigator: Hanna

Test digestion

buffer used: 4; Restriction-enzymes used: Enzyme 1: EcoRI-HF ; Enzyme 2: PstI-HF
Plasmid: pGA14_Präfix_lITR 1 - 10 (all: ~ 400 ng/µL)

Components	Volume/µL	Mastermix
DNA	2.5	-
BSA (10x)	-	12
Buffer 4 (10x)	-	12
Enzyme 1 EcoRI-HF	-	6
Enzyme 2 PstI-HF	-	6
H2O	-	54
Total volume	10	90

Incubation: 55 minutes

Agarose-Gel:

0.75 g Agarose, 50 ml TAE (1.5 %), 3 µL GELRED, at 115 Volt, running time: 30 minutes

Expected fragment size: Hopefully 160 bp = left ITR :) If pGA14_Cerulean religated the expected fragment size would be ~ 800 bp.

Marker: GeneRuler ladder mix (6x)

	Marker	Sample 1	Sample 2	Sample 3	Sample 4	Sample 5	Sample 6	Sample 7	Sample 8	Sample 9	Sample 10
Lane	8 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL

Comments: Numbers refer to "colony 1, 2, 3,..."

Wonderful news: All 10 test digestions delivered positive results: 150 bp fragments and no 800 bp fragment was detectable. Means: left ITR + Präfix was inserted successfully into pGA14!!! :)

yees, thats great! Finally something worked with our ITRs. well done Hanna!! (Bea)

the most astonishingly test digestion gel of our entire working time! :)(Adrian)

Freiburg10 left itr test digest 1707.jpg

Next step: Fusion of suffix to left ITR

Glycerol stocks of all 10 colonies were prepared: B46.1 - B46.10; Plasmid names: P62.1 - P62.10

Trafo of pGA14_Präfix_rITR

Investigator: Hanna

Transformation of BL21 bacteria with pGA14_Präfix_rITR which ligated over night was performed following standard protocol. Abberation: 3µL DNA was added to 50 µL cells.

To do: Mini-Prep + Test digestion of pGA14_Präfix_rITR; Sequencing of pGA14_Präfix_lITR and pGA14_Präfix_rITR.

62.Labortag 18.07.2010

Investigator: Adrian

Calculation of ganciclovir cymeven concentration

Ganciclovir: m = 255,23 g/mol
dissolved in PBS (?), NaCL (0,9%) ?
Concentrations : 0,5 µM = 0,0000005M
xg = (0,0000005 mol/l *255,23 g/mol)/(1l PBS resp. 1l 0,9% NaCl)
x = 0,000128g
x = 0,128 mg
0,128 mg solved in 1l of PBS = 1l of 0,5µM solution
steril filtrated under steril bench

preparation of Aliquots:

Cellculture

The HEK-293 cells were split according to the standard protocol. The HT 1080 cells were split and sowed (3x10^5 cells each well). The amount of cells/ml was determined with the Neubauer-Meteringchamber: (8 cells counted/4)x2,2x20x10^4 = 888000 cells/ml. Two 6-well dishes could be prepared.

only DMEM	3x10^5 cells+DMEM	3x10^5 cells+DMEM
3x10^5 cells+DMEM	3x10^5 cells+DMEM	3x10^5 cells+DMEM

Test digestion of pAAV_RFC_mgmk_tk30: P54, P55, P56, P57

Investigators: Chris, Patrick

To check whether the mutual mgmk_tk30 insert is present in the plasmid we digested it with AgeI and EcoRI. If the insert is present there will an DNA fragmet with a size of about 1700 bp.

P54	P55	P56	P57
291,4 ng/µl	244 ng/µl	247 ng/µl	246 ng/µl

Mastermix:

10 µl Buffer 4
4,4 µl AgeI
2,5 µl EcoRI
no BSA (accroding to NEB)
83,1 µl H2O
Total volume: 100 µl

17 µl of the mastermix were pipetted to 3 µl plasmid sample. Digestion time: 75 minutes.

Gelrun (1% Agarose), 55 minutes, 115 mV: Results: See picture. Interpretation of the results: ? The "upper" DNA seems to be undigested vector underneath the probably digested vector with an estimated size of about 5600 bp. The mutual insert (mgmk_tk30) should be about 1700 bp. There are probably several DNA coil structures visible but not our mutual insert. To do : ligate again.

Aferwards i noticed that i miscalculated the Mastermix.

63. Labortag 19.07.2010

rITR

Picking clones of pGA14_Präfix-rITR Trafo

Few bacteria also grew on control plates. Control means: Ligation of digested vector (pGA14_Cerulean) without insert (Präfix and right ITR).
6 colonies were picked, in order to increase the chance to get a successfully ligated plasmid.

Mini-Preps of pGA14_Präfix-lITR cultures

Investigators: Hanna, Jessy

Glycerol stocks were prepared: B47.1, B47.2, B47.3, B47.4, B47.6

6 Mini-Preps were performed following the standard protocol.

Test digestion of pGA14_Präfix-rITR (Ligation)

Investigator: Hanna, Jessy

Test digestion

buffer used: 4; Restriction-enzymes used: Enzyme 1: EcoRI-HF ; Enzyme 2: PstI-HF
Plasmid: pGA14_Präfix_rITR 1 - 6 (all: ~ 500 ng/µL) -> 1 µg

Components	Volume/µL	Mastermix
DNA	2	-
BSA (10x)	-	6.4
Buffer 4 (10x)	-	6.4
Enzyme 1 EcoRI-HF	-	4
Enzyme 2 PstI-HF	-	4
H2O	-	43.2
Total volume	10	64

Incubation: 45 minutes

Agarose-Gel:

0.75 g Agarose, 50 ml TAE (1.5 %), 3 µL GELRED, at 90 - 100 Volt, running time: 45 minutes

Expected fragment size: Hopefully 160 bp = right ITR :) If pGA14_Cerulean religated the expected fragment size would be ~ 800 bp.

Marker: GeneRuler ladder mix (6x)

	Marker	Sample 1	Sample 2	Sample 3	Sample 4	Sample 5	Sample 6	Marker
Lane	8 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL

Comments: Numbers refer to "colony 1, 2, 3,..."

Wonderful news: All 6 test digestions delivered positive results: ~ 160 bp fragments and no 800 bp fragment were detectable. Means: right ITR + Präfix was inserted successfully into pGA14!!! :)

Next step: Ordering new oligos: Präfix of lITR, suffix of right and left ITRs, continuation of fancy cloning protocol

New Oligos (left ITR Präfix and Suffix + right ITR Suffix) were ordered.

Sequencing of ITRs

Investigator: Hanna

pGA14_Präfix_lITR and pGA14_Präfix_rITR were sent for sequencing to GATC:
1) pGA14_Präfix_lITR: c(P62.1) = 422.38 ng/µL -> V = 5 µL + 25 µL H2O
2) pGA14_Präfix_rITR: c(P63.1) = 501 ng/µL -> V = 4.2 µL + 25.8 µL H2O

Primer: GATC_std_pQE-FP

Quantitative real time PCR

Investigator: Hanna

Template: DNA of HT1080 cells transducted with 1) 10 µL and 2) with 30 µL virus stock solution.

Pipetting scheme:
Master Mix

2x QuantiFast SYBR Green PCR Mix: 400 µL
Primer for and rev: 32 µL of 1:10 dilution = 10 µM
Water: 208 µL
Total: 640 µL

Template: 5 µL
To each template 20 µL master mix were added.

PCR program:

Hold: 95°C, 5 minutes
Cycling: 95°C for 10 seconds, 60°C for 30 seconds
Melt: Ramp from 60°C to 95°C, rising by 1°C each step, wait for 45 seconds on first step, then wait for 5 seconds for each step afterwards. Aquire to Melt A on FAM.

Cloning strategy for gmk_tk added!!

Investigator: Bea
Media:Freiburg10 BioBrick GMK TK30 07 07 2010 with new oligos.pdf

pAAV_RC site directed mutagenesis: Digestion of the two mutagenesis reaction of PstI site: 310 and 4073

Investigator: Volker

Digestion of pAAV_RC

experiment date: 19.07.2010

plasmid: name: pAAV_RC number: P58 / P59

buffer used: 4 ; Restriction-enzymes used: Enzyme (no. Lab:66) XmnI

DNA concentration (vector): ng/µL

components	P58 /µl	P59 /µl
DNA	4,34	3,76
BSA (10x)	2	2
Buffer 4 (10x)	2	2
Enzyme XmnI (no.Lab: 66)	1	1
H2O	10,66	11,24
Total volume (e.g. 15,20,25,30 µl)	20	20

Incubate at 37°C

Freiburg10 pAAV RC site directed mutagenesis performed with PstI 310 and 4073 19 07 2010.jpg

Gelextraction was prepared according to the protocol
- weight of gel: 310: 150 mg; 4073: 150mg
Nanodrop: 310: 5,5ng/µl; 4073: 7,0ng/µl
Ligation was prepared according to the protocol
- Ratio: 310:4073 --> 2,52 µl:6,48µl

Ligation was frozen in -20°C

pHelper plasmid for Midi-Prep prepared

Investigator: Stefan
200ml DYT media + 200µl Amp were inoculated with pHelper-plasmid glycerol stock and put on shaker in 37°C room.
For Midi-Prep: Use Endotoxin-free Midi Prep not our Midi Prep!

Trafo of IGEM 2009 linkers

We borrowed several linkers/tags from Gerrit and did a Trafo in XL1B cells:
- small linker
- middle linker
- long linker
- Strep-Tag
- Split
- GSAT
- SEG

Amount of DNA used: 0,5 µl
Plates incubated at 37°C overnight

64. Labortag 20.07.2010

Quickchange site directed mutagenesis:

Investigators: Achim,Anissa
1) VP1ex P27.2
2) VP2ex P28.2
3) VP3ex P29.2
PCR reaction:

2.5 µL 10x Pfu Ultra II buffer
1) 1,44µl 2) 1,83µl 3) 1,76µl template (1:100 dilution)
0.34 µL primer SDM PstI (4073)forward (of 1:10 dilution)
0.35 µL primer SDM PstI (4073) reverse (of 1:10 dilution)
0,5 µL DMSO (primers form very strong secondary structures)
0.5 µL dNTP
1) 18,9 2) 18,5 3) 18,6 µL dH2O
0.5 µL PfuUltra II fusion (1.25 U)

-> end volume: 25 µL

PCR program:
Quickge
Trafo was carried out, using 2µl DNA, strain:XL1 blue

Transformation with ligation from july 19th

used bacterial strain: BL21
2µL of DNA (pAAV_RC w/o PstI 310/4073)
Trafo plate in 37°C room for incubating at 12.30
no clones to pick at 22.00

Picking Clones from Linker Trafo

clones were picked at 22.00

Endotoxin-free Midi Prep of pHelper

Investigators: Chris, Stefan
Midi-Prep was done according to protocol.
Result of the Midi-prep: 503,2 ng/µl
Plasmid (P64) was placed in Stratagene-Box.

Quantitative real time PCR

Investigator: Hanna

Because there was one positive non-template control (H2O) yesterday, we performed the qPCR one more time.
For this purpose we also calculated the plasmid pipetting for the standard curve again:

c(P9) = 272 ng/µL --> 3 x 1:10 = 1:1000 dilution.
2.68 µL of the 1:1000 dilution was added to 52.32 µL H2O = 2600000 copies/µL.
By performing 1:10 dilutions further 6 "standard samples" were created: 260000 copies/µL; 26000 copies/µL; 2600 copies/µL; 260 copies/µL, 26 copies/µL, 2.6 copies/µL

Template: DNA of HT1080 cells transducted with 1) 10 µL and 2) with 30 µL virus stock solution.

Pipetting scheme:
Master Mix

2x QuantiFast SYBR Green PCR Mix: 400 µL
Primer for and rev: 32 µL of 1:10 dilution = 10 µM
Water: 208 µL
Total: 640 µL

Template: 5 µL
To each template 20 µL master mix were added.
Comment: To non-template control 2 17 µL + 3µL H2O was added (not enough master mix was left).
PCR program:

Hold: 95°C, 5 minutes
Cycling: 95°C for 10 seconds, 60°C for 30 seconds
Melt: Ramp from 60°C to 95°C, rising by 1°C each step, wait for 45 seconds on first step, then wait for 5 seconds for each step afterwards. Aquire to Melt A on FAM.

Cloning of p51(pSB1C3_RFC25) for His-tag insert

Investigators: Anna, Stefan

buffer used:4 ; Restriction-enzymes used: Enzyme SpeI (no. Lab:71), NgOMIV (no. Lab:113)

DNA concentration (vector): 230 ng/µl

components	V (p51)/ µl
DNA	5
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme: SpeI (no.Lab:71)	1
Enzyme: NgOMIV (no.Lab: 113)	1
H2O	9
Total volume	20

1% Agarose-gel, 3µl Gelred

Loading dye(5x): 4µl

Loading plan: marker (10µl), free, sample (24µl)

expected size of fragment: 2080 bp

65. Labortag 21.07.2010

Sequencing of ITRs

Investigator: Hanna

P62.1 (=left ITR + RFC23-Präfix in pGA14) and P63.1 (= right ITR-Präfix in pGA14) were sequenced:

Sequencing results of pGA14_lITR-RFC23Präfix.

Sequencing results of pGA14_rITR-RFC10Präfix).

Sequencing delivered, that the präfixes were fused successfully to the ITRs. The mismatch (orange box) was due to the alignment with the RFC10 präfix... (oligos were ordered!), what means, that the sequencing is OK.
Interestingly it seems, that not only we had problems with PCR of the ITR -> Very strong secondary structures. Even sequencing of the ITRs seems impossible under normal conditions: Exactly at the point where the ITR sequence starts the sequencing signal delivered no clear results.

Conclusion: Fancy method worked until now.

Quantitative real time PCR

Investigator: Hanna

Because the non-template control and the not-transduced cell-DNA controls delivered positive PCR results for the CMV-promoter, a control qPCR was prepared:
1. not-transduced cell-DNA controls (K1 and K2) were diluted: 1:100
2. Oligos (O20, O21) were 1:10 diluted
3. Master Mix was prepared:

75 µL SYBR Green
39 µL H2O
6 µL Oligos

4. Pipetting scheme:

1. K1
2. K2
3. NTC1
4. NTC2
5. Sdt7

Mini-Preps of linker

experiment date: 21.07.2010 ; time: 10:30Uhr
name of investigator: Anissa, Kerstin

Glycerol Stocks

	Clone 1	Clone 2	Clone 3	Clone 4	Clone 5	Clone 6	Clone 7
Bacteria strain	XL1 B	XL1 B	XL1 B	XL1 B	XL1 B	XL1 B	XL1 B
Plasmidname	pGA14_middle linker	pGA14_GSAT linker	pGA14_long linker	pGA14_split	pGA14_strep	pGA14_short linker	pGA14_SEG
given glycerol-stock no.	B48	B49	B50	B51	B52	B53	B54
given plasmid no.	p65	p66	p67	p68	p69	p70	p71

Comments: Different Linker-fragments are very short (5-178bp) --> no Test-digestion; directly sequencing

Results of Trafo of cloning pAAV_RC SDM of PstI 310 and 4073

Investigator: Bea
Comments: Cloning together of the two site-directed mutagenesis performed with the pAAV_RC

Results: no clones grown on LB-agar plate, because pAAV_RC was digested with only one blunt-end restriction enzyme. Luckily, th enzyme vut twice, and one time in the Amp gene. Therefore wrong ligation of the two fragments lacked the Amp resistance.

To do: new cloning together of pAAV_RC PstI 310 and 4073 with TWO other enzymes.

PCR with pUB_V5_mGMK_TK30

Investigator: Adrian, Bea
Comments: Perform PCR with two primers

pmGMK_TK30_prefix_RFC25_for
pmGMK_TK30_suffix_RFC25_rev

and pUB_V5_hisB_mGMK_tk30 (P15) and clone it into pAAV_RFC25.

PCR:

PCR program: GMKTK

components	volume in µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
pMGMK_TK30_RFC25_prefix_for (060) (1:10 dilution)	2,5 (0,5 µM)
pMGMK_TK30_RFC25_suffix_rev (063) (1:10 dilution)	2,5 (0,5 µM)
DNA template: pUB_V5_hisB_mgmk_tk30	~2 µL of 1:1000 dilution
DMSO	-
Phusion polymerase	0,5
H2O	31,5µL
Total volume (e.g. 50 µl)	50

Comments:New Oligos (pmGMK_TK30_prefix_RFC25_for and pmGMK_TK30_suffix_RFC25_rev) with add-on tails (prefix and suffix), but TK30 still contains three iGEM restriction sites but will be ready for use in cell culture
Result of PCR product (theoretically)

Freiburg10 PCR product mGMK tk30 RFC25.jpg

Digestion of pAAV_RFC25

Vector: name:pAAV_RFC25 number:p42
new vector name: pAAV_RFC25_MGMK_TK30
buffer used:4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:149) AgeI ; Enzyme 2 (no.Lab:63) XbaI
DNA concentration (vector):321,5 ng/µl

Comments: Digestion of pAAV_RFC25 wihle performing PCR with P42

components	volume of vector /µl	volume of insert (=PCR product) /µl
DNA	4,73	-
BSA (100x)	2	-
Buffer 4 (10x)	2	-
AgeI (no.Lab:149)	1	-
XbaI(no.Lab:63)	1	-
H2O	9,27	-
Total volume (e.g. 15,20,25,30 µl)	20	-

Incubation: Vector: 1.5 h

Agarose-Gel:

0,5 g Agarose
50 ml TAE (1%)
3 µl GELRED (3-6µl)
110 Volt, running time: 50 minutes

Results of digestion with XbaI and AgeI of pAAV_RFC25 and PCR with pUB_V5_gmk_tk30

Digestion of pAAV_RFC25 witth XbaI and AgeI and PCR of pUB_V5_gmk_tk30 with prefix and suffix primer in RFC25 standard loaded on 1% agarose gel.

Result: Gel was loaded with 50µL of pCR product and 20µL of pAAV_RFC25 digestion. Expected bands can be seen, but pAAV_RFC25 too high and there are some additional bands. We cut out only the intensive band at around 1700 bp.

Comment:After a PCR there can be two ways to proceed with the PCR product:

load 7-8µL of PCR sample on an analytical gel and watch agarose gel for additional bands. If there are some more bands than expected load sample on preparative gel.If there aren´t any additional bands. proceed with digestion of PCR product in order to ligate it into vector.
load total PCR sample on preparative gel. Ask Sven or Tobi in which volume you should elute after cutting out the gel (Gel extraction), but you should elute sample at least in 30µL.

File:Freiburg10 General plan Overview PCR.png

After gel extraction was performed, concentration of the two constructs was measured and revealed:
- c(pAAV_RFC25)= 27,33ng/µL
- c(gmk_tk30)= 24,53ng/µL
After the gel extraction, the PCR product gmk_tk30 was digested again with XbaI and AgeI
and purified with the PCR purification Kit provided by Qiagen

Digestion of the PCR product gmk_tk30

components	volume of vector /µl	volume of insert (=PCR product) /µl
DNA	-	30
BSA (100x)	-	0,5
Buffer 4 (10x)	-	4
AgeI (no.Lab:149)	-	1
XbaI(no.Lab:63)	-	1
H2O	-	3,5
Total volume (e.g. 15,20,25,30 µl)	-	40

Incubation: 1:45 h
Ligation and Trafo were performed following standard protocols.

Gelextraction, Ligation and Transformation for cloning of pSB1C3_His_RFC25 (continuation of cloning from 64th lab day)

Investigator: Bea, Kerstin, Stefan

Extraction

Gel extraction performed following standard protocol provided by Qiagen

Ligation

Measure DNA-concentration with Nanodrop
c(pSB1C3) = 18,2,8 ng/µL
c(His-tag) = 11,2 ng/µL
Calculation of volume needed for ligation:
c(pSB1C3) = 8,26 µL
c(His-tag) = 0,74 µL

Transformation

Transformation has been followed the standard protocol Media:Freiburg10_Cloning Protocol.pdf
Deviation of standard protocol added: medium added to cells before incubation on thermomixer changed to DYT. Standard protocol changed.

Picking clones pf VP1-3 pEX plasmids from DKFZ

Investigator: Bea
Two clones of each plasmid were picked and inoculated in 10mL DYT medium containing 10 µL ampicillin

VPex-1 clone 1
VPex-1 clone 2
VPex-2 clone 1
VPex-2 clone 2
VPex-3 clone 1
VPex-3 clone 2

and they were put in the 37°c room at 19:15

66. Labortag 22.7.2010

cell culture

Investigator: Adrian HT 1080 cells were split according to the standart protocol.

Mini Prep and test digestion pKEX_VP1-3 w/o PstI(4073)

Investigators: Kerstin, Jessica
PstI should be deleted in VP1, VP2, VP3

Glycerol stock were prepared:
- B55-B60
Plasmids
- pKEX_VP1 clone1:488,2 P72
- pKEX_VP2 clone1:484,8 P73
- pKEX_VP3 clone1:485,8 P74
- pKEX_VP1 clone2:499,2 P75
- pKEX_VP2 clone2:511,7 P76
- pKEX_VP3 clone2:470,4 P77

Test digestion of three plasmids to check if the PstI 4073 is deleted (compared to the origin P27-P29)

components	P72 /µl	P27 /µl	P73/µl	P28/µl	P74/µl	P29
DNA	1,6	1,7	1,6	8,1	7,5	7,4
BSA (10x)	1	1	1	1	1	1
Buffer 4 (10x)	1	1	1	1	1	0,5
H2O	10,9	10,8	10,9	4,4	5,0	5,1
Total volume (e.g. 15,20,25,30 µl)	15	15	15	15	15	15

Digestion: 45 minutes, 37°C. Results:

Deletion was succesful, there are still 2 PstI restriction sites in P72-74

Freiburg10 SDM of pKex VP1-3 und Origing pKex VP1-3.jpg

Cloning together of pAAV_RC PstI 310 and 4073 with two enzymes

Investigators: Chris, Patrick

Clone P58 (pAAV_RC_SDM310.1) and P59 (pAAV_RC_SDM4073) will be digested with HindII and SpeI. The smaller fragment (about 1700 bp) of P58 and the larger fragment of P59 (about 5900 bp) will be ligated to receive a plasmid carrying both mutations.

components	volume of vector /µl (P59)	volume of insert /µl (P58)
DNA	2	5,5
BSA (10x)	2	2
Buffer 2 (10x)	2	2
HindIII	2	2
SpeI	2	2
H2O	12	9,5
Total volume	20	20 µl

Incubation: at 37°C, 70 minutes.

The Gelextraction was performed according to the standard protocol.
Weight of P58 gel extract: 50 µg
Weight of P59 gel extract: 98 µg
The received concentrations (measured by nanodrop): P58: 3 ng/µl , P59: 4,7 ng/µl
Quickligation was not performed according to the standard protocol:

2 µl P58 Insert
2 µl P59 Vector
5 µl Quickligase buffer (2x)
1 µl Quickligase
Total volume: 10 µl

Incubation: 15 minutes at roomtemperature.
Transformation was performed according to the standard protocol with E. coli BL21. The agar plates were put into the 37°C room at 23:00.
New Ampicillin was prepared and put into the -20°C freezer.

Sequencing of linker

Investigator: Anissa

Linker	Sequencing
p65: middle linker	was sucessful
p66: GSAT linker	sequence didn’t arrive yet
p67: long linker	was sucessful
p68: split linker	false, no linker but YFP.Gerrit’s searching for the right sample
p69: strep linker	the suffix of strep has a double AgeI! That’s why we have to cut off next time with AgeI (and digest long enough)
p70: short linker	was sucessful
p71: SEG linker	was sucessful

middle linker:

GSAT linker:

long linker:

Split linker:

Strep tag:

Short linker:

SEG linker:

Biobricks of hgH and ß-Globin

Investigators: Stefan, Anna

Could you upload some agarose gels eg the gels after the digestion and the PCR? Thanks a lot! (Bea)

Comments: Perform PCR with two primers

PCR of ß-Globin and hgH:

DNA template: pAAV_MCS; concentration: 360 ng/µl

PCR program: BGLOB

components	volume in µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
ß_globin_suffix (085) (1:10 dilution)	2,5 (0,5 µM)
ß_globin_prefix (086) (1:10 dilution)	2,5 (0,5 µM)
DNA template: pAAV_MCS (1:1000)	5,6 µL of 1:1000 dilution
DMSO	-
Phusion polymerase	0,5
H2O	27,9 µL
Total volume (e.g. 50 µl)	50

PCR program: HGH

components	volume in µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
(083) (1:10 dilution)	2,5 (0,5 µM)
(084) (1:10 dilution)	2,5 (0,5 µM)
DNA template: pAAV_MCS (1:1000)	5,6 µL of 1:1000 dilution
DMSO	-
Phusion polymerase	0,5
H2O	27,9 µL
Total volume (e.g. 50 µl)	50

Digestion of pSB1C3_RCF25_CFP:

DNA-Concentration: 230,9 ng/µl

components	volume of vector /µl
DNA	5
BSA (10x)	3
Buffer 4 (10x)	3
PstI	1
XbaI	1
H2O	17
Total volume (e.g. 15,20,25,30 µl)	30

Gel running of digested vector and PCR products

1% Agarose gel
3 µl Gelred, 8 µl DNA-Ladder-Mix
125 Volt, running time: 40 minutes

Sample/µl	Loading dye (5x)/µl	Expected size/bp
Vector: 30	6	2080
ß-Globin: 50	10	524
hgH: 50	10	479

Gelextraction

Gel extraction performed following standard protocol provided by Qiagen

Sample/	Weight/g	QG buffer/µl
Vector	0,13	390
ß-Globin	0,28	840
hgH	0,24	720

Digestion of PCR products

components	volume of vector /µl
DNA	30
BSA (100x)	0,5
Buffer 4 (10x)	4
PstI	1
XbaI	1
H2O	3,5
Total volume (e.g. 15,20,25,30 µl)	40

Purification of PCR products, Ligation, Transformation

procedure has been followed a different protocol (see Sven); has to be added in the standard protocols !

Measure DNA-concentration with Nanodrop:

c(pSB1C3) = 12,42 ng/µL
c(ß-Globin) = 51,93 ng/µL
c(hgH)= 36,87 ng/µL

Calculation of volume needed for ligation:

c(pSB1C3) = 7,3 µL
c(ß-Globin) = 1,7 µL

c(pSB1C3) = 7,62 µL
c(hgH) = 1,38

Note: after heatshock cells were put on the shaker without adding 750 µl DYT, it was recognized and added later after 25 min of shaking !

Picking clones of pSB1C3_His_RFC25 and pAAV_RFC25_GMK_TK30 for Mini-Prep

Investigators: Stefan

Three clones of each construct were picked and inoculated in 10mL DYT medium containing 10 µL ampicillin (pAAV_RFC25_GMK_TK30) or 10 µL chloramphenicol (pSB1C3_His_RFC25).

They were put in the 37°C room at 20:33.

67. Labortag 23.7.2010

Picking clones of pAAV_RC_1.1

Investigator: ChrisW, Patrick
The inoculated agar plates from 'Cloning together of pAAV_RC PstI 310 and 4073 with two enzymes' were checked for colonies. Three clones were picked and in each case inoculated 20 ml DYT + Amp at 10:20.

Mini prep of two pAAV_RC_SDM_PstI_310_4073. Results: It was checked visually whether enough E. coli BL21 cells had grown. Therefore only two midi preps were carried out, according to the standard protocol (Final elution with 50 µl). Unfortunately both of them yielded a quite low plasmid concentration, probably due to the short growth time (7 h).
pAAV_RC mini pstI 301,4073: 44,7 ng/µl
pAAV_RC mini 2 pstI 301,4073: 83,1 ng/µl

30 µl of both plasmids were sent for sequencing to GATC, named PS1 and PS2. Primers used: GATC_std_PolyC-D and GATC_std_SK.

Glycerol stock:
B 67: pAAV_RC_SDM_PstI_310_4073 (1)
B 68: pAAV_RC_SDM_PstI_310_4073 (2)

Results of Trafo Biobricks of hgH and ß-Globin

Investigator: Anissa, Bea

Comments: No clones of pSB1C3_hGH and pSB1C3_betaGlobin grown on trafo plate. Possible reason can be the forgotten DYT medium added to the cells after the heat-shock. Cells were incubated at 37°C for 40 minutes without medium and were added afterewards.

TO DO: Repeat ligation of

hgh PCR product and
beta-globin PCR product

with pSB1C3 cut with XbaI and PstI.

Measure DNA-concentration with Nanodrop:

c(pSB1C3) = 38,9 ng/µL
c(ß-Globin) = 51,93 ng/µL
c(hgH)= 36,87 ng/µL

Calculation of volume needed for ligation:

c(pSB1C3) = 3,8 µL
c(ß-Globin) = 5,2 µL

c(pSB1C3) = 3,8 µL
c(hgH) = 5,2

Attention: There was not enough cut vector. In both Ligations were only 2,2 µl of vector added. So incubation lasted 15 minutes and for transformation 4 µl were used.

Mini-Prep and Test digestion of pAAV_RFC25_mGMK_TK30

Investigator: Adrian, Bea

Comments: Mini-Prep, test digestion and sequencing is carried out in order to verify insertion of the PCR product mGMK_TK30 with RFC25 add-on tails into pAAV_RFC25(overhangs). Aim is to use the construct in order to conduct experiments with the gmk_tk30 fusionenzyme.

Mini-Prep of pAAV_RFC25_mGMK_TK30 clone 1 to 3: After performing Mini-Preps of clone 1 - 3 (elution volume with EB buffer was 50 µL) , concentration was measured and revealed following concentrations:

P81 = pAAV_RFC25_mGMK_TK30 clone 1: c = 486 ng/µL
P82 = pAAV_RFC25_mGMK_TK30 clone 2: c = 426 ng/µL
P83 = pAAV_RFC25_mGMK_TK30 clone 3. c = 457 ng/µL

Test digestion of pAAV_RFC25_mGMK_TK30 clone 1 to 3:

P81 = pAAV_RFC25_mGMK_TK30 clone 1
P82 = pAAV_RFC25_mGMK_TK30 clone 2
P83 = pAAV_RFC25_mGMK_TK30 clone 3

components	volume of P81/µl	volume of P82/µL	volume of P83/µL
DNA	2	2	2
BSA (100x)	1,5	1,5	1,5
Buffer 4 (10x)	1,5	1,5	1,5
PstI	0,5	0,5	0,5
XbaI	0,5	0,5	0,5
H2O	9	9	9
Total volume /µl	15	15	15

Expected sizes:

mGMK_TK30: 1700bp
pAAV_RFC25: 4600bp

Results of samples loaded 1% agarose gel and ran 50 minutes at 110 V:

Freiburg10 Test digestion of pAAV RFC25 mGMK TK30 cut with XbaI and AgeI 23 07 2010001.png

Sequencing of pAAV_RFC25_mGMK_TK30

70ng/µL were sent to GATC from each clone. They were labeled:

AF_P81 (clone 1)
AF_P82 (clone 2)
AF_P83 (clone 3)

Mini-Prep of pSB1C3_His6

Investigator: Adrian

pSB1C3_6xHis clone 1 = P84 : 107,8 ng/µl (eluted with 50µl)
pSB1C3_6xHis clone 2 = P85 : 122,8 ng/µl (eluted with 50µl)
pSB1C3_6xHis clone 3 = P86 : 98,8 ng/µl (eluted with 50µl)

68. Labortag 24.7.2010

Cell culture: Seeding of HEK293 for Transfektion with P81, P82 and P83

Investigator: Adrian

unfortunately the T75 flask with HEK-cells was overpopulated => to much cells =>yellow medium and differentiation of the HEK-cells => thrown away
I had to thaw cells, (P4) so there'll be no transfection at Monday :(

Cell culture: Transduction of HT1080 with AAVs

Investigator: Adrian

I. Plate I(A is up)

control: no virus added	virus without GOI added	virus with 10µg amount of GOI added
control: no virus added	virus without GOI added	virus with 10µg amount of GOI added

II. Plate II(A is up)

control: no virus added	virus without GOI added	virus with 10µg amount of GOI added
control: no virus added	virus without GOI added	virus with 10µg amount of GOI added

III. Plate II(A is up)

control: no virus added	virus without GOI added	virus with 10µg amount of GOI added
control: no virus added	virus without GOI added	virus with 10µg amount of GOI added

Discussion round nr. 4

Investigators: Adrian and his evil twins

adrian created a poster

Stocktaking of superior goods

Investigator: Adrian
superior goods:

DYT/LB medium
tips
LB-agar

69. Labortag 25.7.2010

Clone picking from pSB1C3_hgH and pSB1C3_betaglobin

Investigator: Bea

Comments: Clones were very small and not many clones could be detected. Possible reasons:
1) The ratio for a proper ligation need to be 3:1 insert: vector. There was not enough plasmid of the digested vector pSB1C3.
2) The digested fragments of the PCR products hGH and beta-globin and the cutted vector were stored at -20°C. This could lead to the bad results of the transformation, because the overhangs were degraded.

Two clones were picked of each trafo plate:

pSB1C3_hGH
pSB1C3_betaglobin

They were inoculated in 10mL DYT medium containing 10µL chloramphenicol and put into 37°C room for incubating. The reason for picking only two clones was that not many more clones could be detected easily.

70. Labortag 26.7.2010

Mini Prep and test digestion pSB1C3_hgh and pSB1C3_beta-globin

Investigators: Anissa, Kerstin

Glycerol stock were prepared:
- B69-B71
Plasmids
- pSB1C3_hgh clone1: 139 ng/µl p89
- pSB1C3_hgh clone2: 209,4 ng/µl p90
- pSB1C3_beta-globin clone1: 217,5 ng/µl p91

Incubation time: 1,5h Incubation temperature:37°C

Test digestion with Xba and PstI to check if hgh and beta-globin were cloned succesfully into the pSB1C3, respectively.

Test digestion of pSB1C3 hgh and pSB1C3 beta-globin cut with XbaI and PstI 26 07 2010002.jpg

components	p89 /µl	p90 /µl	p91/µl
DNA	4,3	4,3	4,1
BSA (10x)	1,5	1,5	1,5
Buffer 4 (10x)	1,5	1,5	1,5
H2O	6,7	6,7	6,9
Total volume (e.g. 15,20,25,30 µl)	15	15	15

Test digestion P87: pAAV_RC_PstI-301-4073 clone 1 and P88: pAAV_RC_PstI-301-4073 clone 2

Investigator: Chris W.

Plasmids
- pAAV_RC_PstI-301-4073 clone1: 44,2 ng/µl p87
- pAAV_RC_PstI-301-4073 clone2: 83,2 ng/µl p88
- pAAV_RC: 429,8 ng/µl p50

Incubation time: 1,5h Incubation temperature:37°C

Test digestion with PstI 0,5µl

components	p87 /µl	p88 /µl	p50/µl
DNA	13,6	7,2	0,72
BSA (10x)	1,5	1,5	1,5
Buffer 4 (10x)	1,5	1,5	1,5
H2O	2,9	9,3	15,78
Total volume (e.g. 15,20,25,30 µl)	20	20	20

Oligos for hTERT promoter

Investigator: Bea

Oligos were ordered to modify hTERt promoter in order to obtain hTERT in the iGEM RFC10 standard.

Ordered oligos at Sigma-Aldrich for amplifying hTERT promoter.

Retrafo with pTVvector containing the CMV promoter

Investigator: Bea

Comments: In order to obtain the CMV promoter in the correct RFC10 standard, oligos werde designed and ordered. For using the plasmid obtained from the iGEM team 2008, a retrafo has to be performed.

Re-transformation:

Construct used: expressionvector + CMV (BBa_TV_CMV)
- clone 7
- clone 8
concentration measureed with NanoDrop:
- clone 7 (Bba_TV_VMV_7): c = 334, 65 ng/µL
- clone 8 (Bba_TV_VMV_8): c = 183,77 ng/µL
Plasmid need to be diluted in order to obatain the final 100pg.
Dilution: 1:1000
Volume needed of 1:1000 dilution of each clone:
- clone 7 (Bba_TV_VMV_7): v = 0,29 µL
- clone 8 (Bba_TV_VMV_8): v = 0,54 µL
100 µL aliquot of XL1-B were thawed on ice and divided into 50µL each. The proper amount of each clone was added.

Continuation: ITRs

Investigator: Hanna

In order to convert also the left ITR into RFC10 standard, the FANCY method was repeated with the newly arrived oligos (präfix and suffix).

Practical Cloning: Digestion of pAAV_MCS with AlwNI

plasmid: P9 (270 ng/µL) = pAAV_MCS
buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:120) AlwNI

Comments: No.

Digestion

components	Volume [µL]
DNA	15
BSA (100x)	0.2
Buffer 4 (10x)	2
Enzyme AlwNI (no.Lab:120)	2
H2O	0.8
Total volume	20

Incubation: 1 h 20 minutes

Agarose-Gel:

0.5 g Agarose, 50 mL TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 50 minutes

Sample	Sample/µl]	Loading dye (6x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
P9	20 µl	4 µl	1674 bp = left ITR	2982 bp = right ITR

Marker: GeneRuler ladder mix

	Marker [µL]	Sample P9 [µL]
Lane	8	24

Gelextraction

Gel measurement:

Sample	weight	concentration
left ITR fragment	0.07 g	35.65 ng/µL
right ITR fragment	0.15 g	66.05 ng/µL

Practical Cloning: Digestion of left ITR fragment with NotI + PstI

buffer used: 4 ; Restriction-enzymes used: Enzyme 1 NotI-HF; Enzyme 2 PstI-HF

Comments: Due to the digestion of an gelex- and very small fragment (ITR ~ 150 bp), the whole gelex-volume was used for digestion.

Digestion

components	Volume [µL]
DNA	19 µL = 0.68 µg
BSA (100x)	0.25
Buffer 4 (10x)	2.5
Enzyme NotI-HF	1
Enzyme PstI-HF	1
H2O	1.25
Total volume	25

Incubation: 1 h 15 minutes

Agarose-Gel:

1.3 g Agarose, 65 mL TAE (2 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes

Sample	Sample/µl]	Loading dye (5x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
left ITR fragment	25 µl	4 µl	145 bp = left ITR

Marker: GeneRuler ladder mix

	Marker [µL]	Sample left ITR [µL]
Lane	8	29

Gelextraction

Gel measurement:

Sample	weight	concentration
left ITR	0.09 g	3.59 ng/µL

Practical Cloning: Digestion of pGA14_Präfix-rITR with EcoRI + PstI

buffer used: 4 ; Restriction-enzymes used: Enzyme 1 EcoRI-HF; Enzyme 2 PstI-HF

Comments: No.

Digestion

Plasmid: P63.1; c = 501.14 ng/µL

components	Volume [µL]
DNA	4
BSA (100x)	0.2
Buffer 4 (10x)	2
Enzyme NotI-HF	1
Enzyme PstI-HF	1
H2O	11.8
Total volume	20

Incubation: 1 h 15 minutes

Agarose-Gel:

1.3 g Agarose, 65 mL TAE (2 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes

Sample	Sample/µl]	Loading dye (5x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
Präfix - right ITR	20 µl	3.5 µl	165 bp = left ITR

Marker: GeneRuler ladder mix

	Marker [µL]	Sample Präfix-rITR [µL]
Lane	8	23

Gelextraction

Gel measurement:

Sample	weight	concentration
Präfix-rITR	0.08 g	7.55 ng/µL

Gel picture of left ITR fragment and Präfix-rITR fragment:

Comment: The left ITR fragment was, as expected, nearly not detectable. Nevertheless it was cut out of the gel, because the same probleme occured during the first fancy-performance, which turned out to be successful!

Practical Cloning: Digestion of pGA14 with EcoRI + NotI

plasmid: P61 (200 ng/µL) = pGA14_Cerulean
buffer used: 4 ; Restriction-enzymes used: Enzyme 1 = EcoRI-HF; Enzyme 2 = NotI-HF

Comments: This digested vector used used for both ligation approaches.

Digestion

components	Volume [µL]
DNA	10
BSA (100x)	0.3
Buffer 4 (10x)	3
Enzyme EcoRI-HF	1.5
Enzyme NotI-HF	1.5
H2O	13.7
Total volume	30

Incubation: 1 h 15 minutes

Agarose-Gel:

0.5 g Agarose, 50 mL TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 60 minutes

Sample	Sample/µl]	Loading dye (5x)/µl	Expected size 1 (Geneious)
pGA14	30 µl	4 µl	2887 bp

Marker: GeneRuler ladder mix

	Marker [µL]	Sample pGA14 [µL]
Lane	8	34

Gelextraction

Gel measurement:

Sample	weight	concentration
pGA14	0.08 g	13.63 ng/µL

Hybridization of ITR-Oligos

left ITR:

10 µL Oligo 1 (O100 = lITR_Präfix_RFC10_for bzw. O104 = rITR_Suffix_RFC10_for)
10 µL Oligo 2 (O101 = lITR_Präfix_RFC10_rev bzw. O105 = rITR_Suffix_RFC10_rev)
4 µL 100 mM TrisHCl pH8
8 µL 5 mM MgCl2
8 µL H2O

Total: 40 mL

Because some of the oligos produce strong secondary structures, we used the ORIGAMI1 program:
1) initial denaturation: 99°C, 7 minutes
2) 99°C, 1 minute
3) 73 x repetition of 2) -> -1°C, R = 0.3 °C/sec
4) hold 4°C

Ligation

1. Ligation of left ITR + Präfix + pGA14:

Präfix-Oligos: 1 µL
left ITR: 8 µL
pGA14: 8 µL
Buffer: 2 µL
T4 Ligase: 1 µL

Total: 20 µL

2. Ligation of Präfix-rITR + Suffix+ pGA14:

Präfix-Oligos: 1 µL
Präfix-rITR: 8 µL
pGA14: 8 µL
Buffer: 2 µL
T4 Ligase: 1 µL

Total: 20 µL

The ligation approaches were incubated at 16°C over night (thermocycler).

Biobrick of GMK

Investigators: Stefan

aim: Biobrick construction of pAAV_RFC25_gmk for further addition of TK30.
result: Transformation worked out, clones can be picked.
expected construct:

Freiburg10 pAAV RFC25 gmk biobrick construction.png

Digestion with XbaI and AgeI and ligate into vector which was digested with XbaI and AgeI as well.

PCR of gmk:

DNA template: puB6_V5_His6_clone1 + TK/GMK; concentration: 493,7 ng/µl

PCR program: GMK

components	volume in µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
pmGMK_TK30_prefix_RFC25_for (082) (1:10 dilution)	2,5 (0,5 µM)
pmGMK_suffix_RFC25_rev (080) (1:10 dilution)	2,5 (0,5 µM)
DNA template: puB6_V5_His6_clone1 + TK/GMK (1:100)	0,5 µL of 1:100 dilution
DMSO	-
Phusion polymerase	0,5
H2O	33 µL
Total volume (e.g. 50 µl)	50

Digestion of pAAV_RCF25:

DNA-Concentration: 321,5 ng/µl

components	volume of vector /µl
DNA	4
BSA (10x)	3
Buffer 4 (10x)	3
AgeI	1
XbaI	1
H2O	18
Total volume (e.g. 15,20,25,30 µl)	30

Gel running of digested vector and PCR products

1% Agarose gel
3 µl Gelred, 8 µl DNA-Ladder-Mix
125 Volt, running time: 60 minutes

Sample of Hanna was loaded as well, see extra journal entry.

Sample/µl	Loading dye (5x)/µl	Expected size/bp
Vector/ 30	6	4636
gmk/ 50	10	603

Freiburg10 pAAV RFC25 digestion and PCR of gmk.jpg

Gelextraction

Gel extraction performed following standard protocol provided by Qiagen

Sample/	Weight/g	QG buffer/µl
pAAV_RFC25	0,15	450
gmk	0,21	630

Digestion of PCR products

components	volume of vector /µl
DNA	30
BSA (10x)	4
Buffer 4 (10x)	4
AgeI	1
XbaI	1
H2O	0
Total volume (e.g. 15,20,25,30 µl)	40

Purification of PCR products, Ligation, Transformation

Purification has been followed by a different protocol (see Sven); has to be added in the standard protocols !

Measure DNA-concentration with Nanodrop:

c(pAAV_RFC25) = 35,46 ng/µL
c(gmk) = 72,84 ng/µL

Calculation of volume needed for ligation:

c(pAAV_RFC25) = 7,56 µL
c(gmk) = 1,44 µL

71. Labortag 27.7.2010

Cloning of linkers in pSB1C3_RFC25_CFP1.1

Investigator: Jessica
Linkers longlinker, SEG and GSAT should be cloned into the RFC25-standard

P66: GSAT_linker_pMA 242,7 ng/µl
P67: LonglinkerA50_pMA 230,4 ng/µl
P71: SEG_pMA 211,8 ng/µl
P51: pSB1C3_RFC25_CFP1.1 230,1 ng/µl

all linkers and pSB1C3_RFC25_CFP1.1 are digested with AgeI and XbaI for 2 hours

components	volume of vector /µl (P66)	volume of insert /µl (P67)	volume of insert /µl (P71)	volume of insert /µl (P51)
DNA	8,2	8,7	9,4	8,7
BSA (10x)	2	2	2	2
Buffer 4 (10x)	2	2	2	2
AgeI	1	1	1	1
XbaI	1	1	1	1
H2O	5,8	5,3	4,6	5,3
Total volume	20	20 µl	20 µl	20 µl

1% Agarose gel
3 µl Gelred, µl DNA-Ladder-Mix for P51, Low range for P66,67,71
130 Volt, running time: 45 minutes for P51, 90 Volt, running time 30 minutes for P66,67,71

Sample/µl	Expected size/bp
Vector P51	2078
Insert P66	126
Insert P67	54
Insert P71	126

weight of P66 gel extract: 0,04g
weight of P67 gel extract: 0,09g
weight of P71 gel extract: 0,1g
weight of P51 gel extract: 0,15g

finally called:

pSB1C3_RFC25_longlinker P96
pSB1C3_RFC25_GSAT P97
pSB1C3_RFC25_SEG P98

Nanodrop

Longlinker (P67): 2,1ng/µl
SEG (P71): 3,7ng/µl
GSAT (P66): 1,4ng/µl
pSB1C3_RFC25: 29,6ng/µl

Ligation

P51:P66 - 2,2µl:6,8µl
P51:P67 - 2,53µl:6,47µl
P51:P71 - 5,54µl:3,46µl

Transformation

4µl DNA was added to 50µl XL1b

Result sequencing of pAAV_RFC25_mGMK_TK30

Investigator: Bea

Comments: Results of the PCR and cloning experiment from lab day: 23.07.2010 (Mini-Prep). The sucessful insertion of mGMK_TK 30 into the vector pAAV_RFC25 can be confirmed and is ready for cell culture.

Results sequencing of plasmid P81 (pAAV_RFC25_mGMK_TK30 clone 1)

Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P81.JPG

Results sequencing of plasmid P82 (pAAV_RFC25_mGMK_TK30 clone 2)

Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P82.jpg

Results sequencing of plasmid P83 (pAAV_RFC25_mGMK_TK30 clone 3)

Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P83.JPG

Quickchange @ Pst in RepX 68 and RepX 78

Investigator: Kira

PCR program: PstI

components	volume in µl
10x Phusion HF buffer	2.5 µl
10 mM dNTP mix	0.5 µl
__310 ____primer_for (1:10 dilution)	0,39 µl
__310____primer_rev (1:10 dilution)	0,39 µl
DNA template (1:20 dilution)	0,5 µl
DMSO	0 µl
Phusion polymerase	0.5 µl
H2O	20,22 µl
Total volume (e.g. 50 µl)	25 µl

cycles	temperature	time
1	95 C	2 min
20	95 C	30 sec
	66 C	1 min
	68 C	5 min

The PCR-products were digested with 0.5 µl DpnI
Transformation was performed according to the standard protocol in XL1B cells

Site-directed mutagenesis of pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) with BamHI and SalI

Investigator: Adrian, Bea

Comments: Site-directed mutagenesis was perfomed with pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) in order to delete BamHI and SalI in the plasmid. These restriciton sites need to be removed because they are the single-cutter in the loops which will be used for targeting.

Protocol: Different PCR programs were used for performing the Quickchange site-directed mutagenesis protocol.

Longer elongation/extension time
Shorter elongation/extension time

1. PCR reaction with PCR program with longer elongation time:

DNA template used: pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) = P87
A dilution of 1:20 was prepared and it was calculated the amount of DNA template needed for each site-directed mutagenesis reaction.

components	volume in µl	volume in µl\|
10x Phu Ultra HF II buffer	2.5 µl	2.5 µl
10 mM dNTP mix	0.5 µl	0.5 µl
primer_for (1:10 dilution)	O68= SDM SalI: 0,67 µl	O66= SDM BamHI: 0,68 µl
primer_rev (1:10 dilution)	O69= SDM SalI: 0,67 µl	O67= SDM BamHI: 0,72 µl
P87 (DNA template) (1:20 dilution)	0,83 µl	0,83 µl
DMSO	-	-
Phusion polymerase	0.5 µl	0.5 µl
H2O	19,33 µl	18,77 µl
Total volume (e.g. 50 µl)	25 µl	25 µl

Used PCR programs for both SDMs:

Comment: Program has a long extension time because Quikchange Kit (Stratagene) recommends 1 minute per kb. Our vector has a length of 7300 bp therefore 7 minutes and 30 seconds were chosen for proper elongation of the whole vector.

Rounds	Temperature	Time
1	95°C	2'
20	95°C	30
	60°C	1'
	68°C	7 min 30 sec
Hold	4°C

2. PCR reaction with PCR program with shorter elongation time:

DNA template used: pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) = P87
A dilution of 1:20 was prepared and it was calculated the amount of DNA template needed for each site-directed mutagenesis reaction.

components	volume in µl	volume in µl\|
10x Phu Ultra HF II buffer	2.5 µl	2.5 µl
10 mM dNTP mix	0.5 µl	0.5 µl
primer_for (1:10 dilution)	O68= SDM SalI: 0,67 µl	O66= SDM BamHI: 0,68 µl
primer_rev (1:10 dilution)	O69= SDM SalI: 0,67 µl	O67= SDM BamHI: 0,72 µl
P87 (DNA template) (1:20 dilution)	0,83 µl	0,83 µl
DMSO	-	-
Phusion polymerase	0.5 µl	0.5 µl
H2O	19,33 µl	18,77 µl
Total volume (e.g. 50 µl)	25 µl	25 µl

Used PCR programs for both SDMs:

Comment: Quikchange Protocol (Stratagene) recommends 30 seconds per kb chosing a elongation temperature of 68°C. Our vector has a length of 7300 bp therefore 4 minutes were chosen for proper elongation of the whole vector. In order to see wheter this PCR program works aswell the same PCR ingredients were chosen as it can be seen in the table above.

Rounds	Temperature	Time
1	95°C	2'
20	95°C	30
	60°C	1'
	68°C	4'
Hold	4°C

Summary: Four site-directed mutagenesis have been performed with the plasmid pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) = P87.

Site-directed mutagenesis in order to delete restriction site BamHI
- with shorter elongation time (modified protocol)
- with longer elongation time
Site-directed mutagenesis in order to delete restriction site SalI
- with shorter elongation time (modified protocol)
- with longer elongation time
The samples were digested with 0,5µL DpnI after site-directed mutagenesis were performed in order to remove bacterial DNA template.
Trafos have been performed with all four samples. Trafo plates are containing ampicillin.

Cell culture

Investigator: Adrian

3 x 6er dishes for Transduction were seeded and passaged(P14)

ITRs: Trafo of overnight-ligation approaches

Investigator: Hanna

Comments: Cloning approach was continued: RFC10-Präfix_rightITR was ligated to RFC10-Suffix and pGA14 and leftITR was ligated to RFC10-Präfix and pGA14 over night. Trafo of these samples was performed in order to pick clones tomorrow.

Trafo was performed following the standard protocol. Abberance: 4 µL DNA was added to BL21 cells.

PCR: beta-Globin

Investigator: Hanna
Because sequencing delivered, that cloning of the beta-globin intron into pSB1C3 didn't work (Cerulean was still in the vector), the PCR was performed one more time:

components	volume [µl]
5x Phusion HF buffer	10
10 mM dNTP mix	1
beta-globin_primer_for	2,5
beta-globin_primer_rev	2,5
DNA template	1 ng = 2.8 µL of 1:1000 dilution of pAAV_MCS, c=360 ng/µL
DMSO	-
Phusion polymerase	0,5
H2O	30.7
Total volume (e.g. 50 µl)	50

PCR program:

98°C, 1'

98°C, 30
63°C, 25
72°C, 15

-> 8x

98°C, 30
72°C, 20

-> 20x

1 x 72°C, 5'
Hold: 4°C

Repetition of PCR for hGH BioBrick Production

Investigator: Bea

Comments: Sequencing of pSB1C3_hGH did not reveal any insertion of hGH into pSB1C3. Instead of hGH CFP was found in the vector indicating that undigested or partially digested vector religated. Therefore a new pCR for generating the BioBrick was performed over night.

PCR reaction:

components	volume [µl]
5x Phusion HF buffer	10
10 mM dNTP mix	1
hGH_primer_for	2,5
hGH-globin_primer_rev	2,5
DNA template	1 ng = 2.8 µL of 1:1000 dilution of pAAV_MCS, c=360 ng/µL
DMSO	-
Phusion polymerase	1
H2O	30.7
Total volume (e.g. 50 µl)	50

Used PCR programs:

Comment: PCR will be performed over night.

Rounds	Temperature	Time
1	98°C	1'
8	98°C	30
	58°C	25
	72°C	12
17	98°C	30
	69°C	25
	72°C	12
Hold	4°C

Picking clones from pAAV_RFC25_mGMK

Investigator: Bea

Comment: Trafo plate looked good. On control plate only few clones grown in contrary to the XL1-B{pAAV_RFC25-mGMK} plate. Two clones were picked.

10 mL containing 10µL ampiciliin were inoculated.
Put into 37°C room on shaker.

Picking clones from Retrafo of pTV_CMV clone 7 and clone 8

Investigator: Bea

Comment: Trafo plates looked good. Enough clones grown. Two clones of each plate were picked

10 mL containing 10µL ampiciliin were inoculated with each clone respectively.
Put into 37°C room on shaker.

72. Labortag 28.7.2010

Results Trafo pAAV_RC_1.1_BamHI and pAAV_RC_1.1_SalI

Investigator: Bea

Results: Too many bacteria grown resulting in a bacterial lawn. Possible reasons could be some problems with the new prepared ampicillin because trafo from Hanna containing the ITRs had the same results. Trouble shooting done by Hanna.

Proceed with BioBrick Production of hGH and beta-globin

Investigator: Bea

Comments: PCR was started yesterday and conducted over night.

Proceeding:

Prepare 1% agarose gel and load samples on gel.
Run time: 45 minutes

Result of gel:

Marker did not resolute very good. Expected sizes of PCR products:

hGH = 510 bp
beta globin intron: 524 bp

It can be seen (or estimated) that two intensive bands are visible at around 500 bp. Therefore these two bands were cut out and a gel extraction was performed. The lower visible band at around 100 bp of hGH is an additional band generated at the pCR reaction. The two intensive blurred bands belong to the loading dye added to the samples.

Freiburg10 PCR of hGH and Bet a globin repeat agaorse gel 28 07 2010008.jpg

After gel extraction was performed, the PCR prdoucts hGH and beta-globin were digested:

DIGESTION of PCR products

components	hGH/µl	beta-globin /µL
pSB1C3_CFP	29	29
BSA (100x)	0,4	0,4
Buffer 4 (10x)	4	4
XbaI	1	1
PstI	1	1
H2O	4,6	4,6
Total volume (e.g. 15,20,25,30 µl)	40	40

Incubate for 2h at 37°C
Perform PCR purification following standard protocols
Elute in 20µL EB-buffer, put on 50°C for 3 minutes before centrifugating
Measure DNA with NanoDrop:
- c(hGH) = 58,14 ng/µL
- c(ß-globin) = 83,10ng/µL

In the meantime prepare the digestion of vector pSB1C3_CFP (P51)

DIGESTION of pSB1C3_CFP

components	volume /µl
pSB1C3_CFP	5
BSA (10x)	2
Buffer 4 (10x)	2
XbaI	1
PstI	1
H2O	9
Total volume (e.g. 15,20,25,30 µl)	20

Incubate for 2h at 37°C
Load sample on 1% preparative agarose gel
Run for 45 minutes at 110 V

Result of gel:

The vector was digested with XbaI and PstI. Expected sizes have been:

pSB1C3 = 2072bp
CFP: 732bp

It can be seen that the vector pSB1C3_RFC25_CFP was digested and two visible bands can be seen on the gel. The lower band corresponds to the CFP fragment (~700 - 800 bp), the higher band corresponds to the plasmid backbone at around 2000-3000 bp. The higher band was cut out and extracted by gel extraction.

Freiburg10 pSB1C3 CFP digestion 28 07 2010009.jpg

Perform gel extraction and measure DNA with NanoDrop
- c(psb1C3) = 29,52 ng/µL

LIGATION of pSB1C3 with hGH and beta-globin

Calculated ratio of pSB1C3 (vector) and hgh(insert) or betaglobin (insert)

Freiburg10 Ligation ration of pSB1C3 hGH and betaglobin 28 07 2010.jpg

The ligated samples

pSB1C3_hGH
pSB1C3_betaglobin

were transformed with XL1B and incubated on agar-plates containing chloramphenicol over night at 37°C.

Results of ITR Trafo

Investigator: Hanna

Because (as mentioned above) there was a bacteria lawn on the right-ITR plate and many colonies on the left-ITR plate three different approaches were performed:

1. Trafo of rightITR-RFC25_pGA14 and leftITR-Präfix_pGA14 was conducted one more time:

Abberances:

3µL DNA-sample was added to 50 µL cells (BL21).
Cells were incubated on ice for just 10 minutes.
Heat shock: 42 seconds at 42°C.
Incubation for just 35 minutes at 37°C, rotating (800 rpm).
Agar plates were prepared with Lab-Ampicillin.

Incubation at 37°C -> Picking clones in the evening.

2. Control: Bacteria were taken from the right-ITR-lawn an resuspended in 100 µL DYT. They were plated on "LabAmp-plates" and stored at 37°C.
-> If something is wrong with our Ampicillin the non-transformed bacteria have progeny-advantages and will crowd out the transformed cells. This means: If there will be no colonies detectable on the new plates, something is wrong with our Ampicillin!
Analysis: Tonight.

3. Picking clones of the left ITR plate: Two large and two small clones were picked from the left ITR plate and each was resuspened in 50 µL DYT. An "LabAmp-plate" was quartered and the four resuspened colonies were individualized each on one quarte of the plate.
Analysis: Tonight.

Trafo evaluation Rep 68&78 Pst

Investigator: Kira

Both plates Rep 68 & Rep 78 contain lots of colonies. Approx. 4 colonies from each plate will be picked and inoculated for Mini prep tomorrow.

Cellculture

Investigator: Jessica
HEK were split according to the standard protocol in 5 flasks

Mini-Prep and Test digestion of pAAV_RFC25_mgmk and pTV_CMV_7 and pTV_CMV_8

Investigator: Stefan

Comments:
mgmk was brought into iGEM standard vector. To verify the construct it will be sent for sequencing.
pTV_CMV_7 and pTV_CMV_8 are clones we recieved from the iGEM 2008 team. Because there are mistakes in the prefix and suffix a PCR will have to be done. They will be sent for sequencing as well.

Mini-Prep of pAAV_RFC25_mgmk clone 1 and 2: After performing Mini-Preps concentration was measured with Nanodrop:

pAAV_RFC25_mgmk clone 1: c = 326,0 ng/µl
pAAV_RFC25_mgmk clone 2: c = 411,3 ng/µl

Mini-Prep of pTV_CMV_7 clone 1 and 2: After performing Mini-Preps concentration was measured with Nanodrop:

pTV_CMV_7 clone 1: c = 378,2 ng/µl
pTV_CMV_7 clone 2: c = 412,9 ng/µl

Mini-Prep of pTV_CMV_8 clone 1 and 2: After performing Mini-Preps concentration was measured with Nanodrop:

pTV_CMV_8 clone 1: c = 337,6 ng/µl
pTV_CMV_8 clone 2: c = 366,6 ng/µl

Test digestion:
pAAV_RFC25_mgmk was digested with XbaI and AgeI. pTV_CMV_7 and pTV_CMV_8 were digested with XbaI and PstI.

P99 = pAAV_RFC25_mgmk clone 1
P100 = pAAV_RFC25_mgmk clone 2
P101 = pTV_CMV_7 clone 1
P102 = pTV_CMV_7 clone 2
P103 = pTV_CMV_8 clone 1
P104 = pTV_CMV_8 clone 2

components	volume of P99/µl	volume of P100/µL	volume of P101/µL	volume of P102/µl	volume of P103/µL	volume of P104/µL
DNA	2,5	2	2,5	2	2,5	2,5
BSA (10x)	1,5	1,5	1,5	1,5	1,5	1,5
Buffer 4 (10x)	1,5	1,5	1,5	1,5	1,5	1,5
XbaI	0,5	0,5	0,5	0,5	0,5	0,5
AgeI	0,5	0,5	/	0/	/	/
PstI	/	/	0,5	0,5	0,5	0,5
H2O	8,5	9	9	8,5	8,5	8,5
Total volume /µl	15	15	15	15	15	15

Expected sizes:

mgmk: 603bp
pAAV_RFC25: 4636bp

CMV: 679bp
pTV: 3408bp

Results of samples loaded 1% agarose gel and ran ~50 minutes at 115 V:

Freiburg10 pAAV RFC25 mgmk and pTV CMV 7 and pTV CMV 8 small.jpg

Sequencing

70ng/µL were sent to GATC from each clone. They were labeled:

SB 1 (pAAV_RFC25_mgmk clone 2 (P100))
SB 2 (pTV_CMV_7 clone 1 (P101))
SB 3 (pTV_CMV_8 clone 1 (P103))

For SB 1 there was sent the GOI_forward primer (O30) as well.

Site-directed mutagenesis of SspI and PvuII in pSB1C3_CFP

Investigator: Jessica

Comments: Site-directed mutagenesis was perfomed with pSB1C3_CFP in order to delete SspI and PvuII in the plasmid. These restriciton sites need to be removed because they are also in the loop we want to modify.

PCR reaction with PCR program with SspI and PvuII:

DNA template used: ppSB1C3_CFP = P51

components	volume in µl	volume in µl\|
10x PfuUltra II buffer	2.5 µl	2.5 µl
10 mM dNTP mix	0.5 µl	0.5 µl
primer_for (1:10 dilution)	O107= SDM SspI: 0,55 µl	O109= SDM PvuII: 0,58 µl
primer_rev (1:10 dilution)	O106= SDM SspI: 0,55 µl	O108= SDM PvuII: 0,59 µl
P51 (DNA template) )	0,43 µl	0,43 µl
DMSO	-	0,5µl
PfuUltra II Fusion	0.5 µl	0.5 µl
H2O	16,1 µl	15,53 µl
Total volume (e.g. 50 µl)	25 µl	25 µl

Used PCR programs for SDMs:

1) PvuII

Rounds	Temperature	Time
1	95°C	2'
20	95°C	30
	78°C	1'
	68°C	2 min 50 sec
Hold	4°C

2) SspI

Rounds	Temperature	Time
1	95°C	2'
20	95°C	30
	79°C	1'
	68°C	2 min 40 sec
Hold	4°C

Transformation was prepared according to the standard protocol

Affibody

Investigator: Hanna
In order to target the EGF-receptor (EGFR/ErbB-1/Her1) an affibody molecule can be fused to the N-terminus of e.g. VP2, which is expressed in trans. The ZEGFR:1907 was chosen for this approach. Because just the amino acid sequence is published by Friedman et al., 2008, the sequence was translated with Mr. Gene's help :) and optimized for mammalian expression.

Strategy:

Picking clones from Trafo pSB1C3_RFC25_longlinker, pSB1C3_RFC25_GSAT, pSB1C3_RFC25_SEG

Investigator: Jessica

Comment: Trafo plates looked good. Enough clones grown. Two clones of each plate were picked

10 mL containing 10µL chloramphenicol were inoculated with each clone respectively.
Put into 37°C room on shaker.

Preparation for competent XL1b

Investigator: Jessica 15 ml DYT was prepared with tetracyclin and XL1b from glycerolstock and incubates over night. goes on on thursday.

ReTrafo of pGL3_hTERT

Investigator: Bea

Comment: pGL3_hTERT received from Kira. Contains ampiciliin restitance. Retrafo was performed in order to obtain enough DNA to conduct PCR for add-on tails.

Re-transformation:

Construct used: pGL3_hTert
concentration c = 276ng/µL
Plasmid need to be diluted in order to obatain the final 100pg.
Dilution: 1:1000
Volume needed of 1:1000 dilution of pGL3_hTert:
- v = 0,37µL
100 µL aliquot of XL1-B were thawed on ice and the plasmid DNA was added.

Trafo of PAAV_RC_1.1 SDM of BamHI and SalI

Investigator: Bea

Comment: Trafo did not work (see above) therefore th etRafo have been performed again

Picking clones from the 2. Trafo of left and right ITR (Hanna)

Investigator: Jessica

Comment: Trafo plates looked good. Enough clones grown. Four clones of each plate were picked

10 mL containing 10µL Amp were inoculated with each clone respectively.
Put into 37°C room on shaker.

Comment @Hanna: also on control plate are clones grown... not on the quartered plate. back in the 37°C room

73. Labortag 29.7.2010

Mini-Prep and Test digestion of Rep 68 and Rep 78

Investigator: Kira

3 clones from each plate were picked and inoculated. The mini prep DNA extraction revealed followed DNA concentrations:

Rep 68 clone 1: 470 ng/μl clone 2: 556,15 ng/μl clone 3: 686,40 ng/μl

Rep 78 clone 1: 566,78 ng/μl clone 2: 519,68 ng/μl clone 3: 521,88 ng/μl

All 6 samples were test digested with PstI to check if the site directed mutagenesis was successful.

Components	Volume/µL	Mastermix
DNA	Variable (800 ng)	-
BSA (10x)	1	6
Buffer no. 4 (10x)	1	6
Enzyme 1 ( PstI )	0,5	3
H2O	variable	-
Total volume	10	-

Incubation: 1h @ 37 C

1% agarose gel

Marker: GeneRuler ladder mix

	Marker /µl	Sample Rep 68 clone 1 /µl	Sample Rep 68 clone 2 /µl	Sample Rep 68 clone 3 /µl	Sample Rep 78 clone 1 /µl	Sample Rep 78 clone 2 /µl	Sample Rep 78 clone 3 /µl
Lane	7	12	12	12	12	12	12

Freiburg10 Rep test digestion PstI(310).png

Results sequencing of pTV_CM clone 7 and 8 (received from iGEM team 2008)

Investigator: Bea

Comment: Sequencing results obtained from the Mini-Prep performed yesterday from the constructs pTV_CMV_7 and pTV_CMV_8 received of the iGEM Freiburg team 2008. A Retrafo has been performed and obtained plasmids of this retrafo have been send for sequencing.

Results: Seqeuncing reads look good. Plasmids contain expected CMV promoter which is already in the iGEM RFC10 standard but with one missing "G" in the prefix.

Results prefix RFC10:

Freiburg10 Sequencing results of pTV CMV prefix 29 07 2010.jpg

Results pTV_CMV_7:

Freiburg10 Sequencing results of pTV VMC 7 29 07 2010.jpg

Results pTV_CMV_8:

Freiburg10 Sequencing results of pTV VMC 8 29 07 2010.jpg

Sequencing results of pAAV_RFC25_mGMK

Investigator: Bea

Comment: Sequencing results of pAAV_RFC25_mGMK. A PCR has been perfomed in order to obtain the desired mGMK construct in the RFC25 standard. After Mini-Prep has been perfomed clone 1 has been sent to GATC for sequencing.

Freiburg10 Sequencing results of pAAV RFC25 mGMK 29 07 2010.jpg

Conclusion: The PCR amplification with designed primers to insert prefix and suffix in RFC25 standard can be verified. No nucleotide transitions can be detected. The prefix and suffix are in the designed standards. Additionally it can be confirmed that the mGMK was inserted successfully into the pAAV_RFC25 plasmid and do NOT contain any iGEM restriction sites When receiving the ordered tk30 from Mr.Gene it can be fused to the mGMK and will the be ready for using and sending to the IGEM registry (maybe this needed to be cloned into pSB1C3).

Stock solution of Ampicilin

Investigators: Johannes, Stefan

0,3g Ampicilin were dissolved in 3ml Millipore H20. PCR tubes were filled with 60 µl each and stored at -20 °C.

Mini-Prep and Test digestion of ITR constructs

Investigator: Hanna

The RFC10-Prefix was fused to the left ITR and cloned into the pGA14_Cerulean plasmid. 4 clones of the second trafo (the first trafo didn't work due to wrong preparation of the Ampicillin stock solution, see 28.7.2010) were picked yesterday. Mini-Prep was performed today.
Plasmid-no.: (pGA14_10Prefix_lITR)
P111: 321.91 ng/µL
P112: 489.96 ng/µL
P113: 341.49 ng/µL
P114: 402.3 ng/µL
Glycerol stock were prepared: B85.1 - B85.1.

The "Intermediate-Step-Suffix" was fused to the RFC10-Prefix-rITR construct and cloned into pGA14. 4 clones of the second trafo were picked yesterday. Mini-Prep was performed today.
Plasmid-no.: (pGA14_10Prefix_PreSuffix_rITR)
P115: 401.07 ng/µL
P116: 291.7 ng/µL
P117: 312.98 ng/µL
P118: 326.78 ng/µL
Glycerol stock were prepared: B84.1 - B84.1.

Test digestion

buffer used: 4 ; Restriction-enzymes used: Enzyme NotI-HF
Plasmid: P111 - P118

Pipetting scheme for for each digestion:

Components	Volume/µL
DNA	4 µL
BSA (100x)	0.1
Buffer no.4 (10x)	1
Enzyme NotI-HF	1
H2O	3.9
Total volume	10

Incubation: 55 minutes

Agarose-Gel:

0.8 g Agarose, 55 mL TAE (1.45 %), 3 µL GELRED, at 115 Volt, running time: 35 minutes

Sample	Sample/µl]	Loading dye (5x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
pGA14_Prefix_lITR clone 1	10 µl	2 µl	~ 150 bp	~ 2900 bp
pGA14_Prefix_lITR clone 2	10 µl	2 µl	~ 150 bp	~ 2900 bp
pGA14_Prefix_lITR clone 3	10 µl	2 µl	~ 150 bp	~ 2900 bp
pGA14_Prefix_lITR clone 4	10 µl	2 µl	~ 150 bp	~ 2900 bp
pGA14_Prefix_PreSuffix_rITR clone 1	10 µl	2 µl	145 bp	~ 2900 bp
pGA14_Prefix_PreSuffix_rITR clone 2	10 µl	2 µl	145 bp	~ 2900 bp
pGA14_Prefix_PreSuffix_rITR clone 3	10 µl	2 µl	145 bp	~ 2900 bp
pGA14_Prefix_PreSuffix_rITR clone 4	10 µl	2 µl	145 bp	~ 2900 bp

Marker: GeneRuler ladder mix

	Marker /µl	Sample pGA14_Prefix_lITR clone 1 /µl	Sample pGA14_Prefix_lITR clone 2 /µl	Sample pGA14_Prefix_lITR clone 3 /µl	Sample pGA14_Prefix_lITR clone 4 /µl	Sample pGA14_Prefix_PreSuffix_rITR clone 1 /µl	Sample pGA14_Prefix_PreSuffix_rITR clone 2 /µl	Sample pGA14_Prefix_PreSuffix_rITR clone 3 /µl	Sample pGA14_Prefix_PreSuffix_rITR clone 4 /µl
Lane	6	12	12	12	12	12	12	12	12

Comments:Because samples can be sent to GATC just until 7 p.m., gel run was checked already after 15 minutes:

No bands can be detected at the expected sizes. The fragment size seems to be inbetween the expectation of either 150 and 750 bp. Further on there is also an additional band visible. Because of that it's not possible to say, whether cloning worked. Therefore the three clones marked in the picture were sent to GATC for sequencing:

pGA14_Prefix_lITR clone 1: 6.5 µL plasmid + 23.5 µL H2O = "Hanna 1"
pGA14_Prefix_lITR clone 4: 5.2 µL plasmid + 24.8 µL H2O = "Hanna 2"
pGA14_Prefix_PreSuffix_rITR clone 1: 5.2 µL plasmid + 24.8 µL H2O = "Hanna 3"

Picking clones of pGL3_hTERT

Investigator: Bea

Comments: Clones will be picked from trafo plate in order to obatin single colonies in order to perform Mini-prep tomorrow.

Bacterial strain used: XL1-B
Two clones were picked of trafo plate
Inoculating of 10 mL DYT medium containing 10µL ampicillin

Picking clones of pAAV_RC_1.1 SDM of BamHI and SalI

Investigator: Bea

Comments: All trafo plates looked good, enough clones grew, aside from trafo plate XL1-B {pAAV_RC_1.1_SalI}: long PCR, where no clones grew on plate. Clones will be picked from each trafo plate in order to obatin single colonies in order to perform Mini-Prep tomorrow.

Bacterial strain used: XL1-B
Two clones were picked of each trafo plate
- XL1-B {pAAV_RC_1.1_BamHI}: long PCR
- XL1-B {pAAV_RC_1.1_BamHI}: short PCR
- XL1-B {pAAV_RC_1.1_SalI}: short PCR
Inoculating of 10 mL DYT medium containing 10µL ampicillin

Picking clones of pSB1C3_hGH and pSB1C3_betaglobin

Investigator: Bea

Comments: Clones will be picked from trafo plate in order to obatin single colonies in order to perform Mini-Prep tomorrow.

Bacterial strain used: XL1-B
Two clones were picked of each trafo plate
- XL1-B {pSB1C3_hGH}
- XL1-B {pSB1C3_betaglobin}
Inoculating of 10 mL DYT medium containing 10µL chloramphenicol

PCR with pTV_CMV with designed oligos for amplifying CMV in RFC10 standard

Investigator: Bea

Comments: Retrafo of th epTV_CMv constructs has been performed and seqeuncing revealed that the plasmid contains the CMV promoter. Therefore, PCR in order to add prefix and suffix in RFC10 standard can be performed.

Plasmid used: pTV_CMV_7 clone 2 (P102)
Plasmid has to be diluted to provide the possibilty of pipetting the volume.
- 1:1000 dilution of 412ng/µL --> c(new) = 0,412ng/µL
Primer used:
- pCMV_prefix_RFC10_for (1:10)
- pCMV_suffix_RFC10_rev (1:10)

PCR reaction:

components	volume /µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
pCMV_prefix_for_RFC10 (1:10)	2,5
pCMV_suffix_for_RFC10 (1:10)	2,5
pTV_CMV_7 clone 1 (P102)	1.8 ng = 4,5 µL of 1:1000 dilution of P102, c=412 ng/µL
DMSO	-
Phusion polymerase	0,5
H2O	29
Total volume (e.g. 50 µl)	50

Used PCR programs:

Comment: PCR will be performed over night.

Rounds	Temperature	Time
1	98°C	1'
30	98°C	15
	70°C	25
	72°C	12
Hold	4°C

Mini-Prep and Test digestion of pSB1C3_RFC25_longlinker, pSB1C3_RFC25_SEG and pSB1C3_RFC25_GSAT

Investigator: Jessica
Nanodrop

pSB1C3_RFC25_longlinker clone1: 187,8 ng/µl P105
pSB1C3_RFC25_longlinker clone2: 197,4 ng/µl P106
pSB1C3_RFC25_SEG clone1: 185,6 ng/µl P107
pSB1C3_RFC25_SEG clone2: 182,6 ng/µl P108
pSB1C3_RFC25_GSAT clone1: 179,5 ng/µl P109
pSB1C3_RFC25_GSAT clone2: 202,5 ng/µl P110

Test digestion 1µg DNA

components	P105 /µl	P107 /µl	P109 /µl
DNA	5,3	5,3	5,6
BSA (10x)	1	1	1
Buffer 4 (10x)	1	1	1
H2O	2,2	2,2	1,9
Total volume (e.g. 15,20,25,30 µl)	10	10	10

agarose gel: 2%, digestion: 45 minutes, 37°C

Freiburg10 test digestion of linkers.jpg

P105, P107 and P109 are sent for sequenzing with Reverse Primer (VR2)

Comments:this is no satisfying result. we can't imagine what this bands stand for. maybe the CFP is still in the pSB1C3 and the digestion of the pSB1C3_RFC25_CFP didn't work. P105, P107 and P109 are sent for sequenzing to look for the CFP respectively the linkers

Picking clones of pSB1C3_CFP w/o SspI and PvuII

Investigator: Jessica

Bacterial strain used: XL1-B
Four clones were picked of trafo plate
Inoculating of 10 mL DYT medium containing 10µL chloramphenicol

Hanna will do the Mini Prep tomorrow

Inoculation of pSB1C3_RFC25_CFP

Investigator: Jessica

200ml DYT was prepared with 200µl chloramphenicol and the glycerol stock no. B39
stored in the 37°C room over night for Midi Prep tomorrow

74. Labortag 30.7.2010

Continuation of PCR with pTV_CMV and digestion of pSB1C3

Investigator: Bea

Comments: Retrafo of the pTV_CMv constructs has been performed and sequencing revealed that the plasmid contains the CMV promoter. Therefore, PCR was be performed overnight. After PCR the PCR product was loaded on a 1% preparative agarose gel. While PCR was separated by the agarose gel, digestion of pSB1C3_CFP was performed.

Proceeding:

Prepare 1% agarose gel and load samples on gel.
Run time: 45 minutes

Result of gel:

Expected sizes of PCR products:

CMV = 681 bp

Freiburg10 PCR with pTV CMV 30 07 2010.jpg

After gel extraction was performed, the PCR prdouct CMV was digested:

DIGESTION of PCR products

Components	Volume/µL
PCR product: CMV	29
BSA (100x)	0,4
Buffer 4 (10x)	4
Enzyme XbaI	1
Enzyme PstI	1
H20	4,6
Total volume	40

Incubate for 2h at 37°C
Perform PCR purification following standard protocols
Elute in 20µL EB-buffer, put on 50°C for 3 minutes before centrifugating
Measure DNA with NanoDrop:

c(CMV) = 87,4ng/µL

In the meantime prepare the digestion of vector pSB1C3_CFP (P51)

DIGESTION of pSB1C3_CFP

Components	Volume/µL
pSB1C3_CFP	6
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme XbaI	1
Enzyme PstI	1
H20	8
Total volume	20

Incubate for 2h at 37°C
Load sample on 1% preparative agarose gel
Run for 45 minutes at 110 V

Result of gel:

The vector was digested with XbaI and PstI. Expected sizes have been:

pSB1C3 = 2072bp
CFP: 732bp

Freiburg10 Digestion of pSB1C3 CFP with XbaI and PstI 30 07 2010.jpg

Proceed with ligation of pSB1C3 and CMV

v (vector) = 7,37µL
v (insert)= 1,63µL

Trafo has been performed with XL1B cells.

100µL if XL1B cells have been transformed with 2µL of pSB1C3_CMV
Transformed cells have been plated on agar plates containing chloramphenicol

Next steps: Picking clones of trafo plate and performing Mini-Prep. When all BioBricks are ready conduct assembly strategy and test constructs.

Repetition of test digestion of Rep 68 and Rep 78

Investigator: Kira

Components	Volume/µL	Mastermix
DNA	Variable (800 ng)	-
BSA (10x)	1	6
Buffer no. 4 (10x)	1	6
Enzyme 1 ( PstI )	0,5	3
H2O	variable	-
Total volume	10	-

Incubation: 1h @ 37 C

1% agarose gel

Marker: GeneRuler ladder mix

1/3 of the digested solution was diluted in 2/3 water because the agarose gel from yesterday showed very distinct bands

	Marker /µl	Sample Rep 68 wt	Sample Rep 68 clone 1 /µl	Sample Rep 68 clone 2 /µl	Sample Rep 68 clone 3 /µl	Sample Rep 78 clone 1 /µl	Sample Rep 78 clone 2 /µl	Sample Rep 78 clone 3 /µl	Sample Rep 78 wt
Lane	7	12	12	12	12	12	12	12	12

TAE buffer was changed before start, the samples have been diluted to 1/3 but the bands are still very distinct. However, it is possible to analyse the gel. Rep 68 contains no PstI restriction sites anymore, while Rep 78 shows one band, which might be due to the additional PstI restiction site.

clone1_Rep68 and clone1_ Rep78 were sent for sequencing

Continuation: left ITR

Investigator: Hanna

GATC didn't manage to do the sequencing of the left ITR-Präfix construct until now. This can be interpreted as positive news, because this increases the fact that the ITR is in the plasmid (very strong secondary structures!). Therefore cloning will be continued today:

Practical Cloning:

Digestion of pGA14_Cerulean (P61) and of pGA14_10Präfix-lITR (P111)

components	volume of pGA14_Cerulean (P61) /µl	volume of pGA14_10Präfix-lITR (P111) /µl
DNA	7.5	9.3
BSA (100x)	0.2	0.2
Buffer 4 (10x)	2	2
Enzyme 1	PstI-HF: 1	NotI-HF: 1
Enzyme 2	XbaI: 1	XbaI: 1
H2O	8.3	6.5
Total volume	20	20

Incubation: ~2 h

Agarose-Gel:

P61:
0.5 g Agarose, 50 mL TBE!!! (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes
P111:
0.8 g Agarose, 50 mL TBE!!! (1.45 %), 3 µL GELRED, at 115 Volt, running time: 35 minutes

Sample	Sample/µl]	Loading dye (5x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
P61	20 µl	5 µl	2896 bp	~ 750 bp
P111	20 µl	5 µl	151 bp	~ 2890 bp

Marker: GeneRuler ladder mix

Gelextraction

Gel measurement:

Sample	Concentration
P61	12.44 ng/µL
P111	11.21 ng/µL

Oligo-Hybridization

RFC10-Suffix of left ITR:

10 µL Oligo 1 (O102)
10 µL Oligo 2 (O103)
4 µL 100 mM TrisHCl pH8
8 µL 5 mM MgCl2
8 µL H2O

Total: 40 mL

Thermocycler program: ORIGAMI1
1. 99°C, 7'
2. 99°C, 1'
73 x, -1°C; R = 0.3 °/s
3. Hold 4°C

Ligation

left ITR fragment: 6.2 µL
Suffix: 1 µL
pGA14: 11.5 µL
Buffer: 2.2 µL
T4 Ligase: 1 µL

Total: 21.9 µL
Sample will be incubating over night in the thermocycler at 16°C.

Continuation: right ITR

Investigator: Hanna

Sequencing results delivered that the right ITR was succesfully ligated to the pGA14 plasmid. Unfortunately just about 100 bp were successfully sequenced. Within the ITR region sequencing seemed one more time not to be possible due to the very strong secondary structures which hinder the polymerase to read through. Therefore we can just validate that the ITR with the prefix is inside pGA14, but it's not possible to give a statement about the ITR quality or whether the suffix was successfully fused to the sequence. Theoretically the digested plasmid is not able to religate without ITR and Suffix sequence. But noone knows what our E.colis are able to achieve :)

Freiburg10 pGA14 rITR-Prefix PreSuffix.jpg

Nevertheless we decided to continue with the experiment:

Practical Cloning:

Digestion of pGA14_Cerulean (P61) and of pGa14_Präfix-PreSuffix-rITR (P115)

components	volume of pGA14_Cerulean (P61) /µl	volume of pGa14_Präfix-PreSuffix-rITR (P115) /µl
DNA	7.5	7.5
BSA (100x)	0.2	0.2
Buffer 4 (10x)	2	2
Enzyme 1	EcoRI-HF: 1	EcoRI-HF: 1
Enzyme 2	SpeI: 1	SpeI: 1
H2O	8.3	8.3
Total volume	20	20

Incubation: ~2 h

Agarose-Gel:

P61:
0.5 g Agarose, 50 mL TBE!!! (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes
P115:
0.8 g Agarose, 50 mL TBE!!! (1.45 %), 3 µL GELRED, at 115 Volt, running time: 35 minutes

Sample	Sample/µl]	Loading dye (5x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
P61	20 µl	5 µl	2895 bp	~ 750 bp
P115	20 µl	5 µl	171 bp	~ 2890 bp

Marker: GeneRuler ladder mix

Gelextraction

Gel measurement:

Sample	Concentration
P61	16.65 ng/µL
P115	7.95 ng/µL

Ligation

right ITR fragment: 2.2 µL
pGA14: 5.8 µL
Buffer: 1 µL
T4 Ligase: 1 µL

Total: 10 µL
Sample will be incubating over night in the thermocycler at 16°C.

ITR gel pictures

Investigator: Hanna

Digestion worked. The marked bands were cut out.

Digestion of the right ITR fragment worked well. Unfortunately the left ITR fragment is too large. The ecpectation was ~ 151 bp. It seemed to consist of ~ 300 bp. --> Two ITRs in tandem??? Hopefully GATC will find a way in order to sequence the ITRs!

ZEGFR:1907

Investigator: Hanna (guided by Sven)

The Affibody-BioBrick (RFC25) was ordered at Geneart. The sequence does not contain any iGEM restriction sites. We'll receive the DNA in ~ 8 work days.
Strategy: See Lab day 28.07.2010.
More information: See Informationssammlung zum AAV and Theoretical cloning !!

Mini-Prep and Test digestion of pSB1C3_SDM_SspI, pSB1C3_SDM_PvuII, pSB1C3_beta-globin, pSB1C3_hgH, pAAV_RC_1.1_BamHI long PCR, pAAV_RC_1.1_BamHI short PCR,pGL3_hTERT and pAAV_RC_1.1_SalI (short PCR), pAAV_RC_1.1_BamHI long PCR, pAAV_RC_1.1_BamHI short PCR

Investigator: Anissa, Stefan

Comments: There are some (SspI, PvuII, BamHI, SalI) restriction sites in our standard vector which are also present in the viral loops. Therefore, the sites in the vector have to be removed. The beta-globin and hGH constructs are BioBricks for sending to iGEM headquarters. Sequencing is needed. hTERT is tumor-specific promotor we obtained from Kira. Sequencing is needed.

Mini-Prep of pSB1C3_SDM_SspI clone 1 to 4: After performing Mini-Preps concentration was measured with Nanodrop:

pSB1C3_SDM_SspI clone 1 (=P125): c = 321,9 ng/µl
pSB1C3_SDM_SspI clone 2 (=P126): c = 290,3 ng/µl
pSB1C3_SDM_SspI clone 3 (=P127): c = 309,0 ng/µl
pSB1C3_SDM_SspI clone 4 (=P128): c = 298,1 ng/µl

Mini-Prep of pSB1C3_SDM_PvuII clone 1 to 4: After performing Mini-Preps concentration was measured with Nanodrop:

pSB1C3_SDM_PvuII clone 1 (=P129): c = 308,4 ng/µl
pSB1C3_SDM_PvuII clone 2 (=P130): c = 316,9 ng/µl
pSB1C3_SDM_PvuII clone 3 (=P131): c = 445,6 ng/µl
pSB1C3_SDM_PvuII clone 4 (=P132): c = 445,4 ng/µl

Mini-Prep of pSB1C3_beta-globin clone 1 and 2: After performing Mini-Preps concentration was measured with Nanodrop:

pSB1C3_beta-globin clone 1 (=P133): c = 221,9 ng/µl
pSB1C3_beta-globin clone 2 (=P134): c = 206,3 ng/µl

Mini-Prep of pSB1C3_hgH clone 1 and 2: After performing Mini-Preps concentration was measured with Nanodrop:

pSB1C3_hgH clone 1 (=P135): c = 245,5 ng/µl
pSB1C3_hgH clone 2 (=P136): c = 226,2 ng/µl

Mini-Prep of pAAV_RC_1.1_BamHI (long PCR) clone 1 and 2: After performing Mini-Preps concentration was measured with Nanodrop:

pAAV_RC_1.1_BamHI (long PCR) clone 1 (=P137): c = 537,8 ng/µl
pAAV_RC_1.1_BamHI (long PCR) clone 2 (=P138): c = 546,9 ng/µl

Mini-Prep of pAAV_RC_1.1_BamHI (short PCR) clone 1 and 2: After performing Mini-Preps concentration was measured with Nanodrop:

pAAV_RC_1.1_BamHI (short PCR) clone 1 (=P139): c = 547,0 ng/µl
pAAV_RC_1.1_BamHI (short PCR) clone 2 (=P140): c = 494,0 ng/µl

Mini-Prep of pGL3_hTERT clone 1 and 2: After performing Mini-Preps concentration was measured with Nanodrop:

pGL3_hTERT clone 1 (=P141): c = 286,1 ng/µl
pGL3_hTERT clone 2 (=P142): c = 319,9 ng/µl

Mini-Prep of pAAV_RC_1.1_SalI (short PCR) clone 1 and 2: After performing Mini-Preps concentration was measured with Nanodrop:

pAAV_RC_1.1_SalI (short PCR) clone 1 (=P143): c = 480,0 ng/µl
pAAV_RC_1.1_SalI (short PCR) clone 2 (=P144): c = 510,7 ng/µl

Test digestion:
pSB1C3_SDM_SspI was digested with SspI.
pSB1C3_SDM_PvuII was digested with PvuII.
pSB1C3_beta-globin was digested with XbaI and PstI.
pSB1C3_hgH was digested with XbaI and PstI.
pAAV_RC_1.1_BamHI (long PCR) was digested with BamHI.
pAAV_RC_1.1_BamHI (short PCR) was digested with BamHI.
pGL3_hTERT was digested with BglII and MluI.
pAAV_RC_1.1_SalI (short PCR) was digested with SalI.

components	volume of P125/µl	volume of P126/µl	volume of P127/µl	volume of P128/µl	volume of neg. control P51.1/µl	volume of P129/µl	volume of P130/µl	volume of P131/µl	volume of P132/µl	volume of neg. control P51.1/µl	volume of P133/µl	volume of P134/µl	volume of P135/µl	volume of P136/µl	volume of P137/µl	volume of P138/µl	volume of neg. control P53.3/µl	volume of P139/µl	volume of P140/µl	volume of neg. control P53.2/µl	volume of P141/µl	volume of P142/µl	volume of P143/µl	volume of P144/µl	volume of neg. control P53.1/µl
DNA	3	3	3	3	7	3	3	2	2	7	4	4	4	4	1,5	1,5	2	1,5	2	2	3	3	2	1,8	2
BSA (10x)	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5
Buffer 4 (10x)	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5	1,5
Enzyme 1	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5	0,5
Enzyme 2	/	/	/	/	/	/	/	/	/	/	0,5	0,5	0,5	0,5	/	/	/	/	/	/	0,5	0,5	/	/	/
H2O	8,5	8,5	9,5	9,5	4,5	8,5	8,5	8,5	8,5	4,5	7	7	7	7	10	10	9,5	10	9,5	9,5	8	8	9,5	9,7	9,5
Total volume /µl	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15	15

Expected sizes:
pSB1C3_SDM_SspI

no cut

control:

2072bp

pSB1C3_SDM_PvuII

no cut

control:

2072bp

pSB1C3_beta-globin

756bp
2058bp

pSB1C3_hgH

502bp
2058bp

pAAV_RC_1.1_BamHI (long and short PCR):

no cut

control:

811bp
6524bp

pGL3_hTERT

467bp
4801bp

pAAV_RC_1.1_SalI (short PCR):

no cut

control:

7331bp

Results of samples loaded 1% agarose gel and ran ~50 minutes at 115 V:

Freiburg10 Test digestion of P125-144.png

Sequencing

Sequencing will be done next week.

Midi-prep of pSB1C3_CFP

Investigator: Anissa

Comments: The mini-prep of pSB1C3_CFP was depleted, so a double midi-prep was made for serving the pool. They were named p51.1 and p51.2. Both are from the glycerol-stock B39, which means they are sequenzed and ready to use.

concentration p51.1: 132,06 ng/µL
concentration p51.2: 151,47

75. Labortag 31.7.2010

Trafo of ITR-over-night ligations

Investigator: Hanna

The last step of the ITR fancy method was done ytesterday. Means: If cloning worked, both ITRs should be in the RFC10 standard. Ligation was done over night and the referring trafo will be done today.

Trafo was performed following the standard protocol.
Abberations:
3 µL sample was added to BL21 cells. Incubation time on ice was just 15 minutes. Incubation at 37°C for 45 minutes.

=> Go to Labjournal August part 1 (labday 76 - 92)

@@ Line 1: / Line 1: @@
+{{:Team:Freiburg_Bioware/css}}
+{{:Team:Freiburg_Bioware/Head}}
+{{:Team:Freiburg_Bioware/menu_notebook}}
+{{:Team:Freiburg_Bioware/jquery}}
 <!-- Freiburg_bioware -->
+[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook => Back to Notebook overview]<br><br>
 <html>
-<!-- Stylesheed -->
+<div class="box_right">
-<style>
+<left><u1>NoteBook Navigator</u1></left>
+<br>
-#content {
-width: 965px;
-/*background-color: #3300ee;*/
-}
-#banner_top {
-opacity: 1;
-width: 965px;
-height: 200px;
-margin: 0px 0px 0px 0px;
-}
-/*Menu and the corresponding buttons*/
-#menu {
-width: 900px;
-margin: 30px 0px 30px 0px;
-}
-div.menu_button {
-float: left;
-width: 110px;
-}
-div.menu_button a {
-font-weight: bold;
-font-size: 12px;
-/*border: 1px solid black;*/
-text-decoration: none;
-color: #555555;
-background: transparent url(http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/7/7e/Freiburg10_Buttongrau100.png) no-repeat scroll center center;
-}
-div.menu_button a:hover {
-/*color: #999999;*/
-background: transparent url(http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/9/99/Freiburg10_Buttongruen100.png) no-repeat scroll center center;
-}
-#BHome a {
-padding: 20px 35px 20px 35px;
-margin: 10px 2px 10px 2px;
-}
-#BTeam a {
-padding: 20px 35px 20px 35px;
-margin: 10px 2px 10px 2px;
-}
-#BProject a {
-padding: 20px 30px 20px 30px;
-margin: 10px 2px 10px 2px;
-}
-#BBioBricks a {
-padding: 20px 15px 20px 15px;
-margin: 10px 2px 10px 2px;
-}
-#BNote a {
-padding: 20px 22px 20px 21px;
-margin: 10px 2px 10px 2px;
-}
-#BSponsors a {
-padding: 20px 24px 20px 22px;
-margin: 10px 2px 10px 2px;
-}
-#BSafety a {
-padding: 20px 32px 20px 32px;
-margin: 10px 2px 10px 2px;
-}
-#BModelling a {
-padding: 20px 24px 20px 24px;
-margin: 10px 2px 10px 2px;
-}
-/* Main area */
-div.overall {
-width: 965px;
-margin: 30px 0px 0px 0px;
-}
-#subMenu {
-width: 165px;
-height: 600px;
-float: left;
-margin: 40px 10px 0px 0px;
-border: 1px solid black;
-}
-div.box_right {
-width: 780px;
-height: auto;
-float: left;
-margin: 40px 0px 0px 0px;
-/*border: 1px solid black;*/
-}
-</style>
-<!-- Start stuff you see -->
-<!-- Banner -->
-<img src="http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/3/31/Freiburg10_Header_wiki.png" alt="banner" id="banner_top"/>
-<!-- Menu -->
-<center>
-<div id="menu">
-<div class="menu_button" id="BHome"><a href="https://2010.igem.org/Team:Freiburg_Bioware" target="blank">Home</a></div>
-<div class="menu_button" id="BTeam"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Team" target="blank">Team</a></div>
-<div class="menu_button" id="BProject"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project" target="blank">Project</a></div>
-<div class="menu_button" id="BBioBricks"><a href="https://2010.igem.org/Team:Freiburg_Bioware/BioBricks" target="blank">BioBricks &trade;</a></div>
-<div class="menu_button" id="BNote"><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook" target="blank">Note Book</a></div>
-<div class="menu_button" id="BSponsors"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Sponsors" target="blank">Sponsors</a></div>
-<div class="menu_button" id="BSafety"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Safty" target="blank">Safety</a></div>
-<div class="menu_button"id="BModelling"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Modelling" target="blank">Modelling</a></div>
-</div>
-</center>
-<!-- Main area -->
-<div id="subMenu">
-</div>
-<div class="box_right">
 <ul>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/March">March</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/March">March (labday 1)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/April">April</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/April">April (labday 2 - 5)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/May">May</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/May">May (labday 6 - 17)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June">June</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June">June (labday 18 - 45)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July">July</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July">July (labday 46 - 75)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August">August</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August">August part 1 (labday 76 - 92)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September">September</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August2">August part 2 (labday 93 - 106)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October">October</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September">September part 1 (labday 107 - 123)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/November">November</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September2">September part 2 (labday 124 - 135)</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October">October part 1 (labday 136 - 149 )</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October2">October part 2 (labday 150 - 166 )</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/November">November  (labday 167 - 170 )</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/Cellculture">Cellculture</a></li>
 </ul>
+</div>
 </html>
 ==Juli==
-===46.Labortag 01.07.2010===
+===<p style="font-size:17px; background-color:#00dd77;">46.Labortag 01.07.2010</p>===
 ====<p style="font-size:15px; background-color:#66bbFF;"><b>qPCR</b></p>====
@@ Line 148: / Line 42: @@
 <ul>
-<li>HT1080 cells were thawd following standard protocols</li>
+<li>HT1080 cells were thawed following standard protocols</li>
 <li>HT1080 passage 3</li>
 <li>Incubation at 37°C</li>
@@ Line 172: / Line 66: @@
   <br><br><br><br><br><br>
-[[Image:Freiburg_Progress in the VPex seq.png|1200px|Progess of the sequencing of the VPex constructs provided by PD Dr. Kleinschmidt (DKFZ)]]
+[[Image:Freiburg_Progress in the VPex seq.png|800px|Progess of the sequencing of the VPex constructs provided by PD Dr. Kleinschmidt (DKFZ)]]
-===47.Labortag 02.07.2010===
+===<p style="font-size:17px; background-color:#00dd77;">47.Labortag 02.07.2010</p>===
 ====<p style="font-size:15px; background-color:#66bbFF;"><b>Fluoroscence Pictures of Transduction 3</b></p>====
@@ Line 190: / Line 84: @@
 ====<p style="font-size:15px; background-color:#66bbFF;"><b>Seeding and Splitting HEK</b></p>====
 <p><b>Investigators: Johannes, Kira, Patrick, Chris W</b></p><br>
 * 4 Petri dishes (each 10ml DMEM, 1,5*10^6 cells) and one 75 cell culture bottle (20ml DMEM, 1,5*10^6 cells). The cell density was not sufficient so we could not seed 3x10^6 in the 10 cm dishes as planed initially.
@@ Line 216: / Line 108: @@
 The 453 insertion site is acoording to [Boucas et al., 2009] a promising alternative to the 585/588 integration site.
 The Peptides were integrated between the 453 Glycine and the 454 Threonine. This risidues were annotated in the gene maps (Genious) and visualized in the 3D structure (PyMOL).
-<br><br>infos from the paper<br><br>
+<br><br><br><br><br><br><br><br><br>
-<br><br>infos from the paper<br><br>
-<br><br>infos from the paper<br><br>
-<br><br>infos from the paper<br><br>
 ====<p style="font-size:15px; background-color:#66bbFF;"><b>Searching new restriction sites in the 585/588 WT loop</b></p>====
@@ Line 232: / Line 120: @@
 Informations for the restriction enzymes were looked up in the [http://www.neb.com/nebecomm/products/category1.asp?#2 NEB Product catalogue].
-[[Image:Freiburg_Search for restriction sites in the 585_588 loop WT sequence.png|1100px|right|thumb|Search for restriction sites in the 585/588 WT loop  sequence]]
+[[Image:Freiburg_Search for restriction sites in the 585_588 loop WT sequence.png|900px|center|thumb|Search for restriction sites in the 585/588 WT loop  sequence]]
 The three restriction sites are:
@@ Line 317: / Line 205: @@
 Especially the position where the cut is performed is ideal for our purpose because peptides are usually integrated after the Glycine 453 as described for example in [Boucas et al.; 2009].
-===48.Labortag 03.07.2010===
+===<p style="font-size:17px; background-color:#00dd77;">48.Labortag 03.07.2010</p>===
 ====<p style="font-size:15px; background-color:#66bbFF;"><b>Planing the gene synthesis to replace the three restriction sites in the rep ORF</b></p>====
@@ Line 353: / Line 241: @@
 '- CGTGGAGATCGAGTGGGAGCT'''C'''CAGAAGGAAAACAGCAAACGCTGG -3'<br>
-[[Image:Freiburg_RFC 25 restriction sites in the rep ORF.png|1100px|right|thumb|Restriction sites of the RFC25 standard located in the Rep ORF shown in dark blue and single cuting restriction endunucleases shown in light blue ]]
+[[Image:Freiburg_RFC 25 restriction sites in the rep ORF.png|900px|center|thumb|Restriction sites of the RFC25 standard located in the Rep ORF shown in dark blue and single cuting restriction endunucleases shown in light blue ]]
 The region with the three restriction sites that are located near to each other is show in the picture above. The restriction sites indicated in light blue are single cutters and can therefor be use to clone the synthesized fragment into the original sequence of pAAV-RC.<br>
@@ Line 377: / Line 265: @@
 This are all the restriction sites in the ORFs for the Rep and Cap proteins. In the backbone of the pAAV_RC there are more restriction sites in the iGEM standard. These restriction sites should not cause any problems when the insert in cloned into a standard iGEM vector.
 An other interesting question is what has been changed in the regulatory region p5. This will be important to determine the sequence that is required for the functional expression of the pAAV-RC.
 ====<p style="font-size:15px; background-color:#66bbFF;"><b>Modification of the Cap genes</b></p>====
@@ Line 404: / Line 291: @@
 The 293 cells were checked for cell density. They will be >70% confluent tomorrow and therefore transfected.
-===49.Labortag 04.07.2010: Transfection nr.3===
+===<p style="font-size:17px; background-color:#00dd77;">49.Labortag 04.07.2010:</p> ===
+====<p style="font-size:15px; background-color:#66bbff;">Transfection nr.3</p>====
-Investigators: Chris W, Patrick
+'''Investigators: Chris W, Patrick'''
+<br />
-Transfektion with P41 was performed according standart protocol.
+Transfection with P41 was performed according standart protocol.
 Two transfektions where carried out with 10µg (3,33 µg each plasmid) DNA and the other two with 20µg DNA (6,66 µg each plasmid).
-===50.Labortag 05.07.2010:Repetition of ITR restriction site modification via PC, Splitting HT and HEK cells, Preparation of HT1080 3x6er dishes for Transduction, Preparation of 6x10cm  cellculture dishes HEK293 ===
+===<p style="font-size:17px; background-color:#00dd77;">50.Labortag 05.07.2010:</p>===
+====<p style="font-size:15px; background-color:#66bbff;">Sequencing of pAAV_iGEM-mVenus-YFP</p>====
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of pAAV_iGEM-mVenus-YFP</u></p>
+'''Investigator: Hanna <br>'''
-Hanna <br>
 Alignment of sequenced hGH region with pAAV_iGEM_mVenus-YFP delivered following picture:<br>
-[[Image:Freiburg10 hGHsequencing.JPG|900px|]] <br>
+[[Image:Freiburg10 hGHsequencing.JPG|900px|thumb|center]] <br>
 There seemed to be a nucleotide insertion. But by having a closer look, we recognized that Geneious mis-interpreted the signal at this point. Further on we could validate that YFP was also successfully cloned into this clone. Unfortunately the sequencing of the gene of interest didn't work - neither with the forward, nor with the reverse primer. Their sequences were checked on the order form: Everything OK! <br>
 '''To do: Repeat sequencing of GOI!'''
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Dirty and fancy method for ITR BioBrick production</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Dirty and fancy method for ITR BioBrick production</p>====
-Hanna <br>
+'''Investigator: Hanna'''<br>
 A new strategy for ITR BioBrick production was figured out. This method does NOT require any PCR steps! :) <br>
 We want to take advantage of the fact, that the ITRs are flanked by NotI and PstI. <br>
@@ Line 433: / Line 319: @@
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Beta-globin BioBrick production:</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Beta-globin BioBrick production</p>====
-Hanna <br>
+'''Investigator: Hanna''' <br>
 The beta-globin sequence (pAAV_MCS) contains no iGEM-restriction sites. Therefore we decided NOT to order the sequence, but to perform a PCR with RFC10 overhang primers: <br>
-[[Image:Freiburg10 beta-globin for.JPG|600px|]] <br>
+[[Image:Freiburg10 beta-globin for.JPG|thumb|center|500px|]] <br>
-[[Image:Freiburg10 beta-globin rev.JPG|600px|]] <br>
+[[Image:Freiburg10 beta-globin rev.JPG|thumb|center|500px|]] <br>
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>hGH BioBrick production:</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">hGH BioBrick production</p>====
-Hanna <br>
+'''Investigator: Hanna <br>'''
 The hGH sequence (pAAV_MCS) contains no iGEM-restriction sites. Therefore we decided NOT to order the sequence, but to perform a PCR with RFC10 overhang primers: <br>
-[[Image:Freiburg10_hGH_for.JPG|600px|]] <br>
+[[Image:Freiburg10_hGH_for.JPG|thumb|center|500px|]] <br>
-[[Image:Freiburg10_hGH_for.JPG|600px|]] <br>
+[[Image:Freiburg10_hGH_for.JPG|thumb|center|500px|]] <br>
 <br>
-====Splitting HT and HEK cells====
+====<p style="font-size:15px; background-color:#66bbff;">Splitting HT and HEK cells</p>====
-*Investigators: Adrian, Bea
+*'''Investigators: Adrian, Be'''a
 *HEK Cells: over 100% confluent!!!
 *HT-cells: over 90%   confluent!!!
-====Preparation of HT1080 3x6er dishes for Transduction====
+====<p style="font-size:15px; background-color:#66bbff;">Preparation of HT1080 3x6er dishes for Transduction</p>====
-*Investigators: Adrian, Bea
+*'''Investigators: Adrian, Bea'''
 * 3x 6well dishes got prepared with 3ml DMEM and 300.000 cells (0,0375ml of our Cell-falcon)
 * Transduction on 6.7.2010
-====Preparation of 6x10cm  petri dishes HEK293====
+====<p style="font-size:15px; background-color:#66bbff;">Preparation of 6x10cm  petri dishes HEK293</p>====
-* Investigator: Adrian
+* '''Investigator: Adrian'''
 * 6x 10cm petri dishes with 10ml with 3.000.000 cells (0,344ml of cell-falcon)
 * Transfection on 7.7.2010
-==== '''Repetition of ITR restriction site modification via PCR''' ====
+====<p style="font-size:15px; background-color:#66bbff;">Repetition of ITR restriction site modification via PCR</p> ====
+'''Investigator: Achim, Chris'''
 <li> experiment date: 5.7.2010
-<li> name of investigator: Achim, Chris
 *Because the previous attempt to replace the PSTI and NOTI restriction sites in the ITRs with the IGEM standard were unsucessful, new, longer primers were designed an ordered.
 *a new pcr reaction with higher annealing temperatures was prepared:
@@ Line 528: / Line 413: @@
 <br>
-<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Search for restriction sites in the sequence LQA/RGQA/RQA</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Search for restriction sites in the sequence LQA/RGQA/RQA</p>====
-Investigator: Volker<br>
+<b>Investigator: Volker</b><br>
 The idea to use a R588L mutation instead of the R588A that is published in the literature was discussed with the supervisers. It was proposed to search for other amino acid exchanges that alter the loop less drastically. For this reason the mutation N587Q was examined for possible restriction sites.
@@ Line 536: / Line 421: @@
 <p style="clear:both;"><li> :) </p>
-==== '''Results sequencing alignment of GMK_TK30''' ====
+====<p style="font-size:15px; background-color:#66bbff;">Results sequencing alignment of GMK_TK30</p> ====
-Investigator: Bea
+'''Investigator: Bea'''
 <br>
+<br />
 '''Result''': The obtained sequencing results indicate that the DNA we received from Amor contains the GMK_TK30 fusion enzyme, but tk30 contains some restriction sites.
 <br>
-[[Image:Freiburg10_Sequence_alignment_GMK_TK30_page1.jpg|500px|left|thumb|Sequence alignment of GMK_TK30]]
+[[Image:Freiburg10_Sequence_alignment_GMK_TK30_page1.jpg|800px|thumb|center|Sequence alignment of GMK_TK30]]
-[[Image:Freiburg10_Sequence_alignment_GMK_TK30_page2.jpg|520px|right|thumb|Sequence alignment of GMK_TK30]]
+[[Image:Freiburg10_Sequence_alignment_GMK_TK30_page2.jpg|800px|thumb|center|Sequence alignment of GMK_TK30]]
-[[Image:Freiburg10_Sequence_alignment_GMK_TK30_page3.jpg|500px|left|thumb|Sequence alignment of GMK_TK30]]
+[[Image:Freiburg10_Sequence_alignment_GMK_TK30_page3.jpg|800px|thumb|center|Sequence alignment of GMK_TK30]]
-[[Image:Freiburg10_Sequence_alignment_GMK_TK30_page4.jpg|520px|right|thumb|Sequence alignment of GMK_TK30]]
+[[Image:Freiburg10_Sequence_alignment_GMK_TK30_page4.jpg|800px|thumb|center|Sequence alignment of GMK_TK30]]
 <br>
-<p style="clear:both;"><li>To do (06.07.2010): Order primers for BioBrick Fusionenzyme and order genes of GMK and TK (wtTK, TK30, sr39????)</li>
+<ul>
-<li> remove iGEM restriction sites</p>
+<li>To do (06.07.2010): Order primers for BioBrick Fusionenzyme and order genes of GMK and TK (wtTK, TK30, sr39????)</li>
-<br>
+<li> remove iGEM restriction sites</li>
+</ul>
-===51.Labortag 6.07.2010: Harvesting AAVs from 4 10cm dishes, Transduction of 3x6er dishes ===
+===<p style="font-size:17px; background-color:#00dd77;">51.Labortag 6.07.2010: </p>===
-Investigators: Adrian, Anna, Bea, Kerstin
+====<p style="font-size:15px; background-color:#66bbff;">Harvesting AAVs from 4 10cm dishes, Transduction of 3x6er dishes</p>====
+'''Investigators: Adrian, Anna, Bea, Kerstin'''
 We want to investigate which of the following approaches yields a better transduction efficiency.
@@ Line 570: / Line 458: @@
 * 3 cycles of freezing and thawing
-<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Search for restriction sites before and after the insertion sites 453 and 585/588</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Search for restriction sites before and after the insertion sites 453 and 585/588</p>====
-Investigator: Volker<br>
+'''Investigator: Volker'''<br>
+====<p style="font-size:15px; background-color:#66bbff;">Transduction of 3x6er dishes </p>====
+'''Investigators: Adrian Bea'''
-===='''Transduction of 3x6er dishes '''====
-Investigators: Adrian Bea
 * used plasmids: 10µg, 20µg YFP
-* we have 10µg and 20µg from standart protocol => SV
+* we have 10µg and 20µg from standard protocol => SV
-* we have 10µg and 20µg from standart protocol pellet => Pellet
+* we have 10µg and 20µg from standard protocol pellet => Pellet
-* we have 10µg and 20µg from standart protocol suspension => Super
+* we have 10µg and 20µg from standard protocol suspension => Super
 * amount of 500µl
@@ Line 610: / Line 496: @@
 |}
-<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Search for restriction sites around the 453 and 585/588 integration sites</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Search for restriction sites around the 453 and 585/588 integration sites</p>====
-Investigator: Volker<br>
+'''Investigator: Volker'''<br>
 For this purpose a list of all commercially availible restriction enzymes was created that do not match in the ORFs of pAAV-RC.
-<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Search for restriction sites in the sequence LQA/RGQA/RQA</u></p>
-Investigator: Volker<br>
+====<p style="font-size:15px; background-color:#66bbff;">Search for restriction sites in the sequence LQA/RGQA/RQA</p>====
+'''Investigator: Volker<br>'''
 The idea to use a R588L mutation instead of the R588A that is published in the literature was discussed with the supervisers. It was proposed to search for other amino acid exchanges that alter the loop less drastically. For this reason the mutation N587Q was examined for possible restriction sites.<br>
@@ Line 625: / Line 513: @@
 <br>
-===52.Labortag 07.07.2010: ===
+===<p style="font-size:17px; background-color:#00dd77;">52.Labortag 07.07.2010:</p>===
-====<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of GIO</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Sequencing of GIO</p>====
-Investigator: '''Hanna''' <br>
+'''Investigator: Hanna''' <br>
 Comments: Neither sequencing with forward nor with reverse primer (O29 + O30) worked. Therefore P40 (pAAV_iGEM_mVenus-YFP) was sent for sequencing once again. <br>
 *Name: Hanna P40 <br>
@@ Line 635: / Line 523: @@
 *V(primer) = 3 µL + 27 µL H2O <br>
-====<p style="font-size:15px; font-weight: bold; color: purple;"><u>Interview with Bild der Wissenschaft</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Interview with Bild der Wissenschaft</p>====
 *'''Adrian''' did a good job ;-)
 *The article will be send to us next week
 *For additional question, Jessica will be send an email
-====<p style="font-size:15px; font-weight: bold; color: purple;"><u>Transfection</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Transfection</p>====
-Investigators:''' Adrian, Bea'''
+'''Investigators: Adrian, Bea'''
 *Transfection of AAV-293 cells with pAAV_iGEM-mVenus_YFP
-====<p style="font-size:15px; font-weight: bold; color: purple;"><u>New pcr run with new polymerase and different MgSO4 concentrations</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">New pcr run with new polymerase and different MgSO4 concentrations</p>====
 *While this time the positive control was actually positive, no pcr product could be seen. The reasons are unclear. (Secondary structures, primer binding...)
-<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Checking the results of the following sequencing reactions for the expression constructs from the DKFZ</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Checking the results of the following sequencing reactions for the expression constructs from the DKFZ</p>====
-Investigator: Volker<br>
+'''Investigator: Volker'''<br>
@@ Line 669: / Line 557: @@
 pKEX-Rep78ex: One point mutation in the second condon that changes the coded amino acids from P to A, a second mutation (ATG=>GGG) at the beginning of the Rep40/Rep52 ORFs to avoid the translation of these sequences, a silent mutation and the same point mutation at the beginning of the exon as seen before in pKEX-Rep52ex.
-===53.Labortag 08.07.2010: ===
+===<p style="font-size:17px; background-color:#00dd77;">53.Labortag 08.07.2010:</p>===
-<p style="font-size:15px; font-weight: bold; color: #014421;"><u> Final planing of the Cap modifications.</u></p>
+====<p style="font-size:15px; background-color:#66bbff;"> Final planing of the Cap modifications</p>====
-Investigator: Volker<br>
+'''Investigator: Volker'''<br>
@@ Line 734: / Line 622: @@
 Recognition site in pSB1C3:  2  <br>
-===54.Labortag 09.07.2010: ===
+===<p style="font-size:17px; background-color:#00dd77;">54.Labortag 09.07.2010:</p>===
+'''Investigators: Anissa, Kerstin, Anna'''
+<br />
 *New DMEM-Medium was prepared (10% FCS). Investigators: Bea, Patrick
 *HT and 293 cells were split into 4 flasks, 2 flasks each. Investigator: Kira
 *AAV stocks were prepared, put into the -80°C freezer and labeled with the date, name, AAV, the amount of DNA used for transfection and drop/resuspend to make clear whether the DNA was just pippeted dropwise to the 293 cells or gently mixed with the cells. The numbers on the 15 ml falcons refer to DNA amount and DNA administration, too. Investigator: Patrick
-Investigators: Anissa, Kerstin, Anna
-====<p style font-weight: bold; color: blue;">PCR of hgH</p>====
+====<p style="font-size:15px; background-color:#66bbff;">PCR of hgH</p>====
 *PCR program: Unnamed
 <br />
@@ Line 815: / Line 704: @@
 to do: Ligation of PCR product into standard plasmid which we´ve received wihthin the DNA distrivution kit of iGEM-HQ .
 <br>
-====<p style= "font-weight: bold; color: blue;">Order oligos for GMK_TK30</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Order oligos for GMK_TK30</p>====
-Investigator: '''Bea'''<br />
+'''Investigator: Bea'''
+<br />
 Oligos have been ordered at sigmaaldrich in order to insert prefix and suffix to fusionenzyme mGMK_TK30 in RFC25.
 <br>
 <br>
-[[Image:Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010.jpg]]
+[[Image:Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010.jpg|thumb|center|800px]]
 <br>
-[[Image:Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010 page2.jpg]]
+[[Image:Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010 page2.jpg|thumb|center|800px]]
 <br>
-[[Image:Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010 page3.jpg]]
+[[Image:Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010 page3.jpg|thumb|center|800px]]
 <br>
 <p style= "font-weight: bold; color: red;">to do: Order gene tk30 and part of gene sr39</p>
-====Quickchange for the PstI restriction sites in pAAV-RC====
+====<p style="font-size:15px; background-color:#66bbff;">Quickchange for the PstI restriction sites in pAAV-RC</p>====
-Investigators: Kira and Volker
+'''Investigators: Kira and Volker'''
+<br />
 Quick change, Gel and test digestion with PstI. (more precise informations will be added)<br>
 @Kira and Volker: did the Quickchange actually work? Could you please add the information onto the wiki!! Thx!
@@ Line 918: / Line 808: @@
 <br />
-===55.Labortag 11.07.2010===
+===<p style="font-size:17px; background-color:#00dd77;">55.Labortag 11.07.2010</p>===
+====<p style="font-size:15px; background-color:#66bbff;">Splitting of HT1080 cells</p>====
-HT 1080 and HEK 293 cells were split. Investigator: Patrick <br>
+'''Investigator: Patrick'''
+<br>
+HT 1080 and HEK 293 cells were split.  <br>
 @ Kira: fetch new trypsin if it is not sufficient for the next splitting !
-===56.Labortag 12.07.2010: ITR BioBrick production===
+===<p style="font-size:17px; background-color:#00dd77;">56.Labortag 12.07.2010:</p>===
+====<p style="font-size:15px; background-color:#66bbff;">Cloning CFP into pSB1C3</p>====
-<p style="font-size:20px; font-weight: bold; color: blue;"><u>Practical Cloning:</u></p>
+'''Investigator: Anna, Kerstin, Anissa'''
+<p style="font-size:13px; font-weight: bold; color: blue;"><u>Practical Cloning:</u></p>
 *experiment date: 12.07.2010 ; time: 11.00
-*name of investigator: Anna, Kerstin, Anissa
 *plasmid: pSB1c3_CFP (p48)
 **Vector: name: pSB1c3 number:- production date: - origin: iGEM
@@ Line 1,020: / Line 912: @@
 '''TRAFO-EVALUATION'''
 * Unfortunately the agar plate with p48, pSB1c3_CFP [XL1B, Cm, A.B.] does not contain any colonies. Thus, the plate was incubated @ 37 C for another 5 hours. Still no detectable colonies. This was double checked by Sven.
-<p style="font-size:20px; font-weight: bold; color: blue;"><u>Seeding HT1080 + Passage:</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Seeding HT1080 + Passage</p>====
-*Investigators: Adrian, Patrick
+*'''Investigators: Adrian, Patrick'''
 * 3* 6well dishes
 {| border="1"
@@ Line 1,034: / Line 926: @@
 * The amount of cells was doubled in first place and diluted in following steps (for further information ask patrick and adrian)
-<p style="font-size:20px; font-weight: bold; color: blue;"><u>PCR of beta-globin:</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">PCR of beta-globin:</p>====
-*Investigator: Achim
+*'''Investigator: Achim'''
 *PCR program: BETA...(?)
 <br />
@@ Line 1,109: / Line 1,001: @@
 <br>
 <br>
-<p style="font-size:15px; font-weight: bold; color: blue;">Midi-Prep preparation pAAV_RC</p>
+====<p style="font-size:15px; background-color:#66bbff;">Midi-Prep preparation pAAV_RC</p>====
-Bea
+'''Investigator: Bea'''
 *200mL LB-Medium and 200µl Amp
 *inoculated with glycerol stock containing pAAV_RC
@@ Line 1,117: / Line 1,009: @@
 <br>
-<p style="font-size:20px; font-weight: bold; color: fuchsia;"><u>First steps in producing ITR BioBricks via Fancy Method</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">First steps in producing ITR BioBricks via Fancy Method</p>====
-Hanna, Chris W. <br>
+'''Investigators: Hanna, Chris W.''' <br>
 <br>
 <p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of pGA14_Cerulean-CFP</p>
@@ Line 1,332: / Line 1,224: @@
 Samples will be incubating over night at 16°C.
-====Ordering genes for the replacement of Rep and Cap parts====
+====<p style="font-size:15px; background-color:#66bbff;">Ordering genes for the replacement of Rep and Cap parts</p>====
-Investigator: Volker guided by Sven & Tobi
+'''Investigator: Volker''' guided by Sven & Tobi
 The replacement for the Rep ORF from base 1510 to base 2008 and for the Cap ORF from base 3064 to base 3985 was ordered from Mr. Gene.
@@ Line 1,341: / Line 1,233: @@
 <br>
-<p style="font-size:20px; font-weight: bold; color: fuchsia;"><u>Sequencing of GOI</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Sequencing of GOI</p>====
-Hanna <br>
+'''Investigator: Hanna''' <br>
 This time the sequencing delivered good results: <br>
-[[Image:GOI primer for.jpg|500px|]] <br>
+[[Image:GOI primer for.jpg|thumb|center|800px|]] <br>
-[[Image:GOI primer rev.jpg|500px|]] <br>
+[[Image:GOI primer rev.jpg|thumb|center|800px|]] <br>
 <br>
 <p style="font-size:15px; font-weight: bold; color: fuchsia;">Conclusion: The designed primers can always be used in order to sequence any gene of interest!!!</p>
@@ Line 1,351: / Line 1,243: @@
 <br>
-===57.Labortag 13.07.2010:===
+===<p style="font-size:17px; background-color:#00dd77;">57.Labortag 13.07.2010:</p>===
-====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Endotoxin-free Midi Prep of pAAV_RC</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Endotoxin-free Midi Prep of pAAV_RC</p>====
-Investigators: Chris, Stefan, Patrick<br>
+'''Investigators: Chris, Stefan, Patrick'''
+<br>
 Deviations from the Standard Protocol: <br>
 As the lysate was applied to the column filter, about 1/5 of the lysate was spilled. <br>
@@ Line 1,360: / Line 1,253: @@
 A new Midi-Pred will be prepared for tomorrow: 200 ml LB, 0,2 ml Amp, E.coli XL-1-blue (with pAAV_RC plasmid).
-====<p style="font-size:20px; font-weight: bold; color: blue;"><u>HEK-293 cells</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">HEK-293 cells</p>====
 The cells were split according to the standard protocol. Investigator: Patrick
-====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Oligos pMGMK_TK30 arrived</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Oligos pMGMK_TK30 arrived</p>====
 New Oligos arrived for inserting RFC25 to thymidinkinase_gmk construct!(number O60 to O65). They were resuspended in water and a 1:10 dilution was done. They were put in Primer Box 2.
 <p style="font-size:12px; font-weight: bold; color: green;"><u>to do: perform PCR tomorrow and clone PCR product into pAAV_RFC25</u></p>
-====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Transduction</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Transduction</p>====
-Invetigators: Adrian, Patrick
+'''Investigators: Adrian, Patrick'''
 * 3 Plates got transduced
@@ Line 1,397: / Line 1,290: @@
 |-
 |}
-====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Results of Trafo of cloning CFP into pSB1C3</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Results of Trafo of cloning CFP into pSB1C3</p>====
-Investigator: Bea <br>
+'''Investigator: Bea'''
+<br>
 Results: no clones on trafo plate even after longer incubation at 37 °C<br>
 '''Solution: perform digestion of linearized plasmid pSB1C3 and pMA_CFP again!!!'''
 <br>
-====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Repetition of cloning of CFP into pSB1C3</u></p>====
-*experiment date: 13.07.2010 ; time: 16:00
+====<p style="font-size:15px; background-color:#66bbff;">Repetition of cloning of CFP into pSB1C3</p>====
-*name of investigator: Bea
+'''Investigator: Bea'''
+*experiment date: 13.07.2010 ; time: 16:00
 **Vector: name: pSB1c3 number: do not have any number production date: - origin: iGEM HQ sent per DNA distribution kit
 **Insert: name: pMA_CFP number:- production date: - origin: iGEM 2009
@@ Line 1,495: / Line 1,390: @@
 *Trafo plate in 37°C room for incubating at 23:00
-====TRANSFORMATION of Quickchange PstI====
+====<p style="font-size:15px; background-color:#66bbff;">TRANSFORMATION of Quickchange PstI</p>====
-Investigator: Kira
+'''Investigator: Kira'''
 *Transfection was performed according to the standard protocol with XL1B cells.
-===58.Labortag 14.07.2010: Seed HEK, DAAD Timetable, Summary, Ordering ITR+TKGMKI, Quickchange for the PstI restriction sites in pAAV-RC===
+===<p style="font-size:17px; background-color:#00dd77;">58.Labortag 14.07.2010</p>===
-====Trafo evaluation of Quickchange PstI====
-Investigator: Kira
+====<p style="font-size:15px; background-color:#66bbff;">Trafo evaluation of Quickchange PstI</p>====
+'''Investigator: Kira'''
 <br />
 Both plates contained lots of colonies, while 8-10 colonies are considered for inoculation to perform a mini prep and an additional test digestion.
@@ Line 1,508: / Line 1,404: @@
 ====Quickchange for the PstI restriction sites in pAAV-RC (modified)====
-Invetigators: Kira
+'''Investigators: Kira'''
 '''PCR program''': PstI
@@ Line 1,573: / Line 1,469: @@
 *The transformation of XL1B was performed according to the standard protocol but with DYT instead of LB.
-====Results of trafo cloning pSB1C3_CFP====
+====<p style="font-size:15px; background-color:#66bbff;">Results of trafo cloning pSB1C3_CFP</p>====
-Investigator: Bea<br>
+'''Investigator: Bea'''<br>
 Comments: experiment have been repeated because no clones were grown after the last trafo!<br>
 *There have been clones grown on the trafo plate. Four clones were picked and inoculated on LB_Medium containing Cm (Chloramphenicol).
 *18:00: 37°C room on shaker. Incubating over night!
-====Seed HEK====
+====<p style="font-size:15px; background-color:#66bbff;">Seed AAV-293</p>====
-Investigators: Adrian ,Bea
+'''Investigators: Adrian ,Bea'''
 * 2x75cm2 culture flasks
 * after counting via neubauer chamber (2,2*20*10000*(x/4))= should be around 3,xxx so it would be possible to prepare 4x10cm petri dishes with 3.000.000 cells per plate and passage 1.500.000 cells to a 75cm.
-====DAAD Timetable====
+====<p style="font-size:15px; background-color:#66bbff;">DAAD Timetable</p>====
-Investigators: Adrian, Kerstin
+'''Investigators: Adrian, Kerstin'''
+Prepared timetable for DAAD
-====Summary====
+====<p style="font-size:15px; background-color:#66bbff;">Summary</p>====
-Investigators:
+'''Investigators: all'''
 <p style="font-size:12px; color: blue;">have not been done yet! to do for tomorrow! deadline of submitting project descrpition is 16th of july!!  (Bea)</p>
-====Ordering ITR+TK/GMK====
+====<p style="font-size:15px; background-color:#66bbff;">Ordering ITR+TK/GMK</p>====
-Investigators: Bea, Sven
+'''Investigators: Bea, Sven'''
 <ul>
 *It has been ordered the TK30 with NgoMIV add-on prefix and ageI and SpeI add-on suffix combined with the  wt_left_ITR in the RFC10 standard.
 </ul>
-====Endotoxoin free Midi prep mAAV_RC====
+====<p style="font-size:15px; background-color:#66bbff;">Endotoxoin free Midi prep mAAV_RC</p>====
-<br>Investigator: Chris W.
+<br>'''Investigator: Chris W.'''
 <br>Midi prep done with the Qiagen-Kit
 <br>OD of the Bacteria: 3.07
@@ Line 1,605: / Line 1,502: @@
 <br>Labeled as P50 and stored in the -20° Freezer
-====MGMK_TK30:PCR with iGEM restriction-sites and cloning into pAAV_RFC25====
+====<p style="font-size:15px; background-color:#66bbff;">MGMK_TK30:PCR with iGEM restriction-sites and cloning into pAAV_RFC25</p>====
-Investigators:Achim,Bea,Anissa
+'''Investigators: Achim,Bea,Anissa'''
 <p style="font-size:20px; font-weight: bold; color: blue;"><u>PCR:</u></p>
@@ Line 1,736: / Line 1,633: @@
 *put in 37°C room at 22:00
-====Ordering of Oligos====
+====<p style="font-size:15px; background-color:#66bbff;">Ordering of Oligos</p>====
-Investigator:Volker <br>
+'''Investigator:Volker''' <br>
 The following four Oligos were ordered:<br>
@@ Line 1,746: / Line 1,643: @@
 <br />
-===59.Labortag 15.07.2010===
-'''Picking clones for mini-prep''' <br />
+===<p style="font-size:17px; background-color:#00dd77;">59.Labortag 15.07.2010</p>===
-Investigators: Adrian, Chris, Stefan
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones for mini-prep</p> ====
+'''Investigators: Adrian, Chris, Stefan'''
 clones (1-4) of pAAV_RFC25_mgmk_tk30 where picked according to protocol for mini-prep (tomorrow). <br />
 Antibiotic: Amp <br />
 Time: 18:30
+<br />
+'''Investigators: Stefan, Patrick'''
+<br />
 '''New millipore H2O, LB + Agar and DMEM medium were prepared''' <br />
-Investigators: Stefan, Patrick
-'''HT 1080 cells were split according to the standard protocol''' <br />
-Investigators: Chris, Patrick
+====<p style="font-size:15px; background-color:#66bbff;">Splitting of HT1080 cells</p>====
+'''Investigators: Chris, Patrick <br />'''
+HT 1080 cells were split according to the standard protocol
-'''TRAFO EVALUATION (PstI Quickchange Trafo from 14.07)''' <br />
+====<p style="font-size:15px; background-color:#66bbff;">PstI Quickchange Trafo from 14.07</p>====
-Investigator: Kira <br />
+'''Investigator: Kira''' <br />
-Unfortunately no colonies are present.
+Trafo evaluation: Unfortunately no colonies are present.
-'''MINI PREP (PstI Quickchange Trafo from 13.07)''' <br />
+====<p style="font-size:15px; background-color:#66bbff;">MINI PREP (PstI Quickchange Trafo from 13.07)</p>====
-Investigator: Kira
+'''Investigator: Kira'''
 @Kira: ich habe die Clone benannt: SDM310 Nr. 1 ist jetzt P58 und sdm4073 nr 1 ist jetzt P59. Bitte eintragen.
-'''TEST DIGESTION (PstI Quickchange Trafo from 13.07)''' <br />
+====<p style="font-size:15px; background-color:#66bbff;">TEST DIGESTION (PstI Quickchange Trafo from 13.07)</p>====
-Investigator: Kira
+'''Investigator: Kira'''
 <br />
+====<p style="font-size:15px; background-color:#66bbff;">FACS</p>====
-'''FACS''' <br />
+'''Investigators: Kerstin, Anna''' <br />
-Investigators: Kerstin, Anna <br />
 FACS analysis of different treated HT1080 cells was done (18 samples)
@@ Line 1,854: / Line 1,753: @@
 * comparison of transduction efficiency of different virus stock production routines
-<p style="font-size:20px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Plasmid Mini-Prep of pSB1C3_CFP</p>====
+'''Investigators: Kerstin, Anissa'''
 *experiment date: 15.07.2010 ; time:10.00
-*name of investigator: Kerstin, Anissa
 *new vector name:pSB1C3_CFP
 <br />
@@ Line 1,883: / Line 1,783: @@
 **Given Plasmid-Number: p53; DNA concentration: 244,1 ng/µl;
 <br />
-'''Comments:'''p48 and p51 were sequenzed
+'''Comments:'''p48 and p51 were sequenced
 <br />
 <br />
@@ Line 1,981: / Line 1,881: @@
 <br>
-<p style="font-size:20px; font-weight: bold; color: fuchsia;"><u>2nd try: First steps in producing ITR BioBricks via Fancy Method</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">2nd try: First steps in producing ITR BioBricks via Fancy Method</p>====
-'''Hanna''' <br>
+'''Investigator: Hanna''' <br>
 <br>
 Unfortunately it turned out, that the digestion step of the 1st try didn't work: After the transformation very much colonies grew on the plates. Sequencing delivered, that survival of the bacteria was due to re-ligated vector... Therefore the whole experiment will be performed again today.
@@ Line 2,229: / Line 2,129: @@
 <br>
-===60.Labortag 16.07.2010===
+===<p style="font-size:17px; background-color:#00dd77;">60.Labortag 16.07.2010</p>===
-<br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Continuation of Fancy Method</u></p>====
 <br>
+====<p style="font-size:15px; background-color:#66bbff;">Continuation of Fancy ITR-method</p>====
+'''Investigator: Hanna''' <br>
 <p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Trafo</u></p>
-'''Hanna''' <br>
-<br>
 Trafo was performed following standard protocol. Aberration: Instead of 2 µL, 3 µL DNA was added to BL21 bacteria (50 µL).
 <br>
 <p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>right ITR</u></p>
-'''Hanna''' <br>
-<br>
 It turned out, that the strategy by digesting pGA14 with XbaI and PstI cannot work. pGA14 needs to be digested with '''EcoRI''' and PstI: <br>
 <br>
@@ Line 2,342: / Line 2,239: @@
 <br>
-====<p style="font-size:15px; font-weight: bold; color: blue;">Results sequencing of pSB1C3_CFP</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Results sequencing of pSB1C3_CFP</p>====
 '''Investigator: Bea'''<br>
 Plasmid: pSB1C3_CFP <br>
@@ Line 2,351: / Line 2,248: @@
 <p style="font-size:13px; font-weight: bold; color: green;">'''Results''': Sequencing reads are good. Cloning of CFP into pSB1C3 can be confirmed. There are no insertions, transitions or deletions in the sequence or the iGEM restriction sites. Using this plasmid in order to create our iGEM BioBricks in RFC10 standard can be confirmed. </p>
 <br>
-[[Image:Freiburg10 Sequencing results pSB1C3 CFP P48 KK.jpg|500px|thumb|left|Sequencing results of '''pSB1C3_CFP (plasmid number P48)'''. There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).]]
+[[Image:Freiburg10 Sequencing results pSB1C3 CFP P48 KK.jpg|800px|thumb|center|Sequencing results of '''pSB1C3_CFP (plasmid number P48)'''. There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).]]
-[[Image:Freiburg10 Sequencing results pSB1C3 CFP P51 AB.jpg|500px|thumb|right|Sequencing results of '''pSB1C3_CFP (plasmid number P51'''). There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).]]
+[[Image:Freiburg10 Sequencing results pSB1C3 CFP P51 AB.jpg|800px|thumb|center|Sequencing results of '''pSB1C3_CFP (plasmid number P51'''). There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).]]
 <br>
 <br>
-<br>
-<br>
+====<p style="font-size:15px; background-color:#66bbff;"> BioBrick production with hGH and beta-globin by cloning it into pSB1C3</p>====
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<p style="font-size:18px;"> BioBrick production with hGH and beta-globin by cloning it into pSB1C3</p>
 '''Investigator: Bea'''<br>
@@ Line 2,388: / Line 2,267: @@
 <br>
-[[Image:Freiburg10 BioBrick beta-globin missing G.jpg]]
+[[Image:Freiburg10 BioBrick beta-globin missing G.jpg|thumb|center|500px]]
 <br><br>
 <p style="font-size:15px; font-weight: bold; color: purple;">Ordered oligos:</p>
@@ Line 2,412: / Line 2,291: @@
 '''Comment: reverse beta-globin primer is correct!? (Hanna)'''
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Transfection</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Transfection</p>====
-Investigator: Adrian
+'''Investigator: Adrian'''
 <br>
 µg Plasmid were used (pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30)<br>
@@ Line 2,422: / Line 2,301: @@
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Mini Prep of pAAV_RFC25_mgmk_TK30</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini Prep of pAAV_RFC25_mgmk_TK30</p>====
-Investigator: Adrian
+'''Investigator: Adrian'''
 ml were preparated
@@ Line 2,444: / Line 2,323: @@
 Digestion: 65 minutes, 37°C. Results: No mgmk_TK30 insert detectable. I will try it again on saturday or sunday.
-====<p style="font-size:15px; font-weight: bold; color: blue;">Preparation of 50x TAE and 0,5M EDTA</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Preparation of 50x TAE and 0,5M EDTA</p>====
-Investigators: Chris W., Patrick
+'''Investigators: Chris W., Patrick'''
 <br>1 L TAE (50x)
@@ Line 2,462: / Line 2,341: @@
 <br>ad 1 L Milipor
-====Test digestion of the QuickChange for PstI (310) and PstI (4073)====
+====<p style="font-size:15px; background-color:#66bbff;">Test digestion of the QuickChange for PstI (310) and PstI (4073)</p>====
-Investigator: Kira & Volker<br>
+'''Investigator: Kira & Volker'''<br>
 The digestion showed two bands with apropirate lengt for each of the 6 clones as they were expected.<br>
@@ Line 2,470: / Line 2,349: @@
 *pAAV_RC_SDM_PstI (4073) with the primer GATC_std_M13_FP
-====Primers to convert the expression constructs into the iGEM standard were ordered.====
+====<p style="font-size:15px; background-color:#66bbff;">Primers to convert the expression constructs into the iGEM standard were ordered</p>====
-Investigator: Volker<br>
+'''Investigator: Volker'''<br>
 *Praefix VP1ex
@@ Line 2,486: / Line 2,365: @@
 <br>
-===61.Labortag 17.07.2010: left ITR===
+===<p style="font-size:17px; background-color:#00dd77;">61.Labortag 17.07.2010:</p>===
-<br>
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones of pGA14_Präfix-leftITR Trafo</p>====
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Picking clones of pGA14_Präfix-lITR Trafo</u></p>====
+'''Investigator: Hanna''' <br>
-Investigator: Hanna <br>
 <br>
 Bacteria also grew on control plates. Control means: Ligation of digested vector (pGA14_Cerulean) without insert (Präfix and left ITR). Therefore it seemed that somehow pGA14 religated (Can't be if vector digested completely). Therefore 10 colonies were picked, in order to increase the chance to get a successfully ligated plasmid.
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Mini-Preps of pGA14_Präfix-lITR cultures </u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini-Preps of pGA14_Präfix-lITR cultures</p>====
-Investigator: Hanna <br>
+'''Investigator: Hanna''' <br>
 <br>
@@ Line 2,503: / Line 2,381: @@
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Test digestion of pGA14_Präfix-lITR (Ligation)</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Test digestion of pGA14_Präfix-lITR (Ligation)</p>====
-Investigator: Hanna <br>
+'''Investigator: Hanna''' <br>
 <br>
@@ Line 2,510: / Line 2,388: @@
-<p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
+<p style="font-size:14px; font-weight: bold; color: blue;">Test digestion</p>
 *buffer used: 4; Restriction-enzymes used: Enzyme 1: EcoRI-HF ; Enzyme 2: PstI-HF
 *Plasmid: pGA14_Präfix_lITR 1 - 10 (all: ~ 400 ng/µL)
@@ Line 2,577: / Line 2,455: @@
 <p style="font-size:12px;  color: blue;">yees, thats great! Finally something worked with our ITRs. well done Hanna!! (Bea)</p>
 <p style="font-size:12px;  color: black;">the most astonishingly test digestion gel of our entire working time! :)(Adrian)</p>
-[[Image:Freiburg10 left itr test digest 1707.jpg|400px|]]
+[[Image:Freiburg10 left itr test digest 1707.jpg|thumb|center|600px|]]
 <p style="font-size:12px; font-weight: bold; color: fuchsia;">Next step: Fusion of suffix to left ITR</p>
 <br>
@@ Line 2,585: / Line 2,463: @@
 ====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Trafo of pGA14_Präfix_rITR</u></p>====
-Investigator: Hanna <br>
+'''Investigator: Hanna''' <br>
 <br>
 Transformation of BL21 bacteria with pGA14_Präfix_rITR which ligated over night was performed following standard protocol. Abberation: 3µL DNA was added to 50 µL cells.
@@ Line 2,594: / Line 2,472: @@
-===62.Labortag 18.07.2010:===
+===<p style="font-size:15px; background-color:#66bbff;">62.Labortag 18.07.2010</p>===
+'''Investigator: Adrian'''
+<br>
+<br>
 '''Calculation of ganciclovir cymeven concentration'''
-<br>Investigator Adrian:
 *Ganciclovir: m = 255,23 g/mol
@@ Line 2,610: / Line 2,488: @@
 <br>
 preparation of Aliquots:
 <br>
-'''Cellculture'''<br>
+====<p style="font-size:15px; background-color:#66bbff;">Cellculture</p>====
 The HEK-293 cells were split according to the standard protocol. The HT 1080 cells were split and sowed (3x10^5 cells each well).
@@ Line 2,624: / Line 2,501: @@
 |}
-Investigators: Chris, Patrick
-'''Test digestion of pAAV_RFC_mgmk_tk30: P54, P55, P56, P57'''<br>
+====<p style="font-size:15px; background-color:#66bbff;">Test digestion of pAAV_RFC_mgmk_tk30: P54, P55, P56, P57'''</p>====
+'''Investigators: Chris, Patrick'''<br />
 To check whether the mutual mgmk_tk30 insert is present in the plasmid we digested it with AgeI and EcoRI. If the insert is present there will an DNA fragmet with a size of about 1700 bp.
@@ Line 2,650: / Line 2,529: @@
 Gelrun (1% Agarose), 55 minutes, 115 mV: Results: See picture. Interpretation of the results: ? The "upper" DNA seems to be undigested vector underneath the probably digested vector with an estimated size of about 5600 bp. The mutual insert (mgmk_tk30) should be about 1700 bp. There are probably several DNA coil structures visible but not our mutual insert. To do : ligate again.
-[[Image:Gelrun20100718.jpg|400px|]]
+[[Image:Gelrun20100718.jpg|thumb|center|600px|]]
-Aferwards i noticed that i miscalculated the Mastermix. Investigators: Patrick, Chris
+Aferwards i noticed that i miscalculated the Mastermix.
 <br>
 <br>
-===63. Labortag 19.07.2010===
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>rITR</u></p>====
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Picking clones of pGA14_Präfix-rITR Trafo</p>====
+===<p style="font-size:17px; background-color:#00dd77;">63. Labortag 19.07.2010</p>===
+====<p style="font-size:15px; background-color:#66bbff;">rITR</p>====
+<p style="font-size:14px; font-weight: bold; color: fuchsia;">Picking clones of pGA14_Präfix-rITR Trafo</p>
 <br>
 Few bacteria also grew on control plates. Control means: Ligation of digested vector (pGA14_Cerulean) without insert (Präfix and right ITR).<br>
@@ Line 2,664: / Line 2,544: @@
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Mini-Preps of pGA14_Präfix-lITR cultures</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini-Preps of pGA14_Präfix-lITR cultures</p>====
-Investigator: Hanna, Jessy <br>
+'''Investigators: Hanna, Jessy''' <br>
 <br>
@@ Line 2,673: / Line 2,553: @@
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Test digestion of pGA14_Präfix-rITR (Ligation)</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Test digestion of pGA14_Präfix-rITR (Ligation)</p>====
-Investigator: Hanna, Jessy <br>
+'''Investigator: Hanna, Jessy''' <br>
 <br>
@@ Line 2,738: / Line 2,618: @@
 <p style="font-size:14px; font-weight: bold; color: fuchsia;">Wonderful news: All 6 test digestions delivered positive results: ~ 160 bp fragments and no 800 bp fragment were detectable. Means: right ITR + Präfix was inserted successfully into pGA14!!! :)</p>
 <br>
-[[Image:RightITR.jpg|350px|]]
+[[Image:RightITR.jpg|thumb|center|600px|]]
 <p style="font-size:12px; font-weight: bold; color: fuchsia;">Next step: Ordering new oligos: Präfix of lITR, suffix of right and left ITRs, continuation of fancy cloning protocol</p>
@@ Line 2,745: / Line 2,625: @@
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Sequencing</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Sequencing of ITRs</p>====
-Investigator: Hanna <br>
+'''Investigator: Hanna''' <br>
 <br>
 pGA14_Präfix_lITR and pGA14_Präfix_rITR were sent for sequencing to GATC:<br>
@@ Line 2,755: / Line 2,635: @@
 <br>
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Quantitative real time PCR</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Quantitative real time PCR</p>====
-Investigator: Hanna <br>
+'''Investigator: Hanna''' <br>
 <br>
 Template: DNA of HT1080 cells transducted with 1) 10 µL and 2) with 30 µL virus stock solution.<br>
@@ Line 2,777: / Line 2,657: @@
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Cloning strategy for gmk_tk added!!</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Cloning strategy for gmk_tk added!!</p>====
-Investigator: Bea<br>
+'''Investigator: Bea'''<br>
 [[Media:Freiburg10 BioBrick GMK TK30 07 07 2010 with new oligos.pdf]]
 <br>
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">pAAV_RC site directed mutagenesis: Digestion of the two mutagenesis reaction of PstI site: 310 and 4073</p>====
+====<p style="font-size:15px; background-color:#66bbff;">pAAV_RC site directed mutagenesis: Digestion of the two mutagenesis reaction of PstI site: 310 and 4073</p>====
+'''Investigator: Volker'''
 '''Digestion of pAAV_RC '''
 <li> experiment date: 19.07.2010
-<li> name of investigator:Volker
 <li> plasmid: name: pAAV_RC number: P58 / P59
 <li> buffer used: 4 ; Restriction-enzymes used: Enzyme  (no. Lab:66) XmnI
@@ Line 2,810: / Line 2,691: @@
 Incubate at 37°C
-[[Image:Freiburg10 pAAV RC site directed mutagenesis performed with PstI 310 and 4073 19 07 2010.jpg]]<br>
+[[Image:Freiburg10 pAAV RC site directed mutagenesis performed with PstI 310 and 4073 19 07 2010.jpg|thumb|center|400px]]<br>
 *Gelextraction was prepared according to the protocol<br>
 **weight of gel: 310: 150 mg; 4073: 150mg <br>
@@ Line 2,817: / Line 2,698: @@
 **Ratio: 310:4073 --> 2,52 µl:6,48µl<br>
 Ligation was frozen in -20°C<br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">pHelper plasmid for Midi-Prep prepared</p>====
-Investigator:  Stefan<br>
+====<p style="font-size:15px; background-color:#66bbff;">pHelper plasmid for Midi-Prep prepared</p>====
+'''Investigator:  Stefan'''<br>
 ml DYT media + 200µl Amp were inoculated with pHelper-plasmid glycerol stock and put on shaker in 37°C room.<br>
 For Midi-Prep:  Use Endotoxin-free Midi Prep not our Midi Prep!
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Trafo of IGEM 2009 linkers</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Trafo of IGEM 2009 linkers</p>====
 *We borrowed several linkers/tags from Gerrit and did a Trafo in XL1B cells:
 **small linker
@@ Line 2,837: / Line 2,721: @@
 <br>
-===64. Labortag 20.07.2010===
+===<p style="font-size:17px; background-color:#00dd77;">64. Labortag 20.07.2010</p>===
 <br>
-'''Quickchange site directed mutagenesis:'''
+====<p style="font-size:15px; background-color:#66bbff;">Quickchange site directed mutagenesis:</p>====
-<br>
+'''Investigators: Achim,Anissa'''
-Investigators: Achim,Anissa
 <br> 1) VP1ex P27.2<br> 2) VP2ex P28.2 <br> 3) VP3ex P29.2 <br>
 PCR reaction:
@@ Line 2,868: / Line 2,751: @@
 '''Picking Clones from Linker Trafo'''<br>
 * clones were picked at 22.00
-====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Endotoxin-free Midi Prep of pHelper</u></p>====
-Investigators: Chris, Stefan<br>
+====<p style="font-size:15px; background-color:#66bbff;">Endotoxin-free Midi Prep of pHelper</p>====
+'''Investigators: Chris, Stefan'''<br>
 Midi-Prep was done according to protocol.<br>
 Result of the Midi-prep: 503,2 ng/µl<br>
@@ Line 2,875: / Line 2,759: @@
 <br>
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Quantitative real time PCR</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Quantitative real time PCR</p>====
-Investigator: Hanna <br>
+'''Investigator: Hanna''' <br>
 <br>
 Because there was one positive non-template control (H2O) yesterday, we performed the qPCR one more time.<br>
@@ Line 2,903: / Line 2,787: @@
 <br>
 <br>
-====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Cloning of p51(pSB1C3_RFC25) for His-tag insert</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Cloning of p51(pSB1C3_RFC25) for His-tag insert</p>====
-Investigators: Anna, Stefan<br>
+'''Investigators: Anna, Stefan'''<br>
 <br>
@@ Line 2,937: / Line 2,821: @@
 <br>
-===65. Labortag 21.07.2010===
+===<p style="font-size:17px; background-color:#00dd77;">65. Labortag 21.07.2010</p>===
-<br>
+====<p style="font-size:15px; background-color:#66bbff;">Sequencing of ITRs</p>====
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Sequencing of ITRs</p>====
+'''Investigator: Hanna''' <br>
-Investigator: Hanna <br>
 <br>
 P62.1 (=left ITR + RFC23-Präfix in pGA14) and P63.1 (= right ITR-Präfix in pGA14) were sequenced:
 <br>
-[[Image:LITR-RFC23Präfix.jpg |600px|thumb|left|Sequencing results of '''pGA14_lITR-RFC23Präfix'''.]]
+[[Image:LITR-RFC23Präfix.jpg |600px|thumb|center|Sequencing results of '''pGA14_lITR-RFC23Präfix'''.]]
-[[Image:RITR-Präfix.jpg|600px|thumb|right|Sequencing results of '''pGA14_rITR-RFC10Präfix''').]]
+[[Image:RITR-Präfix.jpg|600px|thumb|center|Sequencing results of '''pGA14_rITR-RFC10Präfix''').]]
 <br>
 <br>
@@ Line 2,955: / Line 2,838: @@
 <br>
-====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Quantitative real time PCR</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Quantitative real time PCR</p>====
-Investigator: Hanna <br>
+'''Investigator: Hanna''' <br>
 <br>
 Because the non-template control and the not-transduced cell-DNA controls delivered positive PCR results for the CMV-promoter, a control qPCR was prepared: <br>
@@ Line 2,974: / Line 2,857: @@
 <br>
 <br>
-<p style="font-size:20px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Mini-Preps of linker</p>====
 *experiment date: 21.07.2010 ; time: 10:30Uhr
 *name of investigator: Anissa, Kerstin
@@ Line 2,994: / Line 2,877: @@
 '''Comments:''' Different Linker-fragments are very short (5-178bp) --> no Test-digestion; directly sequencing
-====<p style="font-size:17px; background-color:#66bbff;">'''Results of Trafo of cloning pAAV_RC SDM of PstI 310 and 4073'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">'''Results of Trafo of cloning pAAV_RC SDM of PstI 310 and 4073'''</p>====
 '''Investigator: Bea''' <br>
 ''Comments:'' Cloning together of the two site-directed mutagenesis performed with the pAAV_RC
@@ Line 3,002: / Line 2,885: @@
 <p style="font-size:14px; font-weight: bold; color: red;">To do: new cloning together of pAAV_RC PstI 310 and 4073 with TWO other enzymes.</p>
-====<p style="font-size:17px; background-color:#66bbff;">'''PCR with pUB_V5_mGMK_TK30'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">'''PCR with pUB_V5_mGMK_TK30'''</p>====
 '''Investigator: Adrian, Bea''' <br>
 ''Comments:'' Perform PCR with two primers
@@ Line 3,037: / Line 2,920: @@
 '''Comments:'''New Oligos (pmGMK_TK30_prefix_RFC25_for and pmGMK_TK30_suffix_RFC25_rev) with add-on tails (prefix and suffix), but TK30 still contains three iGEM restriction sites but will be ready for use in cell culture <br>
 '''Result of PCR product''' (theoretically)<br>
-[[Image:Freiburg10 PCR product mGMK tk30 RFC25.jpg|800px|thumb|left|]]
+[[Image:Freiburg10 PCR product mGMK tk30 RFC25.jpg|920px|thumb|left|]]
 <br>
 <br />
@@ Line 3,090: / Line 2,973: @@
 # load 7-8µL of PCR sample on an analytical gel and watch agarose gel for additional bands. If there are some more bands than expected load sample on preparative gel.If there aren´t any additional bands. proceed with digestion of PCR product in order to ligate it into vector.
 #load total PCR sample on preparative gel. Ask Sven or Tobi in which volume you should elute after cutting out the gel (Gel extraction), but you should elute sample at least in 30µL.
-[[Image:Freiburg10 General plan Overview PCR.png|200px|thumb|right|]]
+[[Image:Freiburg10 General plan Overview PCR.png|300px|thumb|center|]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
 <br>
 <br>
@@ Line 3,134: / Line 3,005: @@
 *Ligation and Trafo were performed following standard protocols.
-====<p style="font-size:17px; background-color:#66bbff;">'''Gelextraction, Ligation and Transformation for cloning of pSB1C3_His_RFC25 (continuation of cloning from 64th lab day)'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">'''Gelextraction, Ligation and Transformation for cloning of pSB1C3_His_RFC25 (continuation of cloning from 64th lab day)'''</p>====
-Investigator: Bea, Kerstin, Stefan <br>
+'''Investigator: Bea, Kerstin, Stefan''' <br>
 <b>Extraction</b>
@@ Line 3,170: / Line 3,041: @@
 and they were put in the 37°c room at 19:15
+=== <p style="font-size:17px; background-color:#00dd77;">66. Labortag 22.7.2010 </p>===
-=== 66. Labortag 22.7.2010 ===
-==== cell culture ====
+====<p style="font-size:15px; background-color:#66bbff;">cell culture</p>====
-HT 1080 cells were split according to the standart protocol. Investigator: Adrian
+'''Investigator: Adrian'''
+HT 1080 cells were split according to the standart protocol.
 ====<p style="font-size:15px; background-color:#66bbff;">'''Mini Prep and test digestion  pKEX_VP1-3 w/o PstI(4073)'''</p>====
-Investigators: Kerstin, Jessica<br>
+'''Investigators: Kerstin, Jessica<br>'''
 '''PstI should be deleted in VP1, VP2, VP3'''
@@ Line 3,217: / Line 3,088: @@
 Deletion was succesful, there are still 2 PstI restriction sites in P72-74
 <br>
-[[Image:Freiburg10 SDM of pKex VP1-3 und Origing pKex VP1-3.jpg|400px|thumb|left|]]
+[[Image:Freiburg10 SDM of pKex VP1-3 und Origing pKex VP1-3.jpg|600px|thumb|center|]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
 <br>
 <br>
-====<p style="font-size:15px; background-color:#66bbff;">'''Cloning together of pAAV_RC PstI 310 and 4073 with two enzymes'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Cloning together of pAAV_RC PstI 310 and 4073 with two enzymes</p>====
+'''Investigators: Chris, Patrick'''
 Clone P58 (pAAV_RC_SDM310.1) and P59 (pAAV_RC_SDM4073) will be digested with HindII and SpeI. The smaller fragment (about 1700 bp) of P58 and the larger fragment of P59 (about 5900 bp) will be ligated to receive a plasmid carrying both mutations.
@@ Line 3,268: / Line 3,121: @@
 Incubation: at 37°C, 70 minutes.
 <br>
-[[Image:2010-07-23 PS CW annotated.jpg|600px|thumb|left|]]
+[[Image:2010-07-23 PS CW annotated.jpg|600px|thumb|center|]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
 <br>
 <br>
@@ Line 3,313: / Line 3,141: @@
 Transformation was performed according to the standard protocol with E. coli BL21. The agar plates were put into the 37°C room at 23:00.
 <br>
-New Ampicillin was prepared and put into the -20°C freezer. Investigators: Chris, Patrick
+New Ampicillin was prepared and put into the -20°C freezer.
-====<p style="font-size:15px; background-color:#66bbff;">'''Sequencing of linker '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Sequencing of linker</p>====
 '''Investigator: Anissa'''
 <br />
@@ Line 3,337: / Line 3,165: @@
 <br /><br />
 middle linker:
-[[Image:Middle linlker.jpg|600px|thumb|left|]]
+[[Image:Middle linlker.jpg|600px|thumb|center]]
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
 <br />
 <br />
 GSAT linker:
-[[Image:GSAT linker.jpg|600px|thumb|left|]]
+[[Image:GSAT linker.jpg|600px|thumb|center]]
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
 <br />
 <br />
 long linker:
-[[Image:Long linker.jpg|600px|thumb|left|]]
+[[Image:Long linker.jpg|600px|thumb|center]]
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
 <br />
 <br />
 Split linker:
-[[Image:Split linker.jpg|600px|thumb|left|]]
+[[Image:Split linker.jpg|600px|thumb|center]]
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
 <br />
 <br />
 Strep tag:
-[[Image:Strep tag.jpg|600px|thumb|left|]]
+[[Image:Strep tag.jpg|600px|thumb|center]]
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
 <br />
 <br />
 Short linker:
-[[Image:Short linker.jpg|600px|thumb|left|]]
+[[Image:Short linker.jpg|600px|thumb|center]]
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
 <br />
 <br />
 SEG linker:
-[[Image:SEG linker.jpg|600px|thumb|left|]]
+[[Image:SEG linker.jpg|600px|thumb|center|]]
 <br />
 <br />
-<br />
+====<p style="font-size:15px; background-color:#66bbff;">'''Biobricks of hgH and ß-Globin'''</p>====
-<br />
+'''Investigators: Stefan, Anna''' <br>
-<br />
+<p style="font-size:12px; font-weight: bold; color: blue;">Could you upload some agarose gels eg the gels after the digestion and the PCR? Thanks a lot! (Bea)</p>
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-<br />
-====<p style="font-size:17px; background-color:#66bbff;">'''Biobricks of hgH and ß-Globin'''</p>====
-'''Investigators: Stefan, Anna''' <br> <p style="font-size:12px; font-weight: bold; color: blue;">Could you upload some agarose gels eg the gels after the digestion and the PCR? Thanks a lot! (Bea)</p>
 ''Comments:'' Perform PCR with two primers
@@ Line 3,594: / Line 3,279: @@
 <br /><br />
-<p style="font-size:17px; font-weight: bold; color: blue;">Gel running of digested vector and PCR products</p>
+<p style="font-size:14px; font-weight: bold; color: blue;">Gel running of digested vector and PCR products</p>
 * 1% Agarose gel
@@ Line 3,670: / Line 3,355: @@
 '''Note: after heatshock cells were put on the shaker without adding 750 µl DYT, it was recognized and added later after 25 min of shaking !
-====<p style="font-size:17px; background-color:#66bbff;">'''Picking clones of pSB1C3_His_RFC25 and pAAV_RFC25_GMK_TK30 for Mini-Prep'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones of pSB1C3_His_RFC25 and pAAV_RFC25_GMK_TK30 for Mini-Prep</p>====
 '''Investigators: Stefan''' <br>
@@ Line 3,679: / Line 3,364: @@
-=== 67. Labortag 23.7.2010 ===
+===<p style="font-size:17px; background-color:#00dd77;">67. Labortag 23.7.2010</p>===
-====<p style="font-size:17px; background-color:#66bbff;">'''Picking clones of pAAV_RC_1.1'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones of pAAV_RC_1.1</p>====
 '''Investigator: ChrisW, Patrick''' <br>
 The inoculated agar plates from 'Cloning together of pAAV_RC PstI 310 and 4073 with two enzymes' were checked for colonies. Three clones were picked and in each case inoculated 20 ml DYT + Amp at 10:20.
@@ Line 3,694: / Line 3,379: @@
 B 68: pAAV_RC_SDM_PstI_310_4073 (2) <br>
-====<p style="font-size:17px; background-color:#66bbff;">'''Results of Trafo Biobricks of hgH and ß-Globin'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Results of Trafo Biobricks of hgH and ß-Globin</p>====
 '''Investigator: Anissa, Bea'''<br>
 <p style="font-size:12px; color:#68bbff;">'''''Comments:''''' No clones of pSB1C3_hGH and pSB1C3_betaGlobin grown on trafo plate. Possible reason can be the forgotten DYT medium added to the cells after the heat-shock. Cells were incubated at 37°C for 40 minutes without medium and were added afterewards.</p>
@@ Line 3,716: / Line 3,401: @@
 '''Attention: There was not enough cut vector. In both Ligations were only 2,2 µl of vector added. So incubation lasted 15 minutes and for transformation 4 µl were used.  '''
-====<p style="font-size:17px; background-color:#66bbff;">'''Mini-Prep and Test digestion of pAAV_RFC25_mGMK_TK30 '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini-Prep and Test digestion of pAAV_RFC25_mGMK_TK30 </p>====
 '''Investigator: Adrian, Bea''' <br>
 <p style="font-size:13px; color:#68bbff;">'''''Comments:''''' Mini-Prep, test digestion and sequencing is carried out in order to verify insertion of  the PCR product mGMK_TK30 with RFC25 add-on tails into pAAV_RFC25(overhangs). Aim is to use the construct in order to conduct experiments with the gmk_tk30 fusionenzyme. </p><br>
@@ Line 3,753: / Line 3,438: @@
 <br>
 <p style="font-size:13px; color:#11bb88;">'''Results of samples loaded 1% agarose gel and ran 50 minutes at 110 V:''' </p>
-[[Image:Freiburg10 Test digestion of pAAV RFC25 mGMK TK30 cut with XbaI and AgeI 23 07 2010001.png|400px|thumb|left|]]
+[[Image:Freiburg10 Test digestion of pAAV RFC25 mGMK TK30 cut with XbaI and AgeI 23 07 2010001.png|400px|thumb|center|]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
 <br>
 <br>
@@ Line 3,785: / Line 3,448: @@
 *AF_P83 (clone 3)
-====<p style="font-size:17px; background-color:#66bbff;">'''Mini-Prep of pSB1C3_His6'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini-Prep of pSB1C3_His6</p>====
 '''Investigator: Adrian'''<br>
@@ Line 3,794: / Line 3,457: @@
+=== <p style="font-size:17px; background-color:#00dd77;">68. Labortag 24.7.2010</p> ===
+====<p style="font-size:15px; background-color:#66bbff;">'''Cell culture: Seeding of HEK293 for Transfektion with P81, P82 and P83'''</p>====
-=== 68. Labortag 24.7.2010 ===
+'''Investigator: Adrian'''
-====<p style="font-size:17px; background-color:#66bbff;">'''Cell culture: Seeding of HEK293 for Transfektion with P81, P82 and P83'''</p>====
-Investigator: Adrian
 *unfortunately the T75 flask with HEK-cells was overpopulated => to much cells =>yellow medium and differentiation of the HEK-cells => thrown away
 * I had to thaw cells, (P4) so there'll be no transfection at Monday :(
-====<p style="font-size:17px; background-color:#66bbff;">'''Cell culture: Transduction of HT1080 with AAVs'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Cell culture: Transduction of HT1080 with AAVs</p>====
-Investigator: Adrian
+'''Investigator: Adrian'''
@@ Line 3,833: / Line 3,494: @@
 |}
-====<p style="font-size:17px; background-color:#66bbff;">'''Discussion round nr. 4'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Discussion round nr. 4</p>====
-Investigators: Adrian and his evil twins
+'''Investigators: Adrian and his evil twins'''
 <br>
 * adrian created a poster
-====<p style="font-size:17px; background-color:#66bbff;">'''Stocktaking of superior goods'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Stocktaking of superior goods</p>====
-Investigator: Adrian
+'''Investigator: Adrian'''
 <br>
 superior goods:
@@ Line 3,849: / Line 3,510: @@
 * LB-agar
-=== 69. Labortag 25.7.2010 ===
+===<p style="font-size:17px; background-color:#00dd77;">69. Labortag 25.7.2010</p>===
-====<p style="font-size:17px; background-color:#66bbff;">'''Clone picking from pSB1C3_hgH and pSB1C3_betaglobin'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Clone picking from pSB1C3_hgH and pSB1C3_betaglobin</p>====
 '''Investigator: Bea'''<br>
 <p style="font-size:13px; color:#11bb88;">'''Comments: Clones were very small and not many clones could be detected. Possible reasons: <br>
@@ Line 3,861: / Line 3,522: @@
 They were inoculated in 10mL DYT medium containing 10µL chloramphenicol and put into 37°C room for incubating. The reason for picking only two clones was that not many more clones could be detected easily.
-=== 70. Labortag 26.7.2010 ===
+===<p style="font-size:17px; background-color:#00dd77;">70. Labortag 26.7.2010</p>===
-====<p style="font-size:15px; background-color:#66bbff;">'''Mini Prep and test digestion  pSB1C3_hgh and pSB1C3_beta-globin '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini Prep and test digestion  pSB1C3_hgh and pSB1C3_beta-globin</p>====
 '''Investigators: Anissa, Kerstin'''<br>
@@ Line 3,871: / Line 3,532: @@
 ** pSB1C3_hgh clone2: 209,4 ng/µl   p90
 ** pSB1C3_beta-globin clone1: 217,5 ng/µl   p91 <br>
-<br> Incubation time: 1,5h Incubation temperature:37°C
+<br>
+Incubation time: 1,5h Incubation temperature:37°C
 Test digestion with Xba and PstI to check if hgh and beta-globin were cloned succesfully into the pSB1C3, respectively.
-[[Image:Test digestion of pSB1C3 hgh and pSB1C3 beta-globin cut with XbaI and PstI 26 07 2010002.jpg |300px|thumb|left|]]
+[[Image:Test digestion of pSB1C3 hgh and pSB1C3 beta-globin cut with XbaI and PstI 26 07 2010002.jpg |300px|thumb|center]]
 <br>
@@ Line 3,886: / Line 3,548: @@
 | Buffer 4 (10x)||  align="right" | 1,5||  align="right" | 1,5||  align="right" | 1,5
 |-
 |H2O||  align="right" | 6,7||  align="right" | 6,7||  6,9
 |-
 |'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | '''15'''||  align="right" | '''15'''||  align="right" | '''15'''
 |}
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-====<p style="font-size:15px; background-color:#66bbff;">'''Test digestion  P87: pAAV_RC_PstI-301-4073 clone 1 and P88: pAAV_RC_PstI-301-4073 clone 2 '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Test digestion  P87: pAAV_RC_PstI-301-4073 clone 1 and P88: pAAV_RC_PstI-301-4073 clone 2</p>====
-'''Investigators: Chris W.'''<br>
+'''Investigator: Chris W.'''<br>
 *Plasmids
@@ Line 3,937: / Line 3,580: @@
 |'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | '''20'''||  align="right" | '''20'''||  align="right" | '''20'''
 |}
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-====<p style="font-size:17px; background-color:#66bbff;">'''Oligos for hTERT promoter'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Oligos for hTERT promoter</p>====
 '''Investigator: Bea'''<br>
 <br>
 Oligos were ordered to modify hTERt promoter in order to obtain hTERT in the iGEM RFC10 standard.
-[[Image:Freiburg10 Primers for hTERT promoter 26 07 2010.jpg|1000px|thumb|left|Ordered oligos at Sigma-Aldrich for amplifying hTERT promoter.]]
+[[Image:Freiburg10 Primers for hTERT promoter 26 07 2010.jpg|920px|thumb|center|Ordered oligos at Sigma-Aldrich for amplifying hTERT promoter.]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
 <br>
 <br>
-====<p style="font-size:15px; background-color:#66bbff;">'''Retrafo with pTVvector containing the CMV promoter '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Retrafo with pTVvector containing the CMV promoter</p>====
 '''Investigator: Bea'''<br>
 <p style="font-size:13px; color:#11bb88;">'''Comments''': In order to obtain the CMV promoter in the correct RFC10 standard, oligos werde designed and ordered. For using the plasmid obtained from the iGEM team 2008, a retrafo has to be performed.  </p>
@@ Line 4,017: / Line 3,608: @@
 <br>
-====<p style="font-size:17px; background-color:#fuchsia;">'''Continuation: ITRs'''</p>====
+====<p style="font-size:17px; background-color:#66bbff;">Continuation: ITRs</p>====
 '''Investigator: Hanna'''<br>
 <br>
@@ Line 4,237: / Line 3,828: @@
 Gel picture of left ITR fragment and Präfix-rITR fragment: <br>
 <br>
-[[Image:26.07.ITRs.JPG|400px]] <br>
+[[Image:26.07.ITRs.JPG|thumb|center|600px]] <br>
 <br>
 '''Comment:''' The left ITR fragment was, as expected, nearly not detectable. Nevertheless it was cut out of the gel, because the same probleme occured during the first fancy-performance, which turned out to be successful!
@@ Line 4,301: / Line 3,892: @@
 <br />
 <br>
-[[Image:26.07.pGA14 E+N.JPG]]
+[[Image:26.07.pGA14 E+N.JPG|thumb|center|600px]]
 <p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
 <br />
@@ Line 4,354: / Line 3,945: @@
 <br>
 <br>
-====<p style="font-size:17px; background-color:#66bbff;">'''Biobrick of GMK'''</p>====
+====<p style="font-size:17px; background-color:#66bbff;">Biobrick of GMK</p>====
 '''Investigators: Stefan''' <br>
@@ Line 4,360: / Line 3,952: @@
 '''result:''' Transformation worked out, clones can be picked. <br>
 expected construct:<br>
-[[Image:Freiburg10 pAAV RFC25 gmk biobrick construction.png|400px]]<br>
+[[Image:Freiburg10 pAAV RFC25 gmk biobrick construction.png|thumb|center|600px]]<br>
 Digestion with XbaI and AgeI and ligate into vector which was digested with XbaI and AgeI as well.<br>
@@ Line 4,439: / Line 4,031: @@
 <br />
-[[Image:Freiburg10 pAAV RFC25 digestion and PCR of gmk.jpg|400px]]
+[[Image:Freiburg10 pAAV RFC25 digestion and PCR of gmk.jpg|thumb|center|600px]]
@@ Line 4,489: / Line 4,081: @@
 c(gmk) = 1,44 µL<br>
-=== 71. Labortag 27.7.2010 ===
+===<p style="font-size:17px; background-color:#00dd77;">71. Labortag 27.7.2010 </p>===
-====<p style="font-size:15px; background-color:#66bbff;">'''Cloning of linkers in pSB1C3_RFC25_CFP1.1 '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Cloning of linkers in pSB1C3_RFC25_CFP1.1 </p>====
-Investigator: Jessica<br>
+'''Investigator: Jessica'''<br>
 '''Linkers longlinker, SEG and GSAT should be cloned into the RFC25-standard'''<br>
 * P66: GSAT_linker_pMA 242,7 ng/µl
@@ Line 4,560: / Line 4,152: @@
 * 4µl DNA was added to 50µl XL1b
-====<p style="font-size:15px; background-color:#66bbff;">'''Result sequencing of pAAV_RFC25_mGMK_TK30'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Result sequencing of pAAV_RFC25_mGMK_TK30</p>====
 '''Investigator: Bea'''<br>
-<p style="font-size:13px; color:#66bbff;">'''Comments:''' Results of the PCR and cloning experiment from lab day: 23.07.2010 (Mini-Prep). The sucessful insertion of mGMK_ZK 30 into the vector pAAV_RFC25 can be confirmed and is ready for cell culture.</p>
+<p style="font-size:13px; color:#66bbff;">'''Comments:''' Results of the PCR and cloning experiment from lab day: 23.07.2010 (Mini-Prep). The sucessful insertion of mGMK_TK 30 into the vector pAAV_RFC25 can be confirmed and is ready for cell culture.</p>
 <p style="font-size:14px;>Results sequencing of ''plasmid '''P81''''' (pAAV_RFC25_mGMK_TK30 clone 1)<br></p>
 <br>
-[[Image:Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P81.JPG|1000px]]
+[[Image:Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P81.JPG|thumb|center|920px]]
-<br>
-<br>
 <br>
 <br>
 <p style="font-size:14px;>Results sequencing of ''plasmid '''P82''''' (pAAV_RFC25_mGMK_TK30 clone 2)<br></p>
-[[Image:Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P82.jpg]]
+[[Image:Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P82.jpg|thumb|center|800px]]
-<br>
 <br>
 <br>
@@ Line 4,578: / Line 4,167: @@
 <p style="font-size:14px;>Results sequencing of ''plasmid '''P83''''' (pAAV_RFC25_mGMK_TK30 clone 3)<br></p>
 <br>
-[[Image:Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P83.JPG]]
+[[Image:Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P83.JPG|thumb|center|800px]]
-====<p style="font-size:15px; background-color:#66bbff;">'''Quickchange @ Pst in RepX 68 and RepX 78 '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Quickchange @ Pst in RepX 68 and RepX 78</p>====
-Investigator: Kira
+'''Investigator: Kira'''
 '''PCR program''': PstI
@@ Line 4,739: / Line 4,328: @@
 ====<p style="font-size:15px; background-color:#66bbff;">'''Cell culture'''</p>====
-Investigator: Adrian
+'''Investigator: Adrian'''
 <br>
 * 3 x 6er dishes for Transduction were seeded and passaged(P14)
-====<p style="font-size:15px; background-color:#fuchsia;">'''ITRs: Trafo of overnight-ligation approaches'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">'''ITRs: Trafo of overnight-ligation approaches'''</p>====
 '''Investigator: Hanna'''<br>
 <p style="font-size:13px; color:#Fuchsia;">'''Comments:''' Cloning approach was continued: RFC10-Präfix_rightITR was ligated to RFC10-Suffix and pGA14 and leftITR was ligated to RFC10-Präfix and pGA14 over night. Trafo of these samples was performed in order to pick clones tomorrow.   </p>
@@ Line 4,751: / Line 4,340: @@
 <br>
-====<p style="font-size:15px; background-color:#fuchsia;">'''PCR: beta-Globin'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">'''PCR: beta-Globin'''</p>====
 '''Investigator: Hanna'''<br>
 Because sequencing delivered, that cloning of the beta-globin intron into pSB1C3 didn't work (Cerulean was still in the vector), the PCR was performed one more time: <br>
@@ Line 4,857: / Line 4,446: @@
 *Put into 37°C room on shaker.
-=== 72. Labortag 28.7.2010 ===
+===<p style="font-size:17px; background-color:#00dd77;">72. Labortag 28.7.2010 </p>===
 ====<p style="font-size:15px; background-color:#66bbff;">'''Results Trafo pAAV_RC_1.1_BamHI and pAAV_RC_1.1_SalI'''</p>====
 '''Investigator: Bea'''<br>
@@ Line 4,876: / Line 4,465: @@
 <br>
 <br>
-[[Image:Freiburg10 PCR of hGH and Bet a globin repeat agaorse gel 28 07 2010008.jpg|400px]]
+[[Image:Freiburg10 PCR of hGH and Bet a globin repeat agaorse gel 28 07 2010008.jpg|thumb|center|600px]]
-<br>
 <br>
 <br>
@@ Line 4,938: / Line 4,526: @@
 <br>
 <br>
-[[Image:Freiburg10 pSB1C3 CFP digestion 28 07 2010009.jpg|400px]]
+[[Image:Freiburg10 pSB1C3 CFP digestion 28 07 2010009.jpg|thumb|center|600px]]
 *Perform gel extraction and measure DNA with NanoDrop
 **c(psb1C3) = 29,52 ng/µL
@@ Line 4,945: / Line 4,533: @@
 Calculated ratio of pSB1C3 (vector) and hgh(insert) or betaglobin (insert)
 <br>
-[[Image:Freiburg10 Ligation ration of pSB1C3 hGH and betaglobin 28 07 2010.jpg]]
+[[Image:Freiburg10 Ligation ration of pSB1C3 hGH and betaglobin 28 07 2010.jpg|thumb|center|600px]]
 <br>
 <br>
@@ Line 4,953: / Line 4,541: @@
 were transformed with XL1B and incubated on agar-plates containing chloramphenicol over night at 37°C.
-====<p style="font-size:15px; background-color:#hotpink;">'''Results of ITR Trafo'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Results of ITR Trafo</p>====
 '''Investigator: Hanna''' <br>
@@ Line 4,978: / Line 4,566: @@
 ====<p style="font-size:15px; background-color:#66bbff;">'''Trafo evaluation Rep 68&78 Pst'''</p>====
-Investigator: Kira
+'''Investigator: Kira'''
 Both plates Rep 68 & Rep 78 contain lots of colonies. Approx. 4 colonies from each plate will be picked and inoculated for Mini prep tomorrow.
 <br>
 ====<p style="font-size:15px; background-color:#66bbff;">'''Cellculture'''</p>====
+'''Investigator: Jessica'''<br />
 HEK were split according to the standard protocol in 5 flasks<br>
-Investigator: Jessica
-====<p style="font-size:17px; background-color:#66bbff;">'''Mini-Prep and Test digestion of pAAV_RFC25_mgmk and pTV_CMV_7 and pTV_CMV_8 '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini-Prep and Test digestion of pAAV_RFC25_mgmk and pTV_CMV_7 and pTV_CMV_8</p>====
 '''Investigator: Stefan''' <br>
 <p style="font-size:13px; color:#68bbff;">'''''Comments:'''''<br>
@@ Line 5,050: / Line 4,639: @@
 <br>
 <p style="font-size:13px; color:#11bb88;">'''Results of samples loaded 1% agarose gel and ran ~50 minutes at 115 V:''' </p>
-[[Image:Freiburg10 pAAV RFC25 mgmk and pTV CMV 7 and pTV CMV 8 small.jpg|400px|thumb|left|]]
+[[Image:Freiburg10 pAAV RFC25 mgmk and pTV CMV 7 and pTV CMV 8 small.jpg|400px|thumb|center|]]
 <p style="font-size:13px; color:#11bb56;">'''Sequencing''' </p>
@@ Line 5,169: / Line 4,715: @@
 * Transformation was prepared according to the standard protocol
-====<p style="font-size:15px; background-color:#hotpink;">'''Affibody'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">'''Affibody'''</p>====
 '''Investigator: Hanna''' <br>
 In order to target the EGF-receptor (EGFR/ErbB-1/Her1) an affibody molecule can be fused to the N-terminus of e.g. VP2, which is expressed in trans. The ZEGFR:1907 was chosen for this approach. Because just the amino acid sequence is published by Friedman et al., 2008, the sequence was translated with Mr. Gene's help :) and optimized for mammalian expression. <br>
@@ Line 5,175: / Line 4,721: @@
 '''Strategy:'''
 <br>
-[[Image:Freiburg10AffiStrategy.jpg]]
+[[Image:Freiburg10AffiStrategy.jpg|thumb|center|800px]]
 <br>
 <br>
 ====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones from Trafo pSB1C3_RFC25_longlinker, pSB1C3_RFC25_GSAT, pSB1C3_RFC25_SEG '''</p>====
 '''Investigator: Jessica'''
@@ Line 5,204: / Line 4,751: @@
 ====<p style="font-size:15px; background-color:#66bbff;">'''Trafo of PAAV_RC_1.1 SDM of BamHI and SalI'''</p>====
 '''Investigator: Bea'''<br>
-<p style="font-size:13px; color:#25bbAA;">'''Comment:''' Trafo did not work (see above) therefore th etRafo have been performed again<br>
+<p style="font-size:13px; color:#25bbAA;">'''Comment:''' Trafo did not work (see above) therefore th etRafo have been performed again</p>
 ====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones from the 2. Trafo of left and right ITR (Hanna)'''</p>====
@@ Line 5,214: / Line 4,761: @@
 <p style="font-size:13px; color:#25bbAA;">'''Comment @Hanna:''' also on control plate are clones grown... not on the quartered plate. back in the 37°C room</p>
-=== 73. Labortag 29.7.2010 ===
+===<p style="font-size:17px; background-color:#00dd77;">73. Labortag 29.7.2010</p> ===
 ====<p style="font-size:15px; background-color:#66bbff;">'''Mini-Prep and Test digestion of Rep 68 and Rep 78 '''</p>====
@@ Line 5,276: / Line 4,823: @@
 |}
 <br />
-[[Image:Freiburg10 Rep test digestion PstI(310).png|400px]]<br />
+[[Image:Freiburg10 Rep test digestion PstI(310).png|thumb|center|600px]]<br />
 ====<p style="font-size:15px; background-color:#66bbff;">'''Results sequencing of pTV_CM clone 7 and 8 (received from iGEM team 2008)'''</p>====
@@ Line 5,286: / Line 4,833: @@
 <br>
 <p style="font-size:16px;">Results prefix RFC10:</p>
-[[Image:Freiburg10 Sequencing results of pTV CMV prefix 29 07 2010.jpg|400px]]
+[[Image:Freiburg10 Sequencing results of pTV CMV prefix 29 07 2010.jpg|thumb|center|600px]]
 <br>
 <p style="font-size:16px;">Results pTV_CMV_7:</p>
-[[Image:Freiburg10 Sequencing results of pTV VMC 7 29 07 2010.jpg|600px]]
+[[Image:Freiburg10 Sequencing results of pTV VMC 7 29 07 2010.jpg|thumb|center|600px]]
 <br>
 <br>
 <br>
 <p style="font-size:16px;">Results pTV_CMV_8:</p>
-[[Image:Freiburg10 Sequencing results of pTV VMC 8 29 07 2010.jpg|620px]]
+[[Image:Freiburg10 Sequencing results of pTV VMC 8 29 07 2010.jpg|thumb|center|600px]]
 ====<p style="font-size:15px; background-color:#66bbff;">'''Sequencing results of pAAV_RFC25_mGMK'''</p>====
@@ Line 5,302: / Line 4,848: @@
 <br>
 <br>
-[[Image:Freiburg10 Sequencing results of pAAV RFC25 mGMK 29 07 2010.jpg|600px]]
+[[Image:Freiburg10 Sequencing results of pAAV RFC25 mGMK 29 07 2010.jpg|600px|thumb|center]]
 <br>
 <br>
@@ Line 5,315: / Line 4,861: @@
 <br>
 <br>
-====<p style="font-size:15px; background-color:#fuchsia;">'''Mini-Prep and Test digestion of ITR constructs'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini-Prep and Test digestion of ITR constructs</p>====
 '''Investigator: Hanna''' <br>
 <br>
@@ Line 5,457: / Line 5,003: @@
 <br>
-[[Image:Test digestion ITRs 290710002.jpg|700px]]<br>
+[[Image:Test digestion ITRs 290710002.jpg|700px|thumb|center]]<br>
 <br>
+<br />
 No bands can be detected at the expected sizes. The fragment size seems to be inbetween the expectation of either 150 and 750 bp. Further on there is also an additional band visible. Because of that it's not possible to say, whether cloning worked. Therefore the three clones marked in the picture were sent to GATC for sequencing: <br>
 * pGA14_Prefix_lITR clone 1: 6.5 µL plasmid + 23.5 µL H2O = "Hanna 1"
@@ Line 5,464: / Line 5,011: @@
 * pGA14_Prefix_PreSuffix_rITR clone 1: 5.2 µL  plasmid + 24.8 µL H2O = "Hanna 3"
-====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones of pGL3_hTERT'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones of pGL3_hTERT</p>====
 '''Investigator: Bea''' <br>
 <p style="font-size:13px; color:#25bbAA;">'''Comments:''' Clones will be picked from trafo plate in order to obatin single colonies in order to perform Mini-prep tomorrow.</p>
@@ Line 5,471: / Line 5,018: @@
 *Inoculating of 10 mL DYT medium containing 10µL ampicillin
-====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones of pAAV_RC_1.1 SDM of BamHI and SalI'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones of pAAV_RC_1.1 SDM of BamHI and SalI</p>====
 '''Investigator: Bea''' <br>
 <p style="font-size:13px; color:#25bbAA;">'''Comments:''' All trafo plates looked good, enough clones grew, aside from trafo plate '''XL1-B {pAAV_RC_1.1_SalI}''': long PCR, where no clones grew on plate. Clones will be picked from each trafo plate in order to obatin single colonies in order to perform Mini-Prep tomorrow. </p>
@@ Line 5,481: / Line 5,028: @@
 *Inoculating of 10 mL DYT medium containing 10µL ampicillin
-====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones of pSB1C3_hGH and pSB1C3_betaglobin'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones of pSB1C3_hGH and pSB1C3_betaglobin</p>====
 '''Investigator: Bea''' <br>
 <p style="font-size:13px; color:#25bbAA;">'''Comments:''' Clones will be picked from trafo plate in order to obatin single colonies in order to perform Mini-Prep tomorrow.</p>
@@ Line 5,490: / Line 5,037: @@
 *Inoculating of 10 mL DYT medium containing 10µL chloramphenicol
-====<p style="font-size:15px; background-color:#66bbff;">'''PCR with pTV_CMV with designed oligos for amplifying CMV in RFC10 standard'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">PCR with pTV_CMV with designed oligos for amplifying CMV in RFC10 standard</p>====
 '''Investigator: Bea''' <br>
 <p style="font-size:13px; color:#25bbAA;">'''Comments:''' Retrafo of th epTV_CMv constructs has been performed and seqeuncing revealed that the plasmid contains the CMV promoter. Therefore, PCR in order to add prefix and suffix in RFC10 standard can be performed. </p>
@@ Line 5,542: / Line 5,089: @@
 <br />
-====<p style="font-size:15px; background-color:#66bbff;">'''Mini-Prep and Test digestion of pSB1C3_RFC25_longlinker, pSB1C3_RFC25_SEG and pSB1C3_RFC25_GSAT  '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini-Prep and Test digestion of pSB1C3_RFC25_longlinker, pSB1C3_RFC25_SEG and pSB1C3_RFC25_GSAT</p>====
 '''Investigator: Jessica''' <br>
 '''Nanodrop'''
@@ Line 5,571: / Line 5,118: @@
 agarose gel: 2%, digestion: 45 minutes, 37°C
 <br>
-[[Image:Freiburg10 test digestion of linkers.jpg|400px|thumb|left|]]
+[[Image:Freiburg10 test digestion of linkers.jpg|600px|thumb|center|]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
 <br>
 <br>
 '''P105, P107 and P109 are sent for sequenzing with Reverse Primer (VR2)'''
 <p style="font-size:13px; color:#68bbff;">'''''Comments:'''''this is no satisfying result. we can't imagine what this bands stand for. maybe the CFP is still in the pSB1C3 and the digestion of the pSB1C3_RFC25_CFP didn't work. P105, P107 and P109 are sent for sequenzing to look for the CFP respectively the linkers  </p><br>
-====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones of pSB1C3_CFP w/o SspI and PvuII'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones of pSB1C3_CFP w/o SspI and PvuII</p>====
 '''Investigator: Jessica''' <br>
 *Bacterial strain used: XL1-B
@@ Line 5,601: / Line 5,131: @@
 '''Hanna will do the Mini Prep tomorrow'''<br>
-====<p style="font-size:15px; background-color:#66bbff;">'''Inoculation of pSB1C3_RFC25_CFP'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Inoculation of pSB1C3_RFC25_CFP</p>====
 '''Investigator: Jessica '''
 * 200ml DYT was prepared with 200µl chloramphenicol and the glycerol stock no. B39
 * stored in the 37°C room over night for Midi Prep tomorrow
-=== 74. Labortag 30.7.2010 ===
+===<p style="font-size:17px; background-color:#00dd77;">74. Labortag 30.7.2010</p>===
-====<p style="font-size:15px; background-color:#66bbff;"><b>Continuation of PCR with pTV_CMV and digestion of pSB1C3</b></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Continuation of PCR with pTV_CMV and digestion of pSB1C3</p>====
 <p><b>Investigator: Bea</b> <br></p>
 <p style="font-size:13px; color:#68bbff;"><b>Comments:</b> Retrafo of the pTV_CMv constructs has been performed and sequencing revealed that the plasmid contains the CMV promoter. Therefore, PCR was be performed overnight. After PCR the PCR product was loaded on a 1% preparative agarose gel. While PCR was separated by the agarose gel, digestion of pSB1C3_CFP was performed.</p>
@@ Line 5,622: / Line 5,152: @@
 <br>
-[[Image:Freiburg10 PCR with pTV CMV 30 07 2010.jpg|400px]]
+[[Image:Freiburg10 PCR with pTV CMV 30 07 2010.jpg|thumb|center|400px]]
 <br>
 <br>
@@ Line 5,722: / Line 5,252: @@
 </ul>
 <br>
-[[Image:Freiburg10 Digestion of pSB1C3 CFP with XbaI and PstI 30 07 2010.jpg|400px]]
+[[Image:Freiburg10 Digestion of pSB1C3 CFP with XbaI and PstI 30 07 2010.jpg|thumb|center|400px]]
 <br/ >
 <br/ >
@@ Line 5,794: / Line 5,324: @@
 TAE buffer was changed before start, the samples have been diluted to 1/3 but the bands are still very distinct. However, it is possible to analyse the gel. Rep 68 contains no PstI restriction sites anymore, while Rep 78 shows one band, which might be due to the additional PstI restiction site.
-[[Image:Freiburg10 test digestion PstI.png|400px|]]
+[[Image:Freiburg10 test digestion PstI.png|thumb|center|600px|]]
 clone1_Rep68 and clone1_ Rep78 were sent for sequencing
-====<p style="font-size:15px; background-color:#FF00FF;">'''Continuation: left ITR'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">'''Continuation: left ITR'''</p>====
 '''Investigator: Hanna''' <br>
 <br>
@@ Line 5,905: / Line 5,435: @@
 <br />
-====<p style="font-size:15px; background-color:#FF00FF;">'''Continuation: right ITR'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Continuation: right ITR</p>====
 '''Investigator: Hanna''' <br>
 <br>
@@ Line 5,911: / Line 5,441: @@
 <br>
-[[Image:Freiburg10 pGA14 rITR-Prefix PreSuffix.jpg|900px]] <br>
+[[Image:Freiburg10 pGA14 rITR-Prefix PreSuffix.jpg|thumb|center|900px]] <br>
 <br>
@@ Line 6,001: / Line 5,531: @@
 <br>
-====<p style="font-size:15px; background-color:#FF00FF;">'''ITR gel pictures'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">ITR gel pictures</p>====
-'''Hanna'''
+'''Investigator: Hanna'''
 <br>
-[[Image:PGA14 30072010006.jpg|300px]]
+[[Image:PGA14 30072010006.jpg|thumb|center|600px]]
 <br>
 Digestion worked. The marked bands were cut out. <br>
 <br>
-[[Image:ITRs 30072010007.jpg|300px]]
+[[Image:ITRs 30072010007.jpg|thumb|center|600px]]
 <br>
@@ Line 6,016: / Line 5,546: @@
 <br>
-====<p style="font-size:15px; background-color:#FF00FF;">'''ZEGFR:1907'''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">'''ZEGFR:1907'''</p>====
-Sven, Hanna <br>
+'''Investigator: Hanna (guided by Sven)'''<br>
 <br>
 The Affibody-BioBrick (RFC25) was ordered at Geneart. The sequence does not contain any iGEM restriction sites. We'll receive the DNA in ~ 8 work days. <br>
@@ Line 6,025: / Line 5,555: @@
 <br>
-====<p style="font-size:17px; background-color:#66bbff;">'''Mini-Prep and Test digestion of pSB1C3_SDM_SspI, pSB1C3_SDM_PvuII, pSB1C3_beta-globin, pSB1C3_hgH, pAAV_RC_1.1_BamHI long PCR, pAAV_RC_1.1_BamHI short PCR,pGL3_hTERT and pAAV_RC_1.1_SalI (short PCR), pAAV_RC_1.1_BamHI long PCR, pAAV_RC_1.1_BamHI short PCR, '''</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mini-Prep and Test digestion of pSB1C3_SDM_SspI, pSB1C3_SDM_PvuII, pSB1C3_beta-globin, pSB1C3_hgH, pAAV_RC_1.1_BamHI long PCR, pAAV_RC_1.1_BamHI short PCR,pGL3_hTERT and pAAV_RC_1.1_SalI (short PCR), pAAV_RC_1.1_BamHI long PCR, pAAV_RC_1.1_BamHI short PCR</p>====
 '''Investigator: Anissa, Stefan''' <br>
 <p style="font-size:13px; color:#68bbff;"><b>Comments: There are some (SspI, PvuII, BamHI, SalI) restriction sites in our standard vector which are also present in the viral loops. Therefore, the sites in the vector have to be removed.
@@ Line 6,148: / Line 5,678: @@
 <br>
 <p style="font-size:13px; color:#11bb88;">'''Results of samples loaded 1% agarose gel and ran ~50 minutes at 115 V:''' </p>
-[[Image:Freiburg10 Test digestion of P125-144.png|400px]]
+[[Image:Freiburg10 Test digestion of P125-144.png|400px|thumb|center]]
@@ Line 6,168: / Line 5,698: @@
 <br>
-=== 75. Labortag 31.7.2010 ===
+===<p style="font-size:17px; background-color:#00dd77;">75. Labortag 31.7.2010</p> ===
-====<p style="font-size:15px; background-color:#FF00FF;"><b>Trafo of ITR-over-night ligations</b></p>====
+====<p style="font-size:15px; background-color:#66bbff;"><b>Trafo of ITR-over-night ligations</b></p>====
 <p><b>Investigator: Hanna</b> <br></p>
 The last step of the ITR fancy method was done ytesterday. Means: If cloning worked, both ITRs should be in the RFC10 standard. Ligation was done over night and the referring trafo will be done today. <br>
@@ Line 6,176: / Line 5,706: @@
 Abberations:<br>
 µL sample was added to BL21 cells. Incubation time on ice was just 15 minutes. Incubation at 37°C for 45 minutes.
+<center>[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August '''=> Go to Labjournal August part 1 (labday 76 - 92)''']</center><br>
 <html>
 </div>
 </html>

Team:Freiburg Bioware/NoteBook/Labjournal/July

From 2010.igem.org

Latest revision as of 21:36, 27 October 2010

Contents

Juli

46.Labortag 01.07.2010

qPCR

Thawing HT1080 cells

Investigation of the Kleinschmidt sequencing

47.Labortag 02.07.2010

Fluoroscence Pictures of Transduction 3

Seeding and Splitting HEK

New ologos/primers arrived

Annotation of the 453 insertion site

Searching new restriction sites in the 585/588 WT loop

Searching new restriction sites in the 585/588 KO loop

Searching new restriction sites in the 453 loop

48.Labortag 03.07.2010

Planing the gene synthesis to replace the three restriction sites in the rep ORF

Modification of the Cap genes

Cellculture

49.Labortag 04.07.2010:

Transfection nr.3

50.Labortag 05.07.2010:

Sequencing of pAAV_iGEM-mVenus-YFP

Dirty and fancy method for ITR BioBrick production

Beta-globin BioBrick production

hGH BioBrick production

Splitting HT and HEK cells

Preparation of HT1080 3x6er dishes for Transduction

Preparation of 6x10cm petri dishes HEK293

Repetition of ITR restriction site modification via PCR

Search for restriction sites in the sequence LQA/RGQA/RQA

Results sequencing alignment of GMK_TK30

51.Labortag 6.07.2010:

Harvesting AAVs from 4 10cm dishes, Transduction of 3x6er dishes

Search for restriction sites before and after the insertion sites 453 and 585/588

Transduction of 3x6er dishes

Search for restriction sites around the 453 and 585/588 integration sites

Search for restriction sites in the sequence LQA/RGQA/RQA

52.Labortag 07.07.2010:

Sequencing of GIO

Interview with Bild der Wissenschaft

Transfection

New pcr run with new polymerase and different MgSO4 concentrations

Checking the results of the following sequencing reactions for the expression constructs from the DKFZ

53.Labortag 08.07.2010:

Final planing of the Cap modifications

54.Labortag 09.07.2010:

PCR of hgH

Order oligos for GMK_TK30

Quickchange for the PstI restriction sites in pAAV-RC

55.Labortag 11.07.2010

Splitting of HT1080 cells

56.Labortag 12.07.2010:

Cloning CFP into pSB1C3

Seeding HT1080 + Passage

PCR of beta-globin:

Midi-Prep preparation pAAV_RC

First steps in producing ITR BioBricks via Fancy Method

Ordering genes for the replacement of Rep and Cap parts

Sequencing of GOI

57.Labortag 13.07.2010:

Endotoxin-free Midi Prep of pAAV_RC

HEK-293 cells

Oligos pMGMK_TK30 arrived

Transduction

Results of Trafo of cloning CFP into pSB1C3

Repetition of cloning of CFP into pSB1C3

TRANSFORMATION of Quickchange PstI

58.Labortag 14.07.2010

Trafo evaluation of Quickchange PstI

Quickchange for the PstI restriction sites in pAAV-RC (modified)

Results of trafo cloning pSB1C3_CFP

Seed AAV-293

DAAD Timetable

Summary

Ordering ITR+TK/GMK

Endotoxoin free Midi prep mAAV_RC

MGMK_TK30:PCR with iGEM restriction-sites and cloning into pAAV_RFC25