Team:Freiburg Bioware/NoteBook/Labjournal/June

From 2010.igem.org

(Difference between revisions)

Latest revision as of 21:36, 27 October 2010

=> Back to Notebook overview

NoteBook Navigator

1 18. Labortag 01.06.2010:
- 1.1 Modifying MCS of pAAV_MCS vector
2 19. Labortag 02.06.2010:
- 2.1 Picking clones of pAAV_RFC25MCS
- 2.2 Design and ordering of Oligos (NotI)
- 2.3 Sponsoring work:
3 20. Labortag 03.06.2010:
- 3.1 pAAV_RFC25_MCS -> problem
- 3.2 Picking clones of Thymindinkinase of Amor
4 21. Labortag 04.06.2010:
- 4.1 DKFZ plasmid Retrafos, TK/GMK Mini-Prep
5 22. Labortag 05.06.2010:
- 5.1 Insertion of iGEM expression parts into pAAV_MCS
6 23. Labortag 07.06.2010:
- 6.1 Mini-Preps (Kleinschmidt-plasmids and pAAV_iGEM-MCS)
- 6.2 Kleinschmidt-plasmids
- 6.3 Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)
7 24. Labortag 08.06.2010:
- 7.1 Cloning of mVenus_YFP into pAAV_iGEM-MCS, continuation of site-directed mutagenesis
- 7.2 Continuation of site-directed mutagenesis
8 25. Labortag 09.06.2010:
- 8.1 pAAV_iGEM-MCS_mVenus-YFP, Site-directed mutagenesis
- 8.2 Picking of Clones from pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben
9 26. Labortag 10.06.2010:
- 9.1 Site-directed mutagenesis of PstI in ITRs
- 9.2 Mini-Prep of pAAV_iGEM_Venus_YFP and test digestion
10 27. Labortag 11.06.2010:
- 10.1 Site directed mutagenisis of 10.06.2010
11 28. Labortag 12.06.2010:
- 11.1 Transformation plates stored in 4°C room
12 29. Labortag 13.06.2010:
13 30. Labortag 14.06.2010:
- 13.1 Site-directed mutagenesis:
- 13.2 TK-GMK-Plasmid
- 13.3 Cell culture
14 31. Labortag 15.06.2010:
- 14.1 Solutions for transfection were prepared
15 32. Labortag 16.06.2010:
- 15.1 Sponsoring:
- 15.2 Sequencing of TK-GMK:
- 15.3 Mega primer PCR:
16 33. Labortag 17.06.2010:
- 16.1 Primer designing: VP1 primer for pKEX forward/reverse
- 16.2 Primer designing: CMV_forward/reverse_qPCR
- 16.3 Ordering of required reagents:
17 34. Labortag 18.06.2010
- 17.1 Transfection
- 17.2 Theoretical: Digestion of pAAV_MCS for PCR to design ITR BioBrick
18 35. Labortag 19.06.2010: Literature seminar
19 36.Labortag 20.06.2010:
- 19.1 Picking clones of sequenced pAAV_igEM_mVenus_YFP
20 37.Labortag 21.06.2010:
- 20.1 Second Transfection, Transduction
- 20.2 Feching dry ice for the experiments
- 20.3 Annotation of the BRs and the PLA2 domains
- 20.4 Endotoxin-free Midi-Prep of pAAV_iGEM_mVenus-YFP
- 20.5 Second Transfection
- 20.6 Preparing Viral Stocks
- 20.7 HT1080 Transduction
21 38.Labortag 22.06.2010:
- 21.1 Midiprep of pHelper plasmid; cloning of the rfc25 MCS
22 39.Labortag 23.06.2010:
- 22.1 Preparation of Viral Stock, Seeding cells
- 22.2 Design of Primer
- 22.3 Sequencing of pKEX-VP1
- 22.4 Thaw HT1080 and AAV-293 cells
- 22.5 Picking clones of pAAV_RFC25
- 22.6 Transduction results
- 22.7 Preparation of viral stocks
23 40.Labortag 24.06.2010:
- 23.1 Labmeeting, Presentation/Update by Patrick and Adrian
- 23.2 Midi-Prep of pAAV_iGEM_mVenus-YFP
- 23.3 Mini Prep of P42 and P43 pAAV-RFC-25
- 23.4 ITR modification via PCR
- 23.5 Work on pKEX backbones
24 41.Labortag 25.06.2010:
- 24.1 PCR of ITRs, Splitting HT1080 and AAV-293 cells, Seeding of HT1080 cells, Creating Virus Stock Economics, Medium check
- 24.2 Splitting of HT1080 and AAV-293 cells, Seeding of HT1080 cells
- 24.3 Creating Virus Stock Economics
- 24.4 Medium check
- 24.5 Sequencing results of pAAV_RFC25
- 24.6 Annotation and studies of the AAV structure
25 42.Labortag 26.06.2010
- 25.1 Transduction of HT1080 cells
- 25.2 Paper reading session
26 43.Labortag 28.06.2010:
- 26.1 Checking HT1080 for YFP-Expression, Creating plan: urgent things to do
- 26.2 Sequencing results of P42
- 26.3 Theoretical construction of our biobricks
- 26.4 Urgent Things to do:
- 26.5 Continuation of ITR PCR
- 26.6 ITRs (theoretical)
27 44.Labortag 29.06.2010:
- 27.1 Discussionround
- 27.2 Seeding HT-cells for transfection and titering
- 27.3 Seeding HT1080-cells for transduction and qPCR
- 27.4 Transduction of HT1080 cells for qPCR
28 45.Labortag 30.06.2010:
- 28.1 Titering Procedure via qPCR, Transduction of 6well plates no.4
- 28.2 beta-globin intron
- 28.3 hGH sequence
- 28.4 ITRs: new strategy
- 28.5 Sequencing of pAAV_iGEM-mVenus-YFP
- 28.6 Investigation of the Kleinschmidt sequencing

18. Labortag 01.06.2010:

Modifying MCS of pAAV_MCS vector

Investigators: Anissa, Adrian, Bea, Chris W., Hanna, Patrick, Volker, Sven

Oligos received from Sigma-Aldrich
(right ITR of pAAV_MCS, left ITR of pAAV_MCS and MCS RFC25 for pAAV)

Hybrization of received oligos: MCS RFC25 for pAAV (forward) and MCS RFC25 for pAAV (reverse)
Centrifuge tubes prior to open tubes (13.000 rpm, 30 sec)
- MCS RFC25 for pAAV (forward): Add 92µL Millipore H₂O (Volume on obtained sheet)
- MCS RFC25 for pAAV (reverse): Add 394 µL Millipore H₂O (Volume on obtained sheet)
Vortex the resuspended DNA
Make aliquots of both Oligos (1:10): 10 µL Oligo + 90 µLH₂O (final volume usually 100 µl)
Mix together(into PCR-tube):

Volume/µL	solution
10 (1:10)	Oligo 1: MCS RFC25 for pAAV (forward)
10	Oligo 2: MCS RFC25 for pAAV (reverse)
4	100mM TrisHCl pH8
8	5mM MgCl2
8	H20

Program: ORIGAMI 1 modified for long oligos:
- 1 99°C 7’
- 2 99°C 1’
- -1°C R=0.3 °/s
- Goto 2 rep 74
- Hold 4°C

While hybridization of oligos is performed, digestion of pAAV_MCS vector can be conducted

following standard protocol for cloning.

Title: Ligation MCS_Oligo with pAAV_MCS
Plasmid: pAAV_MCS
Buffer used: 3
BSA: Yes
Measure DNA-concentration with Nanodrop
DNA-Concentration:260 ng/uL
Restriction-enzyms used: http://www.neb.com/nebecomm/DoubleDigestCalculator.asp

Enzyme1 (Nr. Lab: 152): ClaI Enzyme2 (Nr. Lab: 15): BglII

Digestion components :

components	pAAV_MCS
DNA	4
BSA (10x)	3
Buffer 3 (10x)	3
Enzyme: ClaI (no.Lab:152)	2
Enzyme: BglII (no.Lab:15)	1
H₂O	17
Total volume	30

Incubate for 1,5 h at 37°C

1% Agarose gel
- 1% agarose gel was prepared, gel ran for 45 minutes( first: 90V, after 15 minutes: 115 V)

Amount of loading dye added

sample/µL	loading dye/µL
marker: 8	contains loading dye
pAAV_MCS: 24	6

Expected size of fragments

sample	expected size
pAAV_MCS: cut with ClaI and BglII	4580 bp

19. Labortag 02.06.2010:

Picking clones of pAAV_RFC25MCS

Investigators: Adrian, Bea, Chris W., Hanna, Anissa

Practical work:
Control plate contained no clones. :) 4 colonies were picked and grown @ 37°C over night.

Design and ordering of Oligos (NotI)

Investigators: Adrian, Bea, Chris W., Hanna, Anissa

Oligos for site directed mutagenesis of the NotI restriction sites in pAAV_MCS (ITRs) were designed:
Media:Freiburg10 NotI ITR Oligos.pdf

Sponsoring work:

Sponsoring letter was adapted for Quiagen.

20. Labortag 03.06.2010:

pAAV_RFC25_MCS -> problem

Investigators: Anissa, Bea, Melanie, Christian L.

Comment: Continue with Mini-Prep and test digestion of pAAV_RFC25_MCS
Mini-Prep and test digestion have been performed:

Problem: Designed oligos (MCS_RFC25) for altering the MCS of the pAAV_MCS vector cannot be used.
Two startcodons are in the MCS.

Oligo MCS_RFC25: contains 2 Startcodons. the "wrong" Codon is the first ATG which results in the peptide chain with 30 aa. The second ATG is the right ATG which is right before the Gene of Interest.

The two startcodons are not in the same open reading frame (ORF). Therefore two proteins will be produced. The Gene of Interest and the short peptide (30 aa).
The idea of the oligos was to ligate the oligos into the pAAV_MCS vector. The oligos contained two overhangs which correspond to the sequences of the two restriction sites ClaI and BglII:
The pAAV_MCS vector was digested with ClaI and BglII and then we ligated the oligo and the vector. Problem was that we did not notice that the overhang of ClaI and the sequence of EcoRI of the MCS_RFC25 resulted in another ATG startcodon.

Possible Solutions:

first: modify MCS with ordered oligos of Sven (shorter MCS which cannot be used for pEX)and clone mVenus
Perform site-directed-mutagenesis (QuikChange from Stratagene)
Order new MCS-oligos and consider that no new ATG is produced. For example: add another base between ClaI overhang and EcoRI sequence. -----ATXG---- This solution is the more possible one we are going to perform.

Practical work

Preparing four glycerol stocks (2:1)
- numbers: B4 - B7 (for details see nomenclature)
- stored in -80°C, Box 1

MiniPrep
- Nanodrop concentrations

Sample	*Concentration/ngµl-1**
P11	340,5
P12	364,0
P13	358,5
P14	284,4

Test digestion

Components	Volume µl	Mastermix µl
DNA	800	--
BSA (10x)	1,5	7,5
Buffer No.2 (10x)	1,5	7,5
Enzyme 1 (no.Lab:45) Nde I	0,5	2,5
Enzyme 2 (no.Lab:71) Spe I	0,5	2,5
H₂O	variable	--
Total volume	15	20

Sample	Volume/ µl	H₂O / µl
P11	2,3	8,7
P12	2,2	8,8
P13	2,2	8,8
P14	2,8	8,2

Incubation: 1,5 h

Agarose-Gel

Materials

0,5 g Agarose, 50 ml TAE, 3µl GELRED, at 100 Volt, running time: 45 minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
P11	15 µl	3 µl	3677 bp	974 bp
P12	15 µl	3 µl	3677 bp	974 bp
P13	15 µl	4 µl	3677 bp	974 bp
P14	15 µl	4 µl	3677 bp	974 bp

	Marker	Sample P11 /18 µl	Sample P12 /18 µl	Sample P13 /19 µl	Sample P14 /19 µl
Lane	1	3	5	7	9

Results of agarose-gel:

Expected fragments of 3677 bp and 974 bp can be verified. The insertion of the RFC25_MCS has been inserted.

Picking clones of Thymindinkinase of Amor

- 5 clones of the XL-1 Blue colonies containing the plasmid pUB6/HV5/His6 with the thymidinkinase-guanylate fusion enzyme have been picked from LBamp-agarplates
- 1 clone of the XL-1 Blue colonies containing the plasmid pUB6/HV5/His6 without the thymidinkinase (control) has been picked from LBamp-agarplates
- all clones have been inoculated in 10 mL LB containing 10 µL Amp. Incubation: 37°C over-night.
- to do: Mini-Prep of pUB6/HV5/His6 with the thymidinkinase and pUB6/HV5/His6 without the thymidinkinase (control)

Idea

Insertion of Kozak consensus sequence before MCS to enhance gene expression (cloning consideration in Stratagene manual)
- New RFC standard with Kozak sequence for eucaryotes??

21. Labortag 04.06.2010:

DKFZ plasmid Retrafos, TK/GMK Mini-Prep

Investigators: Adrian, Bea, Chris W., Hanna

DKFZ

Comments: Plasmids of PD Kleinschmidt of the DKFZ arrived. The DNA was dried on a whatman paper.
Plasmids received:

pXX6 all Adenovirus helper genes without AAV genes
pKEX-2XL.Rep40 expression plasmid for Rep protein 40
pKEX-2XL.Rep 52 expression plasmid for Rep protein 52
pKEX-2XL.Rep 68 expression plasmid for Rep protein 68
pKEX-2XL.Rep 78 expression plasmid for Rep protein 78
pCMV-VP(HS) expression plasmid for VP proteins in combination (assemly competent)
pKEX-VP1 expression plasmid for single VP proteins (Cap: VP1, VP2 und VP3). Be careful: Single constructs are not assembly competent; Ruffing et al 1992; Steinbach et al. 1997;
pKEX-VP2expression plasmid for single VP proteins (Cap: VP1, VP2 und VP3). Be careful: Single constructs are not assembly competent; Ruffing et al 1992; Steinbach et al. 1997;
pKEX-VP3expression plasmid for single VP proteins (Cap: VP1, VP2 und VP3). Be careful: Single constructs are not assembly competent; Ruffing et al 1992; Steinbach et al. 1997;
pTRUF_CMV_eGFPsingle stranded vector for eGFP expression
dsAAV_CMV_eGFP"self complementary" expression vector from X. Xiao
pTAV2 (whole AAV genome in "blue script" vector)
pDG complete helper plasmid, nedded for vector production ; Grimm et al. 1998

In order to obtain the DNA following steps have been performed:
- cut out the spot where the DNA is spotted with a clean scalpel (note: scalpel should not have any contamination).
- put a 0,5 mL Eppi in a 1,5 mL Eppi. Put little holes in the smaller eppi.
- transfer Whatman paper into Eppi
- add 50 µL TE-EF (Redissolving buffer) to whatman paper and wait 15 minutes
- centrifuge eppis at 2000 rpm, 10 minutes
Transformation with obtained plasmids was performed.

Fusion Enzyme: Thymidinkinase/Guanylate Kinase (TK/GMK)

Plasmid Mini-Prep

experiment date: 04.06.2010 ; time: 3,5h
name of investigator: Adrian, Bea, ChrisW.,Hanna
new vector name: pUB_V5_His6 + TK/GMK (fusionenzyme)

Glycerol Stocks

	Clone 1	Clone 2	Clone 3	Clone 4	Clone 5	Control
Bacteria strain	XL-1 Blue	XL-1 Blue	XL-1 Blue	XL-1 Blue	XL-1 Blue	XL-1 Blue
Plasmidname	pUB_V5_His6 + TK/GMK	pUB_V5_His6 + TK/GMK	pUB_V5_His6 + TK/GMK	pUB_V5_His6 + TK/GMK	pUB_V5_His6 + TK/GMK	pUB_V5_His6 + TK/GMK
Date	04.06.2010	04.06.2010	04.06.2010	04.06.2010	04.06.2010	04.06.2010
given number	B8	B9	B10	B11	B12	B13

Given Plasmid-Number

	Clone 1	Clone 2	Clone 3	Clone 4	Clone 5	Control
given number	P15	P16	P17	P18	P19	P20

Nanodrop concentration

Plasmid
- Given Plasmid-Number: P15; DNA concentration: 493,7 ng/µL ;
- Given Plasmid-Number: P16; DNA concentration: 464,4 ng/µL;
- Given Plasmid-Number: P17; DNA concentration: 445,6 ng/µL;
- Given Plasmid-Number: P18; DNA concentration: 562,9 ng/µL;
- Given Plasmid-Number: P19; DNA concentration: 528,1 ng/µL;
- Given Plasmid-Number: P20; DNA concentration: 499,9 ng/µL;

Comments:A Plasmid-Mini Prep with the received Fusionenzyme Thymidinkinase/Guanylate Kinase (TK/GMK)from Amor has been performed.
The DNA will be sent to GATC for sequencing.

pUB6_V5_His6 - clone 1 (P15) (3 µL added to 27µL H20) has been sent to GATC.
Expected results: Saturday

22. Labortag 05.06.2010:

Insertion of iGEM expression parts into pAAV_MCS

Investigators: Adrian, Bea, Melanie, Hanna

Hybridization:

Hybridization of received oligos: iGEM expression parts (RFC25 without EcoRI, NotI)
Prior to opening the tubes, they were centrifugated at 13.000 rpm for 30 sec.
- expression part MCS_for (charge-no: ST00114065): 108 µL Millipore H₂O (Volume on obtained sheet)were added.
- expression part MCS_for (charge-no: ST00114066): 165 µL Millipore H₂O (Volume on obtained sheet)were added.
Resuspended DNA was vortexted.
Aliquots of both Oligos (1:10) were prepared: 10 µL Oligo + 90 µL H₂O (final volume usually 100 µl).
Mix together(into PCR-tube):

Volume/µL	solution
10 (1:10)	Oligo 1: expression part MCS_for (charge-no: ST00114065)
10 (1:10)	Oligo 2: expression part MCS_for (charge-no: ST00114066)
4	100 mM TrisHCl pH8
8	5 mM MgCl2
8	H20

Program: ORIGAMI 1 modified for long oligos:
- 1 99°C 7’
- 2 99°C 1’
- -1°C R=0.3 °/s
- Goto 2 rep 74
- Hold 4°C

While hybridization of oligos was performed, digestion of pAAV_MCS vector was conducted

following standard protocol for cloning.

Digestion:

Title: Ligation iGEM expression parts (="iGEM-MCS") with pAAV_MCS
Plasmid: pAAV_MCS
Buffer used: 3
BSA: Yes
DNA-Concentration: 260 ng/uL
Restriction-enzyms used:

Enzyme1 (Nr. Lab: 152): ClaI Enzyme2 (Nr. Lab: 15): BglII

Digestion components :

components	pAAV_MCS
DNA	5.8 µL
BSA (10x)	3 µL
Buffer 3 (10x)	2 µL
Enzyme: ClaI (no.Lab:152)	2 µL
Enzyme: BglII (no.Lab:15)	1 µL
H₂O	16.2 µL
Total volume	30 µL

Mixture was incubated for 1,5 h at 37°C.

Agarose-Gel:

1% agarose gel was prepared, gel ran for 45 minutes(110 V)

Amount of loading dye added

sample/µL	loading dye/µL
marker: 8	contains loading dye
pAAV_MCS: 30	6 (6x loading dye)

Expected size of fragments

sample	expected size
pAAV_MCS: cut with ClaI and BglII	4580 bp

</ul>

Gelextraction:

Gel measurement:

Sample	weight
pAAV_MCS	60 mg

Gelextraction was performed following standard protocol.
DNA-concentrations were meassured: pAAV_MCS 18.2 ng/µL, Oligos: 136.7 ng/µL -> 1:10 dilution was prepared: 13.67 ng/µL

Ligation:

	iGEM-MCS	pAAV_MCS
Volume/µl	0.4	8.6

Trafo was performed (using XL1B cells) following standard protocol.

23. Labortag 07.06.2010:

Mini-Preps (Kleinschmidt-plasmids and pAAV_iGEM-MCS)

Investigators: Investigators: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea

pAAV_iGEM-MCS

Plasmid Mini-Prep

experiment date:07.06.2010; time: whole day
name of investigator: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea

Glycerol Stocks

	Clone 1	Clone 2	Clone 3	Clone 4
Bacteria strain	XL1B	XL1B	XL1B	XL1B
Plasmidname	pAAV_iGEM-MCS	pAAV_iGEM-MCS	pAAV_iGEM-MCS	pAAV_iGEM-MCS
Date	07.06.2010	07.06.2010	07.06.2010	07.06.2010
given number	-	B27	B28	B29

Given Plasmid-Number

	Clone 1	Clone 2	Clone 3	Clone 4
given number	-	P34.2	P34.3	P34.4

Test digestion

buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) NdeI
Plasmid
- Given Plasmid-Number: P34.2; DNA concentration: 433.78 ng/µL ;
- Given Plasmid-Number: P34.3; DNA concentration: 408.48 ng/µL ;
- Given Plasmid-Number: P34.4; DNA concentration: 409.80 ng/µL ;

Comments:Clone no.1 was discarded.

Test digestion:

Components	Volume/µL	Mastermix
DNA (clone 2)	1000 ng	-
BSA (10x)	no	-
Buffer no. 4 (10x)	1.5 µL	-
Enzyme 1 (no. Lab: ) AgeI	0.75 µL	-
Enzyme 2 (no. Lab: ) NdeI	0.5 µL	-
H₂O	variable	-
Total volume	15 µL	-

Sample	Volume sample/ µl	Volume H₂O / µl
P34.2	2.3	9.95
P34.3	2.4	9.85
P34.4	2.4	9.85

Incubation: 45 min, 37°C

Agarose-Gel:

0.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 110 Volt, running time: 45 minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
P34.2	15 µl	3 µl	3686 bp	951 bp
P34.3	15 µl	3 µl	3686 bp	951 bp
P34.4	15 µl	3 µl	3686 bp	951 bp

Marker: GeneRuler ladder mix

	Marker	Sample	Sample	Sample
Lane	34.2 / 18 µl	34.3 / 18 µl	34.4 / 18 µl

Kleinschmidt-plasmids

Investigators: Kira, Achim, Jessy, Bea, Adrian, Hanna

Plasmid Mini-Prep

experiment date: 07.06.2010 ; time: 10 – 20 h
Kleinschmidt-plasmids

Glycerol Stocks

	Clone 1	Clone 2	Clone 3	Clone 4	Clone 5	Clone 6	Clone 7	Clone 8	Clone 9
Bacteria strain	XL1B	XL1B	XL1B	XL1B	XL1B	XL1B	XL1B	XL1B	XL1B
Plasmidname	pXX6	pKEX-2XL.Rep 40	pKEX-2XL.Rep 52	pKEX-2XL.Rep 68	pKEX-2XL.Rep 78	pCMV-VP(HS)	pKEX-VP1	pKEX-VP2	pKEX-VP3
Date	07.06.2010	07.06.2010	07.06.2010	07.06.2010	07.06.2010	07.06.2010	07.06.2010	07.06.2010	07.06.2010
given number	B14	B15	B16	B17	B18	B19	B20	B21	B22

	Clone 10	Clone 11	Clone 12	Clone 13
Bacteria strain	XL1B	XL1B	XL1B	XL1B
Plasmidname	pTRUF_CMV_eGFP	dsAAV_CMV_eGFP	pTAV2	pDG
Date	07.06.2010	07.06.2010	07.06.2010	07.06.2010
given number	B23	B24	B25	B26

Given Plasmid-Number

Clone 1

Clone 2

Clone 3

Clone 4

Clone 5

Clone 6

Clone 7

Clone 8

Clone 9

Clone 10

Clone 11

Clone 12

Clone 13

given number

P21

P22

P23

P24

P25

P26

P27

P28

P29

P30

P31

P32

P33

measured concentration

351,01

673,1

532,22

579,05

725,31

659,68

692,8

545,46

568,34

420,62

446,95

496,8

472,58

Comments: Many things went wrong today!

Glycerol stocks must be vortexted!
Check mini-prep buffers - especially buffer PE (needs to contain ethanol!)
Always check volumes - try to estimate if volume makes sense (check pipettes!)
Don't discard bacteria cultures until glycerol stocks and mini-preps are successfully done!!!

Today's conclusion: Better ask 2 times than do something wrong without asking!!!

Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)

Quickchange site directed mutagenesis: PCR reaction:

2.5 µL 10x Pfu Ultra II buffer
0.5 µL template (therefore the a 1:20 dilution of the pAAV_iGEM-MCS (433 ng/µL) was prepared) = 10.825 ng
0.56 µL primer 1 (of 1:10 dilution)
0.56 µL primer 2 (of 1:10 dilution)
1 µL DMSO (primers form very strong secondary structures)
0.5 µL dNTP
18.88 µL dH₂O
0.5 µL PfuUltra II fusion (1.25 U)

-> end volume: 25 µL

PCR program:
1 x : 2' 95°C (HotStart polymerase) 20 x : 30 s 95°C -> 1' 55°C -> 5' 68°C 1 x : 4°C (over night)
Experiment will be continued tomorrow.

24. Labortag 08.06.2010:

Cloning of mVenus_YFP into pAAV_iGEM-MCS, continuation of site-directed mutagenesis

Investigators: Kira, Jessy, Hanna, Achim

Analysis of iGEM-MCS sequence (RFC25 without EcoRI and NotI):

The alignment with the theoretical pAAV_iGEM-MS delivered a "C-deletion" within the NgoMIV restriction site. Due to that the pAAV_iGEM-MCS lacks this site. We controlled the bill of delivery and noted that the deletion must be GATC's fault. All in all this doesn't matter, because parts which are in iGEM standard can be inserted and therefore they will deliver the lacking NgoMIV restriction site. Further on this could be an advantage because after digestion the fragment which is cut out can be better detected in the gel.

Insertion of mVenus_YFP into pAAV_iGEM-MCS

Digestion:

plasmid: insert: pGA14mVenusGeneart; number: - origin:Sven

plasmid: vector: pAAV_iGEM-MCS; number: P32.2 production date:05.06.2010 origin: ____

new vector name: pAAV_iGEM-MCS_mVenus

buffer used:4 ; Restriction-enzymes used: Enzyme AgeI (no. Lab:149); Enzyme XbaI (no. Lab: 63)

DNA concentration (vector):433,78ng/µl ; DNA concentration (insert): 530 ng/µl

components	V (pAAV_iGEM-MCS)/ µl	I(pGA14mVenus_Geneart) / µl
DNA	2,3	3,8
BSA (10x)	2	2
Buffer 3 (10x)	2	2
Enzyme: AgeI (no.Lab:149)	1,25	1,25
Enzyme: XbaI (no.Lab:63)	0,75	0,75
H₂O	11,7	10,2
Total volume	20	20

Incubation: 1 1/2 h at 37°C
0.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 115 Volt, running time:

Sample	Sample/µl]	Loading dye (6x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
P34.2	20 µl	4 µl	4617 bp	22 bp
pGA14mVenus	20 µl	4 µl	2870 bp	774 bp

Gel loaded with vector and insert samples, 24 µl each & 8 µl marker

after 20 minutes, the insert band was cut out. Two overlapping bands were visible in the vector well, after 1 1/2 hours those bands were separated and both were cut out.

Sample	weight	concentration
Vektor_Oben	0,32 g	29,8 ng/µl
Vektor_Unten	0,14 g	12,8 ng/µl
Insert	0,3 g	12,9 ng/µl

the exact volume of insert and vector was calculated with LabTools:

Ligation I with Vektor_Oben:

Vector: 4,16 µl
Insert: 4,84 µl

Ligation II with Vektor_Unten:

Vector: 6 µl
Insert: 3 µl

Continuation of site-directed mutagenesis

Digestion with DpnI:

0.5 µl DpnI added

incubated for 1 hour at 37°C

Trafo:

Cells used for transformation: XL1B

Centrifugation for 3 min at 8000 rpm instead of 6000 rpm (accidentaly)

Plated on agar plate: pAAV_IGEM-MCS Mutagenese PST1 8.6.2010 AM XL1B

incubated over night

25. Labortag 09.06.2010:

pAAV_iGEM-MCS_mVenus-YFP, Site-directed mutagenesis

Investigators: Jessy, Achim, Sven, Toby, Hanna

No pAAV_iGEM-MCS_w/oPstI transformed bacteria (site-directed mutagensis) grew on the ampicillin agar plates over night!

Experiment is conducted again, guided by Toby (Thanks a lot!!!).

Further on the cloning of mVenus-YFP into pAAV_iGEM-MCS seemed to fail:

Only on the agar plate cotaining the bacteria transformed with the "vector_oben" ligation, which actually should be the "wrong" ligation (gelextraction of a band which contained fragments that were too large, see picture in lab journal), revealed colonies. Therefore this experiments is also conducted one more time, guided by Sven (thanks also a lot!!!)

Insertion of mVenus_YFP into pAAV_iGEM-MCS

experiment date: 9.6.2010

plasmid:
- Vector: name: pAAV_iGEM-MCS number: 34.2 production date: 5.6.2010
- Insert: name: pOG14_mVenus number: - production date: ____ origin: Sven :)
new vector name: pAAV_iGEM-MCS_mVenus-YFP
buffer used: NEB4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) XbaI
DNA concentration (vector): 433 ng/µL ; DNA concentration (insert): 530 ng/µL

Digestion

components	volume of vector /µl	volume of insert /µl
DNA	2.83	2.77
BSA (100x)	0.5	0.5
Buffer NEB4 (10x)	3.0	3.0
Enzyme 1 (AgeI)	1.75	1.75
Enzyme 2 (XbaI)	1.25	1.25
H₂O	20.73	20.67
Total volume (e.g. 15,20,25,30 µl)	30	30

Agarose-Gel:

0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED (3-6µl), at 115 Volt

Gelextraction

insert (mVenus-YFP): 26 ng/µL
vector (pAAV_iGEM-MCS): 30 ng/µL

Ligation

vector: 5.85 µL
insert: 3.15 µL
ligase: 1 µL
buffer: 10 µL

Test digestion of pAAV_iGEM-MCS

p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>

buffer used: 1 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) NgoMIV
Plasmid
- Given Plasmid-Number: P34.2 ; DNA concentration: 433.78 ng/µL;
- Given Plasmid-Number: P34.3 ; DNA concentration: 408.48 ng/µL;
- Given Plasmid-Number: P34.4 ; DNA concentration: 409.8 ng/µL;

Components	P34.2 [µL]	P34.3 [µL]	P34.4 [µL]
DNA	2.3	2.5	2.4
BSA (10x)	1	1	1
Buffer no. 1 (10x)	1	1	1
Enzyme 1 (no. Lab: 113) ngoMIV	1	1	1
H₂O	4.7	4.5	4.6
Total volume	10	10	10

Incubation: 1 h, 37°C

Agarose-Gel:

0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes + 20 minutes

Sample	Sample/µl]	Loading dye (6x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
P34.2	10 µl	2 µl	3728 bp	903 bp
P34.3	10 µl	2 µl	3782 bp	903 bp
P34.4	10 µl	2 µl	3782 bp	903 bp

Marker: GeneRuler ladder mix

	Marker	Sample P34.2 /µl	Sample P34.3 /µl	Sample P34.4 /µl
Lane	8 µL	10 µL	10 µL	10 µL

Comments: Digestion of P34.2 delivered just one fragment size, revealing that - as expected after sequencing (C-deletion: no NgoMIV site in iGEM-MCS) - there was just one NgoMIV restriction site in the vector. In contrast to that the digestion of P34.3 and P34.4 delivered two bands - whereas the band of the smaller fragments looked like a smier. Because of this obscure and non-satisfying results (besides our assumption that there's something wrong with the marker :) )we decided to sequence the P34.3 vector:

c(P34.3): 408.48 ng/µL
Volume (plasmid): 5.14 µL
Volume (vector): 24.86 µL
Name of eppi: HW_34
Primer: GATC_std_pTeSp-1

Picking of Clones from pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben

Investigator: Hanna, Achim

experiment date: 9.6.2010
plasmid:
- Vector: name: pAAV_iGEM-MCS_Vektor_oben
- Insert: name: pOG14_mVenus
new vector name: pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben

The Clones were picked and incubated in 10 mL LB-Medium containing 10µL ampicillin over night at 37°C on a rotary shaker.

26. Labortag 10.06.2010:

Site-directed mutagenesis of PstI in ITRs

1. Site directed mutagenisis

Aim: deletion of PstI from both ITR's
2 PCR tubes got prepared, one for the left ITR and one for the right. (The SDM was performed according to the standart protocol)
Media:Freiburg10_Site_directed_Mutagenesis_pAAV_MCS_deletion_PstI.pdf‎

Mini-Prep of pAAV_iGEM_Venus_YFP and test digestion

Investigators: Jessy, Achim

2.1 Mini-Prep of pAAV_iGEM_mVenus_YFP

Title: pAAV_iGEM_mVenus_
Glycerol Stocks

	Clone 1	Clone 2
Bacteria strain	XL1 blue	XL1 blue
Plasmidname	pAAV_iGEM_mVenus	pAAV_iGEM_mVenus
Date	10.06.2010	10.06.2010
given number	B30	B31

Given Plasmid-Number

	Clone 1	Clone 2
given number	P35	P36

Title: pAAV_iGEM_mVenus_YFP (guided by Sven)
investigator: Bea Glycerol Stocks

	Clone 1	Clone 2	Clone 3	Clone 4
Bacteria strain	BL-21	BL-21	BL-21	BL-21
Plasmidname	pAAV_iGEM_mVenus_YFP	pAAV_iGEM_mVenus_YFP	pAAV_iGEM_mVenus_YFP	pAAV_iGEM_mVenus_YFP
Date	10.06.2010	10.06.2010	10.06.2010	10.06.2010
given number	B32	B33	B34	B35

Given Plasmid-Number

	Clone 1	Clone 2	Clone 3	Clone 4
given number	P37	P38	P39	P40

2.2 Test digestion

buffer used: 4 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme AgeI (no.Lab:___) ____
Plasmid
- Given Plasmid-Number: P37; DNA concentration: 114,8 ng/µL ;
- Given Plasmid-Number: P38 ; DNA concentration: 179,8 ng/µL;
- Given Plasmid-Number: P39 ; DNA concentration: 180,8ng/µL ;
- Given Plasmid-Number: P40; DNA concentration: 189,2 ng/µL;

Comments: Clones were picked from trafo-plate in the morning and mini-prep was performed in the late afternoon. Due to this and the fact that bacterial strain was BL-21, DNA-concentrations are quite low.

Investigators: Bea, Chris W.

Components	Volume/µL	Mastermix	Sample: P37	Sample: P38	Sample: P39	Sample: P40
DNA	800 ng	-	7,0 µL	4,5 µL	4,4 µL	4,2 µL
BSA (10x) yes	1,5 µL	7,5 µL	MM 4,5 µL	MM 4,5 µL	MM 4,5 µL	MM 4,5 µL
Buffer no. 4 (10x)	1.5 µL	7,5 µL	"	"	"	"
Enzyme 1 (no. Lab: ) AgeI	0.75 µL	3,75 µL	"	"	"	"
Enzyme 2 (no. Lab: ) XbaI	0.5 µL	2,5 µL	"	"	"	"
H₂O	variable	-	3,75 µL	0,25 µL	6,35 µL	6,55 µL
Total volume	15 µL	-	15 µL	15 µL	15 µL	15 µL

Incubation: 45 min, 37°C

27. Labortag 11.06.2010:

Site directed mutagenisis of 10.06.2010

Transformation
Transformation was performed according to the standard protocol Media:Freiburg10_Cloning Protocol.pdf
Cells were plated on agar plates (2x 1:100; 2x pellet)containing ampicillin and stored over night at 37°C.

Sequencing

p39 was send to GATC for sequenzing

p39: 180,83 ng*µl^-1
volume plasmid: 8,3 µl
volume water: 21,7 µl
primer: GATC_std_pTeSp-1

28. Labortag 12.06.2010:

Transformation plates stored in 4°C room

Investigator: Kira
The plates were stored in the iGEM shelf @ 4 °C. Even if the transformation was not very successfull, some colonies can be picked and inoculated either tomorrow or on Monday. Note: Site-directed mutagenesis does not generate lots of intact plasmids, so few colonies are normal!! (Tobias)

29. Labortag 13.06.2010:

Investigators: Jessy, Patrick, Hanna
We weren't able to detect any colonies on the plates - just a few air bubbles :) To be entirely sure, we put them back into the 37°C room over night.

30. Labortag 14.06.2010:

pAAV_iGEM-mVenus-YFP:

The sequencing data of pAAV_iGEM_mVenus-YFP was analyzed. The alignment with the "theoretical" pAAV_iGEM_mVenus-YFP showed that we successfully inserted mVenus-YFP into pAAV_iGEM-MCS.

Site-directed mutagenesis:

Also today no colonies were detectable on any plates!

TK-GMK-Plasmid

Investigators: Adrian, Hanna
puB6_V5_His6_clone1 + TK/GMK (P15) will be sequenced again:

name: AF 1
primer: GATC_std_BGH-reverse
volume(plasmid) = 4.25 µL
volume (H₂O) = 25.75 µL

Results (15.06.): Unfortunately just ~ 300 bp were sequenced.

To do: Therefore more primers have to be designed in order to sequence the whole ~2000 bp TK-GMK fusion construct!

Cell culture

AAV 293 and HT1080 Cells have been splitted and plated out on 10 cm dishes for transfektion. The Cells were accounted by using the Neubauer-Meteringchamber. After harvesting by following the standard protocol the pallet have been resuspendiated in 15ml of DTT medium. 2,5µl of this cell suspension have been mixed with 47.5µl of trypan blue.

We counted 12,5x 10^6 cells/ml for the T293 AAV cell line and 10x10^6 cells /ml for the HT1080 cell line.

The AAV 293 cells have been plated out on four dishes with 250µl of the cell suspension, on one plated with 1ml and on another dish with 1.5ml. note that that the date is wrong on the plates and the flasks! Cells have been already plated out on the 14th. of June.

We also seated two flasks one for each cell line. Therefor we used 1ml of the HT1080 cell suspension and two ml of the the AAV293 cells.

31. Labortag 15.06.2010:

Solutions for transfection were prepared

Investigators: Adrian, Achim, Chris W., Hanna

1 x TE-Buffer: 1.2114 g TRIS, 0.2 mL EDTA, 81 mL milipore-H₂O were mixed. pH was adjusted with HCl (1M and 5M) to 7.50. Volume was adjusted to 100 mL with milipore-H₂O. Solution was autoclaved (sterilization by filtration is also possible).
1 M CaCl2: 147.02 g CaCl2 x 2H₂O (M = 147.02 g/mol) was solved in 1 Liter H₂O and sterilized by filtration.
2 x HBS: 0.027 g Na2HPO4, 1.636 g NaCl, 1.19155 g HEPES were dissolved in ~ 30 mL milipore-H₂O. pH was adjusted to 7.10. Volume was adjusted to 100 mL and sterilized by filtration.

32. Labortag 16.06.2010:

Sponsoring:

Investigators: Anna, Kerstin, Anissa
Sponsoring letters were examined and modified one more time.

Sequencing of TK-GMK:

Investigator: Hanna
Two primers were designed and ordered from Sigma-Aldrich. Probably we will receive them on Friday.

Mega primer PCR:

Investigators: Bea, Hanna

33. Labortag 17.06.2010:

Primer designing: VP1 primer for pKEX forward/reverse

Investigator: Volker
The construnts that we receieved from PD Dr. Kleinschmidt (DKFZ) are mainly in the pKEX backbone. The sequences of the backbone and the inserts are not availible, for this reason we decided to sequence the constructs. The first step is to sequence from one construct into the backbone. In the second step we will designe primers that bind in the backbone and point into the direction of the insert. These primers will then be used to sequence the inserts of all the constructs.

Forward primer pKEX in VP1 from bp 4124 to 414

VP1 primer for pKEX forward: 5' - CAACAAGTCTGTTAATGTGGAC - 3' 22bp; TM: 50°C; CG% 41%

Reverse primer pKEX in VP1 from bp 2081 to 2100

VP1 primer for pKEX reverse: 5' - GTGGGCCAGGTTTGAGCTTC - 3' 20bp; TM: 54°C CG%: 60%

The amplicon that should be produced by the primers is 199 bp long.

Primer designing: CMV_forward/reverse_qPCR

Investigator: Volker
Primers for the titering of the CMV region from the literature [Rohr et al., 2002] and [Rohr et al., 2005] were compared and analysed. The sequences from 2002 showed a differce in one nucleotide compared to the other primer and to our sequence. For this reason the second set [Rohr et al., 2005] was ordered.

CMV_forward_qPCR: 5' - GGGACTTTCCTACTTGGCA - 3'
CMV_reverse_qPCR: 5' - GGCGGAGTTGTTACGACA - 3'

Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively

These primers will be used in a quantitative PCR assay with Sybr-green to measure the genomic titer and the infectious titer of the viral particles we will produce in the future.

Ordering of required reagents:

Investigator: Volker

Nuclease S1 was ordered from Promega (10000Units for 36,00€)
Proteinase K was ordered from Sigma (5mg for 31,30€; BioUltra, ≥30 units/mg protein, lyophilized powder)

These reagents are required for the procedure to determine the genomic and the infectious titer.

34. Labortag 18.06.2010

Transfection

Transfection via calcium phosphat with the prepared solutions (31. Labortag 15.06.2010)

Investigators: Chris W., Hanna, Patrick, Adrian, Volker
Transfections with the following plasmids:

1)

pAAV_iGEM_mVenus_YFP (glycerol stock B34, P39) P39 has the correct sequence (confirmed)
pHelper
pAAV_RC

2)

pAAV_iGEM_mVenus_YFP (glycerol stock B33, P38) P38 (we dont know if P39 has the correct sequence!)was used because the amount of P39 was not sufficient enough for four Transfections!
pHelper
pAAV_RC

Plasmid concentrations:
pAAV_RC: 1 µg/µl
pHelper: 280 ng/µl
pAAV_iGEM_mVenus_YFP, P39: 180,83 ng/µl
pAAV_iGEM_mVenus_YFP, P38: 179,75 ng/µl

Cellculture clone 1 and 2 were transfected with P39. Cellculture clone 3 and 4 were transfected with P38.

Deviations from the standard protocol (currently incomplete): We could only pipet 3,3 µg (instead of 10 µg) from each of the 3 plasmids into the 15 ml falcons due to insufficient amount of plasmid.

Adrian tried to examine the precipation of the CaCl2+ DNA Clusters. We have to optimize the pH of our 2xHBS at the moment it is 11.12

Theoretical: Digestion of pAAV_MCS for PCR to design ITR BioBrick

Investigator: Bea
Idea:

Digest vector in order to obtain two fragments which contain the left and the right ITR respectively.
Separation (Agarose-gel) and gel extraction of fragments
Perform PCR with iGEM-Primers (forward primer contains EcoRI and Xbai; reverse primer contains SpeI and PstI)
to do:

design primers
digestion of pAAV_MCS etc.

Theoretical: Digestion of pAAV_MCS with AlwNI produces two fragments which can be separated by agaorse gel.

Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively

35. Labortag 19.06.2010: Literature seminar

Investigators: Bea, Hanna, Melanie, Denis, Volker, Christian W., Adrian and Achim

Topics:

The ITRs
The Cap

36.Labortag 20.06.2010:

Picking clones of sequenced pAAV_igEM_mVenus_YFP

Investigators: Bea and Chris W

Incoluate 250 mL DYT medium (add 250µL ampiciliin) with B34 (glycerol stock: BL-21 E.coli cells with P39 plasmid: pAAV-iGEM_mVenus_YFP
Incubate on rotary shaker over-night (o/n) at 37°C
to do: perform Midi-Prep tomorrow (21.06.2010)

37.Labortag 21.06.2010:

Second Transfection, Transduction

Investigators: Patrick, Johannes
2x HBS was steril filtrated into two 50 ml flacons. The falcons were put into the cellculture fridge.

New medium is prepared:

DMEM-Medium

500ml DMEM with Glutamax
10% FCS (50 ml)
5 ml 100x Pen/Strep
5 ml 100x NaPyruvat

H-DMEM-Medium

400 ml DMEM with Glutamax
90 ml FCS
5 ml 100x Pen/Strep
5 ml 100x NaPyruvat

Feching dry ice for the experiments

Investigators:Volker

Dry ice can be fetched from the department for macromolecular chemistry. The chemical depot is located in the second basement. The dry ice can be retrieved from monday to friday from 11:00 to 11:30 and from 14:15 to 14:30. The requestforms for this institute can be found in the iGEM folder and should be filled out, signed by an advisor and taken to the chemical depot. A styrofoam container is required for the transport.

Annotation of the BRs and the PLA2 domains

Investigator:Volker
The Bacis Regions which are important for the nuclear localisation were annotated in the protein sequences of VP 1-3 according to: [Grieger et al, 2006]

Endotoxin-free Midi-Prep of pAAV_iGEM_mVenus-YFP

Investigators: Chris W., Hanna (guided by Sven)
Midi-Prep was performed following standard protocol: File:Freiburg10 Endotoxinfreie Midi.pdf
DNA concenration was measured: 507 ng/µL
Plasmid was further used for a...

Second Transfection

Investigators: Patrick, Johannes

Six transfections were performed according to the standart protocol: Media:Freiburg10_Transfection_protocoll.pdf
Three 10 cm cellcluture dishes with 293 cells were transfected with 10 µg DNA (3,33 µg each plasmid) and the other three 10 cm cellculture dishes with 30 µg DNA (10 µg DNA each plasmid).

Plasmids:

pAAV_iGEM-MCS_mVenus (P41), 507 ng/µl
pAAV_RC , 1000 ng/µl
pHelper , 280 ng/µl

Preparing Viral Stocks

Investigators: Patrick, Johannes

According to the standard protocol (see AAV Helper-free System manual). No dilution was performed.

HT1080 Transduction

Investigators: Patrick, Johannes Four 10 cm cellculture dishes with HT1080 cells have been provided for the transduction.

1 ml of the AAV-2-mVenus (derived from P 39) was pipeted to into dish 1. Note: the virus solution (buffer) showed a yellow coloration.
1 ml of the AAV-2-mVenus (derived from P 39) was pipeted to into dish 2. Note: the virus solution showed (buffer) an orange coloration.
1 ml of the AAV-2-mVenus (derived from P 38) was pipeted to into dish 3. Note: the virus solution showed (buffer) an orange coloration.
1 ml of the AAV-2-mVenus (derived from P 38) was pipeted to into dish 4. Note: the virus solution showed (buffer) an orange coloration.

Apart from the dilution, the transduction was performed according to the standart protocol.

38.Labortag 22.06.2010:

Midiprep of pHelper plasmid; cloning of the rfc25 MCS

Investigators: Bea, Chris W, Adrian, Achim

Hybridisation of oligos RFC25 EcoR1+BglII for & RFC25 EcoR1+BglII rev
- Programm ORIGAMI1 was modified for normal oligos:
  - 1 95°C 7'
  - 2 95°C 1'
  - -1°C R=0,3°s
  - Rep 70

conc of Oligos: 138,3µg/µl

Digestion

plasmid: name: pAAV_MCS number: P9 production date: 01.06.2010 origin: Adrian, Hanna, Bea

new vector name: pAAV_RFC25

buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:23) EcoRI ; Enzyme 2 (no.Lab:15) BglII

DNA concentration (vector): 261,6 ng/µL

components	volume of vector /µl	volume of insert /µl
DNA	5,8	none
BSA (100x)	none	none
Buffer 3 (10x)	3	none
Enzyme EcoRI (no.Lab:23)	1,5	none
Enzyme BglII (no.Lab:15)	1,5	none
H₂O	18,2	none
Total volume (e.g. 15,20,25,30 µl)	30	none

Incubation: 1,5 h

A 1% agarose gel was prepared for plasmid separation

Production of antibiotika-stock-solutions (10 x 1ml AMP)

Midi Prep of pAAV-Helper: concentration. 732,6 µg/µl

Ligation of Oligos: RFC25 and pAAV-MCS.

dilution of our Oligos RFC from 138,3 µg/µl 1:10 13,83 (71bp long)=> 0,64µl
Vektor pAAV-MCS 23.3 µg/µl => 8,36µl
two plates are placed in the 37°C room

Trafo has been performed following standard protocols

39.Labortag 23.06.2010:

Preparation of Viral Stock, Seeding cells

Design of Primer

Investigators: Achim, Hanna

In order to sequence the hGH (polyadenylation) sequence and in general the GOI (gene of interest :) ) primers were designed: Media:Primer GOI+polyA pAAV iGEM-MCS mVenus YFP.pdf
These primer will be used in order to sequence P38 (pAAV_iGEM_mVenus-YFP) which delivered fluorescencing HT1080 cells - in comparison to the already sequenced P39 clone. Further on they can be used in general for sequencing any GOI.
These oligos were ordered at sigma aldrich as E@sy Oligos.
P38 was send for sequencing with GATC_std_pTESp-1 primer: 12 µL P39 (180 ng/µL) + 18 µL H₂O

Sequencing of pKEX-VP1

Investigators: Achim, Hanna, Adrian, Chris W.
Primer:

VP1 primer for pKEX forward: V = 3 µL + 27 µL H₂O
VP1 primer for pKEX reverse: V = 3 µL + 27 µL H₂O

Vector:

pKEX-VP1 (P27.2): c = 693 ng/µL, V = 3 µL + 27 µL H₂O

Thaw HT1080 and AAV-293 cells

Investigators: Achim, Hanna (guided by Sven)
Thawing of HT1080 and AAV-293 cells was performed following this protocol: Media:Freiburg10 Thawing cells.pdf

Picking clones of pAAV_RFC25

Investigators: Achim, Chris W., Hanna
Clones were picked, 250 mL DYT were inoculated.
Bacteria cultures are stored at 37°C over night.

Transduction results

Investigators: Adrian (guided by Sven)

Results of transduction, ~ 1% of the HT1080 showed expression of mVenus.
Bright light image 1	Fluoresce microscopy image 1
Bright light image 1	Fluoresce microscopy image 1

Preparation of viral stocks

Investigator: Johannes, Bea

Steril filtration of virus particles was performed (guided by Sven). Viral stocks are stored at -80°C.

40.Labortag 24.06.2010:

Labmeeting, Presentation/Update by Patrick and Adrian

Delivery of:

Proteinkinase K (will be used for the degradation of the viral capsid prior to qPCR)
Benzonase (will be used fur viral stock preparation)
Primer for for ITR-conversion to iGEM-standars

Presentations of Adrian and Patrick: Media:Adrian.ppt Media:Patrick.ppt‎

Midi-Prep of pAAV_iGEM_mVenus-YFP

Investigators: Hanna, Chris W (Adrian inserted RNAse and Ethanol into Buffers)

new kit from Qiagen was used
35 ml of the over-night culture was filled into a 50 mL falcon and centrifuged at 5000 g at 4°C for 5 minutes.
supernatant was discarded
Midi-prep was performed according to manual of Qiagen
final concentrations: 380,4 µg/µl
Name of eppi: P44

Mini Prep of P42 and P43 pAAV-RFC-25

Investigator: Bea

Mini-Prep was performed following standard protocols
conc: P42: 321,5 µg/µl
conc: P43: 310,1 µg/µl

ITR modification via PCR

Primers for ITR modification were resuspended and labeled: left forward: o24, left reverse: o25, right forward: o26, right reverse: o27

Work on pKEX backbones

Investigator: Volker

The sequencing data was evaluated and BLAST searches were carried out on NCBI to answer the question weather the sequence belongs to the backbone pKEX. This question could be answered positively.
There are standard Primers from GATC that prime in the sequence. The three expression plasmids from PD Kleinschmidt will therefor be sequenced tomorrow.
Additionnaly nine primers for sequences in the AAV Rep and Cap genes were designed.

41.Labortag 25.06.2010:

PCR of ITRs, Splitting HT1080 and AAV-293 cells, Seeding of HT1080 cells, Creating Virus Stock Economics, Medium check

Preparation for PCR of ITRs

Investigator: Bea

Digestion of pAAV_MCS (P9)

experiment date: 25.06.2010
plasmid: name: pAAV_MCS number: P9 production date: 08.05.2010 origin: SH
buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:113) NgoMIV ; Enzyme 2 (no.Lab:120) AlwNI
DNA concentration (vector): 267,9 ng/µL

In order to receive the best PCR-results, two digestion reactions/approaches have been performed.
The first digestion was cut only with AlwNI, the second digestion was cut with AlwNI and NgomIV.

components	v(pAAV_MCS 1) /µl	v(pAAV_MCS 2) /µl
DNA	4	4
BSA (100x)	none	none
Buffer 4 (10x)	2	2
Enzyme AlwNI (no.Lab: 120)	1	1
Enzyme NgoMIV (no.Lab:113)	none	1
H₂O	13,0	12,0
Total volume (e.g. 15,20,25,30 µl)	20	20

Incubation:1,5h

1% agarose gel has been prepared. Running the gel at 110 V for 45 minutes.

Loading plan: Marker (8 µL), pAAV_MCS 1 (24 µL), paav_MCS 2 (24 µL)

Splitting of HT1080 and AAV-293 cells, Seeding of HT1080 cells

Investigator: Hanna

HT1080:

Cells showed 80 % confluence
Cells were washed with PBS, detached with Trypsine
10 mL DMEM was added, cell suspension was centrifuged for 5 minutes at 200 g.
Supernatant was discarded, pellet was resuspended with 8 mL DMEM.
Cells were counted: 47.5 µL Trypan blue (stains dead cells) and 2.5 µL cell suspension were mixed and applied onto a Neubauer counting chamber -> 2.2 x 20 x 10^-4 cells per mL
Therefore 27 µL of the cellsuspension was added to each 3 mL DMEM in the 6-well plates. -> 2 6-well plates were prepared for transduction!
Further on cells were splitted: 110 µL cell suspension was pipetted into 2 75T flasks each containing 20 mL DMEM and stored in the 37°C incubator.

AAV-293 cells:

Cells showed ~ 50% confluence
Cells were splitted following the standard protocol.

Creating Virus Stock Economics

Investigator: Adrian

Medium check

Investigator: Adrian

three little culture bottles got prepared (H-DMEM, DMEM and PBS) and set into the incubator. In the following days they'll get checked for bacerial growth.

Sequencing results of pAAV_RFC25

Investigators: Adrian, Bea, Hanna

SpeI restriction site deletion in sequenced data (on bottom).

sequenced sample: pAAV_RFC25 clone 2 (P43)

used primer: GATC_std_pTeSp-1.ab1
The alignment with the theoretical construct showed, that there's a exchange of one base in the RFC25-multiple cloning site. This substitution leads to the deletion of the SpeI restriction site.
Therefore we checked the order sheet (everything OK!).
We sent the second clone (P42) for sequencing (Hanna).

V(Plasmid) = 6.5 µL
V(H₂O) = 23.5 µL
Primer: pTESP-1

Annotation and studies of the AAV structure

Investigator: Volker

The NGR- and the HPSG motif were annotated in the gene sequences according to [Michelfelder & Trepe; 2009] The pdb sequence were visualized with the programm [http://www.pymol.org| PyMOL] and the important motifs were highlighted.

Impressions from PyMOL

The viral structure of AAV-2.

Sturcture of a single AAV-2 VP2 monomer

B-Factor indicating mobility in the crystal

HPSG-binding-motif

Residues of the HPSG-binding-motif

The NGR-motif that is responsible for the integrin a5β1 binding

42.Labortag 26.06.2010

Transduction of HT1080 cells

Investigator: Adrian

Transduction of 2x6 wells was successfully done (14.25)
one six well is transduced with 10µg the other with 30µg DNA amount (see HEK293 infection protokoll for further information)

(A is up)

stock solution	1:10 Dilution	1:50 Dilution
1:100 Dilution	1:500 Dilution	control (500µl DMEM)

the delution steps (1:10, 1:50, 1:100, 1:500) are placed upon the virus stocks in the -80°C freezer in 15 ml falcons.

Did primers for sequencing GOI arrive?

Paper reading session

Investigators: Igor, Anna, Patrick, Stefan and Volker
Several papers were read and infomation on cap-modifications were extracted.

Trasitions of seven Tyrosines (252, 272, 444, 500, 700, 704 and 730) to Phenylalanines as described in [Zhong et al. 2008]
Transitions of two amino acids (R459D and N551D) leading to reduced sero prevalence as described in [Inchan Kwonand, David V. Schaffer]‎

Proposed transitions Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F in red & R459D and N551D in green

43.Labortag 28.06.2010:

Checking HT1080 for YFP-Expression, Creating plan: urgent things to do

Investigator: Sven, Patrick, Adrian

Checking HT1080 for YFP-Expression

Hannas 2*6 wells (24.6) transduced by (Adrian 25.6)

Results of transduction nr.2
10µg_unverd_2_(c1).JPG 48h post transduction	10µg_unverd_1_(c1).JPG 48h post transduction
30µg_unverd_2_(c1).JPG 48h post transduction	30µg_unverd_(c1).JPG 48h post transduction
30µg_unverd_4_(c1).JPG 48h post transduction	30µg unverd 3 (c1).JPG 48h post transduction
30µg_unverd_6_(c1).JPG 48h post transduction	30µg_unverd_5_(c1).JPG 48h post transduction

The transduced cells will be checked again (29.6.).

Sequencing results of P42

Investigator: Hanna

Sequencing of pAAV_RFC25 (P42):

Sequencing delivered, that there weren't any base exchanges or deletions in this clone. Therefore P43 was dismissed (Plasmid and glycerol stock).

Theoretical construction of our biobricks

Investigators: Hanna, Adrian, Chris W, Patrick, Volker Theoretical cloning

Urgent Things to do:

Modification CAP:
- HSPG -> 2 AS
- Targeting (585,588...) -> 2 AS -> 1 or 2 restriction sites?! Investigator: Volker
- Seroprevalence -> 2 AS
- thyrosine for ubiquitination Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F
- Primer: start codons
- EGF-Rezeptor: A431-Zellinie
  - Affibody: order the Gensequence
  - bispecific AK -> order Diabodys (are there any restriction sites?) Investigator: kristian???

Ordering the ITRs Investigator: Hanna
- Stratagene: right and left
- wild-type

Modification: REP Investigator: Volker
- 3 restriction sites -> site directed mutagenisis vs. synthetic? ->order (check which is the cheaper approach)

HGH Investigator: Hanna
- restriction sites? -> are there any available biobricks?
- biobrick production

Beta-globin: what is the function? -> cut out?
- where is the start and the end?
- restriction sites?
- biobrick production

GMK-TK
- restriction sites: primer
- biobrick production
- ordering the SR39

tumor specific promotors
- more Information!!!
- telomerase specific promoters!!!

Continuation of ITR PCR

Investigators: Hanna, Chris W., Adrian

Analytic gel was run: 1.7 µL loading dye (6x) was added to 8.3 µL of each sample (left ITR: 5 µL DMSO + 10 µL DMSO; right ITR: 5 µL DMSO + 10 µL DMSO).
110 V, 35 minutes
No ITr bands were detectable - just 2 weak "primer-bands"

Conclusion: PCR didn't work. Because of that new primers were designed and ordered (Achim), which are longer and posses therefore higher annealing temperatures.

ITRs (theoretical)

Investigators:Adrian, Achim, Hanna

trs sequences (GTTGG) are present in both ITRs (Stratagene)!
assumption: transcription despite of ITR-secondary structure - no single-strand nick at trs-sequence in transduced cells ?

44.Labortag 29.06.2010:

Discussionround

Affibodys
- Investigator: Anna
  - Affibodys are 6-7kD Proteins derived from Protein A/Z
  - they are binding to domain 3 from IGFR
  - 13 AS are replaceable for changing the tropism

Tyrosine Mutants
- Investigator: Adrian
  - replacements are done in VP3! => Volker?!
  - no multi-mutants are available (instead of single mutations many Y->F)
  - best candidates are: Y730F and Y444F.

Second strand DNA-synthesis in transduced cells
- Investigator: Achim
  - Second strand synthesis is the main limiting for transduction/transgen expression.

Seeding HT-cells for transfection and titering

Investigators: Sven, Adrian, Bea

The pellet was resolved in 4ml we had a 550.000 cells/ml
2x6 well dishes got prepared:

1. Plate I(A is up)

3x10^5 cells	3x10^5 cells	3x10^5 cells
3x10^5 cells	3x10^5 cells	3x10^5 cells

2. Plate II (A is up)

about 3x10^5 cells	only medium	only medium
about 3x10^5 cells	only medium	only medium

Seeding HT1080-cells for transduction and qPCR

Investigator: Hanna

Cell density was determined with trypan blue and counting chamber: 2 x 20 x 10^4 cells/mL
wanted: 5 x 10^4 cells --> 125 µL cell suspension per well
Cells were seeded into a 24-well-plate (row C and D!): 1.5 mL DMEM + 125 µL cell suspension per well
cells were incubated for 1 hour at 37°C

Further on, cells were splitted: ~ 3 mL cell suspension was added to ~ 17 mL DMEM

Transduction of HT1080 cells for qPCR

Investigator: Chris W.

45.Labortag 30.06.2010:

Titering Procedure via qPCR, Transduction of 6well plates no.4

Harvesting cells for qPCR

Investigators: Chris W, Hanna
Transduced HT1080 cells were harvested following Sven's standard protocol.

Transduction of 2 x 6well plates nr.4

Investigators: Bea, Adrian

Master plan: Different Transduction Mechanisms
- rise the amount of transduced particels, instead of 500µl, 1000µl of the AAV-stock getting pipetted into each well.
- the second plate gets stimulated via UV-light to boost the expression of DNA-Repair mechanisms. This should enhance the second strand synthesis of our ssDNA-GOI => a rise of YFP Expression!

1. Plate I(A is up)

3x10^5 cells	3x10^5 cells	3x10^5 cells
3x10^5 cells	3x10^5 cells	3x10^5 cells

Transduction:

1000 µl of Viral Stock DROPPED	1000 µl of Viral Stock gently resuspended	1500 µl of Viral Stock hard resuspending
1000 µl of Viral Stock DROPPED	1000 µl of Viral Stock gently resuspended	no Transduction

2. Plate II (A is up)

about 3x10^5 cells	only medium	only medium
about 3x10^5 cells	only medium	only medium

Transduction:

1500 µl of Viral Stock gently resuspended	no Transduction	no Transduction
1500 µl of Viral Stock gently resuspended	no Transduction	no Transduction

beta-globin intron

Investigators: Adrian, Bea
We found some interesting literature which points out that introns have an influence on the eucaryotic gene expression on DNA and RNA level. Next steps are going to be the designing of the beta-globin intron and maybe further analysis of the other mentioned introns. Maybe two or three more introns can be ordered.
Media:Freiburg10_LeHir_et_al_How_introns_influence_and_enhance_eukaryotic_gene_expression_2003.pdf
Media:Freiburg10_Noe_et_al_An_intron_is_required_dro_dihydrofolate_reductase_protein_stability_2008.pdf
Media:Freiburg10_Mashadrizeh_et_al_A_systematic_study_of_the_function_of_the_human_beta-globin_introns_on_the_expression_of_the_human_coagulation_factor_in_cultured_Chinese_hamster_ovary_cells_2009.pdf‎

Media:Chicken_beta-globin_insulator_overcomes_variegation_of_transgenes_in_Xenopus_embryos.pdf‎

hGH sequence

Investigator: Hanna

orientation in pAAV_MCS is reverse annotated, but in the same orientation as in human growth hormone I gene!
Blast and alignment with other expression vectors and the human growth hormone I revealed that Stratagene annotated 1 bp too much
"A common feature of mRNA in higher eukaryotes (but not in yeast) is the presence of the highly conserved sequence AAUAAA in the region from 11-30 nucleotides upstream of the site of poly(A) addition. (...) The signal is needed for both cleavage and polyadenylation." (Genes VIII, Lewin, P. 720)
good news: There're no iGEM restriction sites in the sequence (RFC25)
Conclusion: Instead of ordering the whole sequenc in iGEM standard it would be probably easier (and cheaper) to perform a PCR.
Done: Oligos were designed for PCR!

ITRs: new strategy

Investigator: Hanna
Plan:

Digest pAAV_MCS with AlwNI. Result: one large fragment containing the left ITR + a small fragment containing right ITR.
Digest both fragments with NotI and PstI.
Hybridize oligos containing RFC10 restriction sites (designed by Hanna), ligate them via intermediate steps (ligating into a vector) with ITRs . Comment: One oligo posseses a blunt end - therefore "intermediate step-vector" needs to be digested with an enzyme producing a blunt site.
Done: Oligos were designed. Need to be checked!

Sequencing of pAAV_iGEM-mVenus-YFP

Investigators: Hanna, Chris W.

3 µL of O28, 29 and 30 each were mixed with 27 µL water -> primer fpr sequencing of GOI and of hGH sequence
11.1 µL plasmid + 18.9 µL H₂O

Investigation of the Kleinschmidt sequencing

Investigator: Volker

The CMV promoter sequence was found in front of the expression constructs of VP2 and VP3

The sequencing of den unknown backbone pKEX revealed that the construct VP1ex from the DKFZ seemed not to contain a regulatory region for the expresion of the VP1 ORF, but in the backbonesequence there were some standard primers from GATC that could be used to sequence the insert of all expression constructs.

This sequencing was done at the 26.06.2010. The read into the construct VP1 showed a long homologous region with the ORF of VP1 where as the sequencing of VP2ex and VP3ex did not show a homologous region with the ORFs of VP2 and VP3.

The test weather primers of GATC bind to the unknown region gave a positive hit in both constructs with the primer GATC_std_CMV_f. This primer is specific for the sequence of the CMV promoter. After this indice the sequences VM_2 26.06. -pBR1.ab1 and VM_3 26.06. -pBR1.ab1 were aligned with the sequence of the CMV promoter provieded in the stratagene kit in the plasmid pAAV-MCS. The majority of the sequence fitted well with CMV promoter as indicated in the image in purple. At the 5' end of the CMV promoter there were some missmatches in the alignment indicated in yellow.

The fact that VP2ex and VP3ex contained a CMV promoter element which was not included in VP1ex was unexpected. The sequencing with the standard primer GATC_std_CMV_f which binds at the 3' end of the CMV promoter and will probably sequence the ORF of VP2ex and VP3ex was ordered.

=> Go to Labjournal July (labday 46 - 75)

@@ Line 1: / Line 1: @@
+{{:Team:Freiburg_Bioware/css}}
+{{:Team:Freiburg_Bioware/Head}}
+{{:Team:Freiburg_Bioware/menu_notebook}}
+{{:Team:Freiburg_Bioware/jquery}}
 <!-- Freiburg_bioware -->
+[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook => Back to Notebook overview]<br><br>
 <html>
-<!-- Stylesheed -->
-<style>
-#content {
-width: 965px;
-/*background-color: #3300ee;*/
-}
-#banner_top {
-opacity: 1;
-width: 965px;
-height: 200px;
-margin: 0px 0px 0px 0px;
-}
-/*Menu and the corresponding buttons*/
-#menu {
-width: 900px;
-margin: 30px 0px 30px 0px;
-}
-div.menu_button {
-float: left;
-width: 110px;
-}
-div.menu_button a {
-font-weight: bold;
-font-size: 12px;
-/*border: 1px solid black;*/
-text-decoration: none;
-color: #555555;
-background: transparent url(http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/7/7e/Freiburg10_Buttongrau100.png) no-repeat scroll center center;
-}
-div.menu_button a:hover {
-/*color: #999999;*/
-background: transparent url(http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/9/99/Freiburg10_Buttongruen100.png) no-repeat scroll center center;
-}
-#BHome a {
-padding: 20px 35px 20px 35px;
-margin: 10px 2px 10px 2px;
-}
-#BTeam a {
-padding: 20px 35px 20px 35px;
-margin: 10px 2px 10px 2px;
-}
-#BProject a {
-padding: 20px 30px 20px 30px;
-margin: 10px 2px 10px 2px;
-}
-#BBioBricks a {
-padding: 20px 15px 20px 15px;
-margin: 10px 2px 10px 2px;
-}
-#BNote a {
-padding: 20px 22px 20px 21px;
-margin: 10px 2px 10px 2px;
-}
-#BSponsors a {
-padding: 20px 24px 20px 22px;
-margin: 10px 2px 10px 2px;
-}
-#BSafety a {
-padding: 20px 32px 20px 32px;
-margin: 10px 2px 10px 2px;
-}
-#BModelling a {
-padding: 20px 24px 20px 24px;
-margin: 10px 2px 10px 2px;
-}
-/* Main area */
-div.overall {
-width: 965px;
-margin: 30px 0px 0px 0px;
-}
-#subMenu {
-width: 165px;
-height: 600px;
-float: left;
-margin: 40px 10px 0px 0px;
-border: 1px solid black;
-}
-div.box_right {
-width: 780px;
-height: auto;
-float: left;
-margin: 40px 0px 0px 0px;
-/*border: 1px solid black;*/
-}
-</style>
-<!-- Start stuff you see -->
-<!-- Banner -->
-<img src="http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/3/31/Freiburg10_Header_wiki.png" alt="banner" id="banner_top"/>
-<!-- Menu -->
-<center>
-<div id="menu">
-<div class="menu_button" id="BHome"><a href="https://2010.igem.org/Team:Freiburg_Bioware" target="blank">Home</a></div>
-<div class="menu_button" id="BTeam"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Team" target="blank">Team</a></div>
-<div class="menu_button" id="BProject"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project" target="blank">Project</a></div>
-<div class="menu_button" id="BBioBricks"><a href="https://2010.igem.org/Team:Freiburg_Bioware/BioBricks" target="blank">BioBricks &trade;</a></div>
-<div class="menu_button" id="BNote"><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook" target="blank">Note Book</a></div>
-<div class="menu_button" id="BSponsors"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Sponsors" target="blank">Sponsors</a></div>
-<div class="menu_button" id="BSafety"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Safty" target="blank">Safety</a></div>
-<div class="menu_button"id="BModelling"><a href="https://2010.igem.org/Team:Freiburg_Bioware/Modelling" target="blank">Modelling</a></div>
-</div>
-</center>
-<!-- Main area -->
-<div id="subMenu">
-</div>
 <div class="box_right">
+<left><u1>NoteBook Navigator</u1></left>
+<br>
 <ul>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/March">March</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/March">March (labday 1)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/April">April</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/April">April (labday 2 - 5)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/May">May</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/May">May (labday 6 - 17)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June">June</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June">June (labday 18 - 45)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July">July</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July">July (labday 46 - 75)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August">August</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August">August part 1 (labday 76 - 92)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September">September</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August2">August part 2 (labday 93 - 106)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October">October</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September">September part 1 (labday 107 - 123)</a></li>
-<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/November">November</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September2">September part 2 (labday 124 - 135)</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October">October part 1 (labday 136 - 149 )</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October2">October part 2 (labday 150 - 166 )</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/November">November  (labday 167 - 170 )</a></li>
+<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/Cellculture">Cellculture</a></li>
 </ul>
+</div>
 </html>
 ==== <p style="font-size:17px; background-color:#00dd77;">18. Labortag 01.06.2010:</p>  ====
 =====<p style="font-size:15px; background-color:#66bbff;">Modifying MCS of pAAV_MCS vector</p>=====
-<br>
+<p><b>Investigators: Anissa, Adrian, Bea, Chris W., Hanna, Patrick, Volker, Sven </b></p>
-Investigators: Anissa, Adrian, Bea, Chris W., Hanna, Patrick, Volker, Sven <br>
 '''Oligos received from Sigma-Aldrich''' <br>
 (right ITR of pAAV_MCS, left ITR of pAAV_MCS and MCS RFC25 for pAAV)
@@ Line 230: / Line 122: @@
 ==== <p style="font-size:17px; background-color:#00dd77;">19. Labortag 02.06.2010:</p>====
-=====<p style="font-size:17px; background-color:#66bbff;">Oligos (NotI)</p>=====
+=====<p style="font-size:17px; background-color:#66bbff;">Picking clones of pAAV_RFC25MCS</p>=====
+<p><b>Investigators: Adrian, Bea, Chris W., Hanna, Anissa</b></p>
-Investigators: Adrian, Bea, Chris W., Hanna, Anissa<br>
-<br>
 '''Practical work:''' <br>
 Control plate contained no clones. :)
 colonies were picked and grown @ 37°C over night.
 <br>
-'''Theoretical work:'''<br>
-Oligos for site directed mutagenesis of the NotI restriction sites in pAAV_MCS (ITRs) were designed:[[Image:Freiburg10 NotI ITR Oligos.pdf]]
+=====<p style="font-size:17px; background-color:#66bbff;">Design and ordering of Oligos (NotI)</p>=====
+<p><b>Investigators: Adrian, Bea, Chris W., Hanna, Anissa</b></p>
+Oligos for site directed mutagenesis of the NotI restriction sites in pAAV_MCS (ITRs) were designed: <br />
+[[Media:Freiburg10 NotI ITR Oligos.pdf]]
 <br>
-'''Sponsoring work:''' <br>
+=====<p style="font-size:15px; background-color:#66bbff;">Sponsoring work:</p>=====
 Sponsoring letter was adapted for Quiagen.
 ====<p style="font-size:17px; background-color:#00dd77;">20. Labortag 03.06.2010: </p>====
 =====<p style="font-size:15px; background-color:#66bbff;"> pAAV_RFC25_MCS -> problem</p>=====
+<p><b>Investigators: Anissa, Bea, Melanie, Christian L.</b></p>
-Investigators: Anissa, Bea, Melanie, Christian L.
-<br>
 '''Comment''': Continue with Mini-Prep and test digestion of pAAV_RFC25_MCS <br>
 Mini-Prep and test digestion have been performed: <br>
 <span style="color:red; font-weight:bold;">Problem</span>: Designed oligos (MCS_RFC25) for altering the MCS of the pAAV_MCS vector cannot be used. <br> Two startcodons are in the MCS.
-[[Image:Oligo RFC25 MCS.jpg|800px|thumb|left| Oligo MCS_RFC25: contains 2 Startcodons. the "wrong" Codon is the first ATG which results in peptide chain with 30 aa. The second ATG is the right ATG which is right before the Gene of Interest.]]
+[[Image:Oligo RFC25 MCS.jpg|thumb|center|800px| Oligo MCS_RFC25: contains 2 Startcodons. the "wrong" Codon is the first ATG which results in the peptide chain with 30 aa. The second ATG is the right ATG which is right before the Gene of Interest.]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
 <br>
 <br>
@@ Line 402: / Line 286: @@
 =====<p style="font-size:15px; background-color:66bbff;">Picking clones of Thymindinkinase of Amor</p>=====
-**5 clones of the XL-1 Blue colonies containing the plasmid '''pUB6/HV5/His6 with the thymidinkinase''' have been picked from LBamp-agarplates
+**5 clones of the XL-1 Blue colonies containing the plasmid '''pUB6/HV5/His6 with the thymidinkinase-guanylate fusion enzyme''' have been picked from LBamp-agarplates
 **1 clone of the XL-1 Blue colonies containing the plasmid '''pUB6/HV5/His6 without the thymidinkinase (control) has been picked from LBamp-agarplates
 **all clones have been inoculated in 10 mL LB containing 10 µL Amp. Incubation: 37°C over-night.
@@ Line 414: / Line 298: @@
 ====<p style="font-size:17px; background-color:#00dd77;">21. Labortag 04.06.2010: </p>====
 =====<p style="font-size:15px; background-color:#66bbff;">DKFZ plasmid Retrafos, TK/GMK Mini-Prep</p>=====
+<p><b>Investigators: Adrian, Bea, Chris W., Hanna</b></p>
-Investigators: Adrian, Bea, Chris W., Hanna<br>
 <p style="font-size:15px; font-weight: bold; color: green;"><u>DKFZ</u></p>
@@ Line 421: / Line 304: @@
 Plasmids received: <br>
-*'''pXX6''' alle Adenovirus Helfer Gene ohne AAV Gene; Plasmid von J. Samulski; evtl. Anfragen für Benutzererlaubnis
+*'''pXX6''' all Adenovirus helper genes without AAV genes
-*'''pKEX-2XL.Rep40''' Expressionsplasmide für das Rep Proteine 40
+*'''pKEX-2XL.Rep40''' expression plasmid for Rep protein 40
-*'''pKEX-2XL.Rep 52''' Expressionsplasmide für das Rep Proteine 52
+*'''pKEX-2XL.Rep 52''' expression plasmid for Rep protein 52
-*'''pKEX-2XL.Rep 68''' Expressionsplasmide für das Rep Proteine 68
+*'''pKEX-2XL.Rep 68''' expression plasmid for Rep protein 68
-*'''pKEX-2XL.Rep 78''' Expressionsplasmide für das Rep Proteine 78
+*'''pKEX-2XL.Rep 78''' expression plasmid for Rep protein 78
-*'''pCMV-VP(HS)''' Expressionsplasmid der drei VP Proteine in Kombination (assemly kompetent
+*'''pCMV-VP(HS)''' expression plasmid for VP proteins in combination (assemly competent)
-*'''pKEX-VP1''' Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
+*'''pKEX-VP1''' expression plasmid for single VP proteins (Cap: VP1, VP2 und VP3). Be careful: Single constructs are not assembly competent; Ruffing et al 1992; Steinbach et al. 1997;
-*'''pKEX-VP2'''Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
+*'''pKEX-VP2'''expression plasmid for single VP proteins (Cap: VP1, VP2 und VP3). Be careful: Single constructs are not assembly competent; Ruffing et al 1992; Steinbach et al. 1997;
-*'''pKEX-VP3'''Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
+*'''pKEX-VP3'''expression plasmid for single VP proteins (Cap: VP1, VP2 und VP3). Be careful: Single constructs are not assembly competent; Ruffing et al 1992; Steinbach et al. 1997;
-*'''pTRUF_CMV_eGFP'''Einzelstrang Vektor zur Expression von eGFP
+*'''pTRUF_CMV_eGFP'''single stranded vector for eGFP expression
-*'''dsAAV_CMV_eGFP'''"self complementary" Expressionsvektor von X. Xiao; evtl. anfragen wegen Benutzererlaubnis
+*'''dsAAV_CMV_eGFP'''"self complementary" expression vector from X. Xiao
-*'''pTAV2 (gesamtes AAV Genom im "blue script" Vektor)
+*'''pTAV2 (whole AAV genome in "blue script" vector)
-*'''pDG''' komplettes Helferplasmid zur Vektorherstellung; Grimm et al. 1998
+*'''pDG''' complete helper plasmid, nedded for vector production ; Grimm et al. 1998
 <br>
 *In order to obtain the DNA following steps have been performed:
@@ Line 487: / Line 370: @@
 <br>
-====<p style="font-size:17px; background-color:#00dd77;">22. Labortag 05.06.2010: Insertion of iGEM expression parts into pAAV_MCS</p>====
+====<p style="font-size:17px; background-color:#00dd77;">22. Labortag 05.06.2010: </p>====
+=====<p style="font-size:15px; background-color:#66bbff;">Insertion of iGEM expression parts into pAAV_MCS</p>=====
-Investigators: Adrian, Bea, Melanie, Hanna<br>
+<p><b>Investigators: Adrian, Bea, Melanie, Hanna</b></p>
-<br>
 <p style="font-size:15px; font-weight: bold; color: blue;">Hybridization:</p>
 *Hybridization of received oligos: iGEM expression parts (RFC25 without EcoRI, NotI)
@@ Line 609: / Line 491: @@
 ====<p style="font-size:17px; background-color:#00dd77;">23. Labortag 07.06.2010:</p>====
 =====<p style="font-size:15px; background-color:#66bbff;">Mini-Preps (Kleinschmidt-plasmids and pAAV_iGEM-MCS)</p>=====
-Investigators: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea
+<p><b>Investigators: Investigators: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea</b></p>
-<br>
 <p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>pAAV_iGEM-MCS</u></p>
 <p style="font-size:15px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
@@ Line 736: / Line 617: @@
 <br />
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Kleinschmidt-plasmids</u></p>
+=====<p style="font-size:15px; background-color:#66bbff;">Kleinschmidt-plasmids</p>=====
+'''Investigators: Kira, Achim, Jessy, Bea, Adrian, Hanna'''
 <p style="font-size:15px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
 *experiment date: 07.06.2010 ; time: 10 – 20 h
-*name of investigator: Kira, Achim, Jessy, Bea, Adrian, Hanna
 *Kleinschmidt-plasmids
 <br />
 <u>Glycerol Stocks</u>
 {| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Clone 6''' ||align="left"| '''Clone 7''' ||align="left"| '''Clone 8''' ||align="left"| '''Clone 9''' ||align="left"| '''Clone 10''' ||align="left"| '''Clone 11''' ||align="left"| '''Clone 12''' ||align="left"| '''Clone 13'''
+| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Clone 6''' ||align="left"| '''Clone 7''' ||align="left"| '''Clone 8''' ||align="left"| '''Clone 9'''
 |-
-| align="left" | '''Bacteria strain''' ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B
+| align="left" | '''Bacteria strain''' ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B
 |-
-| align="left" | '''Plasmidname''' ||align="left"| pXX6 ||align="left"| pKEX-2XL.Rep 40 ||align="left"| pKEX-2XL.Rep 52 ||align="left"| pKEX-2XL.Rep 68 ||align="left"| pKEX-2XL.Rep 78 ||align="left"| pCMV-VP(HS) ||align="left"| pKEX-VP1 ||align="left"| pKEX-VP2 ||align="left"| pKEX-VP3 ||align="left"| pTRUF_CMV_eGFP ||align="left"| dsAAV_CMV_eGFP ||align="left"| pTAV2||align="left"| pDG
+| align="left" | '''Plasmidname''' ||align="left"| pXX6 ||align="left"| pKEX-2XL.Rep 40 ||align="left"| pKEX-2XL.Rep 52 ||align="left"| pKEX-2XL.Rep 68 ||align="left"| pKEX-2XL.Rep 78 ||align="left"| pCMV-VP(HS) ||align="left"| pKEX-VP1 ||align="left"| pKEX-VP2 ||align="left"| pKEX-VP3
 |-
-| align="left" | '''Date''' ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010
+| align="left" | '''Date''' ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010
 |-
-| align="left" | '''given number''' ||align="left"| B14 ||align="left"| B15 ||align="left"| B16 ||align="left"| B17 ||align="left"| B18 ||align="left"| B19 ||align="left"| B20 ||align="left"| B21 ||align="left"| B22 ||align="left"| B23 ||align="left"| B24 ||align="left"| B25 ||align="left"| B26
+| align="left" | '''given number''' ||align="left"| B14 ||align="left"| B15 ||align="left"| B16 ||align="left"| B17 ||align="left"| B18 ||align="left"| B19 ||align="left"| B20 ||align="left"| B21 ||align="left"| B22
+|}
+{| border="1"
+| align="left" |  ||align="left"| '''Clone 10''' ||align="left"| '''Clone 11''' ||align="left"| '''Clone 12''' ||align="left"| '''Clone 13'''
+|-
+| align="left" | '''Bacteria strain''' ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B
+|-
+| align="left" | '''Plasmidname''' ||align="left"| pTRUF_CMV_eGFP ||align="left"| dsAAV_CMV_eGFP ||align="left"| pTAV2||align="left"| pDG
+|-
+| align="left" | '''Date''' ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010
+|-
+| align="left" | '''given number''' ||align="left"| B23 ||align="left"| B24 ||align="left"| B25 ||align="left"| B26
 |}
@@ Line 772: / Line 666: @@
 * Always check volumes - try to estimate if volume makes sense (check pipettes!)
 * Don't discard bacteria cultures until glycerol stocks and mini-preps are successfully done!!!
-<p style="font-size:20px; font-weight: bold; color: red;">'''Today's conclusion: Better ask 2 times than do something wrong without asking!!!'''</p>
+<p style="font-size:15px; font-weight: bold; color: red;">'''Today's conclusion: Better ask 2 times than do something wrong without asking!!!'''</p>
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)</u></p>
+=====<p style="font-size:15px; background-color:#66bbff;">Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)</p>=====
 <br>
 '''Quickchange site directed mutagenesis:'''
@@ Line 802: / Line 697: @@
 =====<p style="font-size:15px; background-color:#66bbff;"> Cloning of mVenus_YFP into pAAV_iGEM-MCS, continuation of site-directed mutagenesis</p>=====
-Investigators: Kira, Jessy, Hanna, Achim <br>
+<b>Investigators: Kira, Jessy, Hanna, Achim</b> <br>
 <br>
 <p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Analysis of iGEM-MCS sequence (RFC25 without EcoRI and NotI):</u></p> <br>
-[[Image:Freiburg10 iGEM-MCS.jpg|800x800px|]] <br>
+[[Image:Freiburg10 iGEM-MCS.jpg|thumb|center|800px]] <br>
-The alignment with the theoretical pAAV_iGEM-MCS delivered a "C-deletion" within the NgoMIV restriction site. Due to that the pAAV_iGEM-MCS lacks this site. We controlled the bill of delivery and noted that the deletion must be GATC's fault.
+The alignment with the theoretical pAAV_iGEM-MS delivered a "C-deletion" within the NgoMIV restriction site. Due to that the pAAV_iGEM-MCS lacks this site. We controlled the bill of delivery and noted that the deletion must be GATC's fault.
 All in all this doesn't matter, because parts which are in iGEM standard can be inserted and therefore they will deliver the lacking NgoMIV restriction site. Further on this could be an advantage because after digestion the fragment which is cut out can be better detected in the gel.
 <br>
@@ Line 890: / Line 785: @@
 </ul>
+=====<p style="font-size:15px; background-color:#66bbff;">Continuation of site-directed mutagenesis</p>=====
-=====<p style="font-size:15px; background-color:#66bbff;">continuation of site-directed mutagenesis</p>=====
 <p style="font-size:15px; font-weight: bold; color: blue;">Digestion with DpnI:</p>
 <li>0.5 µl DpnI added
@@ Line 907: / Line 800: @@
 ====<p style="font-size:17px; background-color:#00dd77;">25. Labortag 09.06.2010:</p>====
-=====<p style="font-size:15px; background-color:#66bbff;">pAAV_iGEM-MCS_mVenus-YFP, site-directed mutagenesis</p>=====
+=====<p style="font-size:15px; background-color:#66bbff;">pAAV_iGEM-MCS_mVenus-YFP, Site-directed mutagenesis</p>=====
-investigators: Jessy, Achim, Sven, Toby, Hanna
+<b>Investigators: Jessy, Achim, Sven, Toby, Hanna</b>
 <br>
-<p style="font-size:15px; font-weight: bold; color: red;">'''No pAAV_iGEM-MCS_w/oPstI transformed bacteria (site-directed mutagensis) grew on the ampicillin agar plates over night! '''</p> Experiment is conducted again by Toby (Thanks a lot!!!).<br>
+<p style="font-size:15px; font-weight: bold; color: red;">'''No pAAV_iGEM-MCS_w/oPstI transformed bacteria (site-directed mutagensis) grew on the ampicillin agar plates over night! '''</p> Experiment is conducted again, guided by Toby (Thanks a lot!!!).<br>
 <br>
-<p style="font-size:15px; font-weight: bold; color: red;">'''Further on the cloning of mVenus-YFP into pAAV_iGEM-MCS seemed to fail: '''</p> Only on the agar plate cotaining the bacteria transformed with the "vector_oben" ligation, which actually should be the "wrong" ligation (gelextraction of a band which contained fragments that were too large, see picture in lab journal), revealed colonies. Therefore this experiments is also conducted one more time by Sven (thanks also a lot!!!)<br>
+<p style="font-size:15px; font-weight: bold; color: red;">'''Further on the cloning of mVenus-YFP into pAAV_iGEM-MCS seemed to fail: '''</p> Only on the agar plate cotaining the bacteria transformed with the "vector_oben" ligation, which actually should be the "wrong" ligation (gelextraction of a band which contained fragments that were too large, see picture in lab journal), revealed colonies. Therefore this experiments is also conducted one more time, guided by Sven (thanks also a lot!!!)<br>
 <br>
 <p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Insertion of mVenus_YFP into pAAV_iGEM-MCS</u></p>
 *experiment date: 9.6.2010
-*name of investigator: Sven
 *plasmid:
 **Vector: name: pAAV_iGEM-MCS number: 34.2 production date: 5.6.2010
@@ Line 1,050: / Line 943: @@
 =====<p style="font-size:15px; background-color:#66bbff;">Picking of Clones from pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben</p>=====
+'''Investigator: Hanna, Achim'''
 *experiment date: 9.6.2010
-*name of investigator: Hanna, Achim
 *plasmid:
 **Vector: name: pAAV_iGEM-MCS_Vektor_oben
@@ Line 1,068: / Line 961: @@
 <br>
 ====<p style="font-size:15px; background-color:#66bbff;">Mini-Prep of pAAV_iGEM_Venus_YFP and test digestion</p>====
+<p><b>Investigators: Jessy, Achim</b></p>
 <p style="font-size:12px; font-weight: bold; color: blue;">2.1 Mini-Prep of pAAV_iGEM_mVenus_YFP</p><br>
 Title: '''pAAV_iGEM_mVenus_'''  <br>
-investigator: Jessy, Achim <br>
 <u>Glycerol Stocks</u>
 {| border="1"
@@ Line 1,151: / Line 1,044: @@
 ===<p style="font-size:17px; background-color:#00dd77;">27. Labortag 11.06.2010:</p>===
-====<p style="font-size:15px; background-color:#66bbff;">Site directed mutagenisis on 10.06.2010</p>====
+====<p style="font-size:15px; background-color:#66bbff;">Site directed mutagenisis of 10.06.2010</p>====
-'''transformation'''<br>
+'''Transformation'''<br>
-transformation was performed according to the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]]<br>
+Transformation was performed according to the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]]<br>
 Cells were plated on agar plates (2x 1:100; 2x pellet)containing ampicillin and stored over night at 37°C.
@@ Line 1,167: / Line 1,060: @@
 ===<p style="font-size:17px; background-color:#00dd77;">28. Labortag 12.06.2010:</p>===
-Kira <br>
+====<p style="font-size:15px; background-color:#66bbff;">Transformation plates stored in 4°C room</p>====
+'''Investigator: Kira''' <br>
 The plates were stored in the iGEM shelf @ 4 °C. Even if the transformation was not very successfull, some colonies can be picked and inoculated either tomorrow or on Monday.
 '''Note: Site-directed mutagenesis does not generate lots of intact plasmids, so few colonies are normal!! (Tobias)'''
@@ Line 1,173: / Line 1,067: @@
 ===<p style="font-size:17px; background-color:#00dd77;">29. Labortag 13.06.2010:</p>===
-Jessy, Patrick, Hanna <br>
+'''Investigators: Jessy, Patrick, Hanna''' <br>
 We weren't able to detect any colonies on the plates - just a few air bubbles :) To be entirely sure, we put them back into the 37°C room over night.
 <br>
 ===<p style="font-size:17px; background-color:#00dd77;">30. Labortag 14.06.2010:</p>===
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>pAAV_iGEM-mVenus-YFP:</u></p>
+<p style="font-size:13px; font-weight: bold; color: fuchsia;"><u>pAAV_iGEM-mVenus-YFP:</u></p>
 The sequencing data of pAAV_iGEM_mVenus-YFP was analyzed. The alignment with the "theoretical" pAAV_iGEM_mVenus-YFP showed that we successfully inserted mVenus-YFP into pAAV_iGEM-MCS.
-[[Image:Freiburg10 mVenus-Alignment.jpg|800x800px|]]
+[[Image:Freiburg10 mVenus-Alignment.jpg|thumb|center|800px]]
 <br>
@@ Line 1,188: / Line 1,082: @@
 ====<p style="font-size:15px; background-color:#66bbff;"><u>TK-GMK-Plasmid</u></p>====
-Adrian, Hanna <br>
+<b>Investigators: Adrian, Hanna </b>
+<br>
 puB6_V5_His6_clone1 + TK/GMK (P15) will be sequenced again: <br>
 * name: AF 1
@@ Line 1,198: / Line 1,093: @@
 <br>
-====<p style="font-size:15px; background-color:#66bbff;"><u>Cell culture</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Cell culture</p>====
 AAV 293 and HT1080 Cells have been splitted and plated out on 10 cm dishes for transfektion.
 The Cells were accounted by using the Neubauer-Meteringchamber.
@@ Line 1,215: / Line 1,110: @@
 ===<p style="font-size:17px; background-color:#00dd77;">31. Labortag 15.06.2010:</p>===
-Adrian, Achim, Chris W., Hanna
+====<p style="font-size:15px; background-color:#66bbff;">Solutions for transfection were prepared</p>====
+<b>Investigators: Adrian, Achim, Chris W., Hanna</b>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Solutions for transfection were prepared:</u></p>
 * 1 x TE-Buffer: 1.2114 g TRIS, 0.2 mL EDTA, 81 mL milipore-H<sub>2</sub>O were mixed. pH was adjusted with HCl (1M and 5M) to 7.50. Volume was adjusted to 100 mL with milipore-H<sub>2</sub>O. Solution was autoclaved (sterilization by filtration is also possible). <br>
 * 1 M CaCl2: 147.02 g CaCl2 x 2H<sub>2</sub>O (M = 147.02 g/mol) was solved in 1 Liter H<sub>2</sub>O and sterilized by filtration.<br>
@@ Line 1,225: / Line 1,120: @@
 ===<p style="font-size:17px; background-color:#00dd77;">32. Labortag 16.06.2010:</p>===
-====<p style="font-size:15px; background-color:#66bbff;"><u>Sponsoring:</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Sponsoring:</p>====
-Anna, Kerstin, Anissa<br>
+<b>Investigators: Anna, Kerstin, Anissa</b><br>
 Sponsoring letters were examined and modified one more time. <br>
 <br>
-====<p style="font-size:15px; background-color:#66bbff;"><u>Sequencing of TK-GMK:</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Sequencing of TK-GMK:</p>====
-Hanna<br>
+<b>Investigator: Hanna</b> <br>
 Two primers were designed and ordered from Sigma-Aldrich. Probably we will receive them on Friday.<br>
 <br>
-====<p style="font-size:15px; background-color:#66bbff;"><u>Mega primer PCR:</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Mega primer PCR:</p>====
-Bea, Hanna <br>
+<b>Investigators: Bea, Hanna </b><br>
 <br>
-[[Image:Freiburg10 ITRprimer.jpg]]
+[[Image:Freiburg10 ITRprimer.jpg|thumb|center|500px]]
 ===<p style="font-size:17px; background-color:#00dd77;">33. Labortag 17.06.2010:</p>===
 ====<p style="font-size:15px; background-color:#66bbff;">Primer designing: VP1 primer for pKEX forward/reverse </p>====
-Investigator: Volker<br>
+<b>Investigator: Volker</b><br>
 The construnts that we receieved from PD Dr. Kleinschmidt (DKFZ) are mainly in the pKEX backbone. The sequences of the backbone and the inserts are not availible, for this reason we decided to sequence the constructs. The first step is to sequence from one construct into the backbone. In the second step we will designe primers that bind in the backbone and point into the direction of the insert.
 These primers will then be used to sequence the inserts of all the constructs.<br>
@@ Line 1,256: / Line 1,151: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Primer designing: CMV_forward/reverse_qPCR</p>====
-Investigator: Volker<br>
+<b>Investigator: Volker</b><br>
 Primers for the titering of the CMV region from the literature [Rohr et al., 2002] and [Rohr et al., 2005] were compared and analysed.
 The sequences from 2002 showed a differce in one nucleotide compared to the other primer and to our sequence. For this reason the second set [Rohr et al., 2005] was ordered.<br>
@@ Line 1,263: / Line 1,158: @@
 *CMV_reverse_qPCR: 5' - GGCGGAGTTGTTACGACA - 3'
-[[Image:Freiburg10_Binding of the CMV_qPCR primer in the vector plasmid.jpg|900px|left|thumb|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]<br>
+[[Image:Freiburg10_Binding of the CMV_qPCR primer in the vector plasmid.jpg|800px|center|thumb|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]<br>
 <p style="clear:both;">These primers will be used in a quantitative PCR assay with Sybr-green to measure the genomic titer and the infectious titer of the viral particles we will produce in the future.</p>
 ====<p style="font-size:15px; background-color:#66bbff;">Ordering of required reagents: </p>====
-Investigator: Volker<br>
+<b>Investigator: Volker</b><br>
 *Nuclease S1 was ordered from Promega (10000Units for 36,00€)
@@ Line 1,279: / Line 1,174: @@
 <br>
-'''investigators:''' Chris W., Hanna, Patrick, Adrian, Volker<br>
+'''Investigators: Chris W., Hanna, Patrick, Adrian, Volker'''<br>
 Transfections with the following plasmids:
@@ Line 1,306: / Line 1,201: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Theoretical: Digestion of pAAV_MCS for PCR to design ITR BioBrick</p>====
-'''investigator''': Bea <br />
+<b>Investigator: Bea</b><br>
-'''idea:'''
+'''Idea:'''
 <ul>
 <li>Digest vector in order to obtain two fragments which contain the left and the right ITR respectively. </li>
@@ Line 1,318: / Line 1,213: @@
 '''Theoretical:''' Digestion of pAAV_MCS with AlwNI produces two fragments which can be separated by agaorse gel.
 <br>
-[[Image:Freiburg10 pAAV MCS fragments cut with AlwNI preparation for PCR.jpg|900px|thumb|left|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]
+[[Image:Freiburg10 pAAV MCS fragments cut with AlwNI preparation for PCR.jpg|800px|thumb|center|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
 <br>
 <br>
@@ Line 1,337: / Line 1,225: @@
 *The Cap
-===<p style="font-size:17px; background-color:#00dd77;">36.Labortag 20.06.2010: Picking clones of sequenced pAAV_igEM_mVenus_YFP</p>===
+===<p style="font-size:17px; background-color:#00dd77;">36.Labortag 20.06.2010: </p>===
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones of sequenced pAAV_igEM_mVenus_YFP</p>====
 '''Investigators: Bea and Chris W'''
 <ul>
@@ Line 1,345: / Line 1,234: @@
 </ul>
-===<p style="font-size:17px; background-color:#00dd77;">37.Labortag 21.06.2010: Second Transfection, Transduction</p>===
+===<p style="font-size:17px; background-color:#00dd77;">37.Labortag 21.06.2010: </p>===
+====<p style="font-size:15px; background-color:#66bbff;">Second Transfection, Transduction</p>====
+<b>Investigators: Patrick, Johannes</b>
+<br/>
 x HBS was steril filtrated into two 50 ml flacons. The falcons were put into the cellculture fridge.
@@ Line 1,363: / Line 1,254: @@
 *5 ml 100x NaPyruvat
-Investigators: Patrick, Johannes
-<p style="font-size:15px; font-weight: bold; color: fuchsia;">Feching dry ice for the experiments </p>
-Volker
+====<p style="font-size:15px; background-color:#66bbff;">Feching dry ice for the experiments </p>====
+<b>Investigators:Volker</b>
 Dry ice can be fetched from the department for macromolecular chemistry. The chemical depot is located in the second basement. The dry ice can be retrieved from monday to friday from 11:00 to 11:30 and from 14:15 to 14:30. The requestforms for this institute can be found in the iGEM folder and should be filled out, signed by an advisor and taken to the chemical depot. A styrofoam container is required for the transport.<br>
 ====<p style="font-size:15px; background-color:#66bbff;">Annotation of the BRs and the PLA2 domains </p>====
-Volker<br>
+<b>Investigator:Volker</b><br>
 The Bacis Regions which are important for the nuclear localisation were annotated in the protein sequences of VP 1-3 according to:
 [[Media:Freiburg10_Separate basic region motifs within the adeno-associated virus capsid proteins are essential for infectivity and assembly.pdf|[Grieger et al, 2006]]]<br>
 ====<p style="font-size:15px; background-color:#66bbff;">Endotoxin-free Midi-Prep of pAAV_iGEM_mVenus-YFP </p>====
-Chris W., Hanna (guided by Sven) <br>
+<b>Investigators: Chris W., Hanna (guided by Sven)</b> <br>
-Midi-Prep was performed following standard protocol: [[Image:Freiburg10 Endotoxinfreie Midi.pdf]] <br>
+Midi-Prep was performed following standard protocol: [[Image:Freiburg10 Endotoxinfreie Midi.pdf|thumb|center|]] <br>
 DNA concenration was measured: 507 ng/µL <br>
 Plasmid was further used for a... <br>
 ====<p style="font-size:15px; background-color:#66bbff;">Second Transfection</p>====
+<b>Investigators: Patrick, Johannes</b><br />
 Six transfections were performed according to the standart protocol: [[Media:Freiburg10_Transfection_protocoll.pdf]]<br>
 Three 10 cm cellcluture dishes with 293 cells were transfected with 10 µg DNA (3,33 µg each plasmid) and the other three 10 cm cellculture dishes with 30 µg DNA (10 µg DNA each plasmid).
@@ Line 1,390: / Line 1,283: @@
 * pHelper , 280 ng/µl
-Investigators: Patrick, Johannes
 ====<p style="font-size:15px; background-color:#66bbff;">Preparing Viral Stocks</p>====
+<b>Investigators: Patrick, Johannes</b> <br />
 According to the standard protocol (see AAV Helper-free System manual). No dilution was performed.
-Investigators: Johannes, Patrick
 ====<p style="font-size:15px; background-color:#66bbff;">HT1080 Transduction</p>====
+<b>Investigators: Patrick, Johannes</b>
 Four 10 cm cellculture dishes with HT1080 cells have been provided for the transduction.
 *1 ml of the AAV-2-mVenus (derived from P 39) was pipeted to into dish 1. Note: the virus solution (buffer) showed a yellow coloration.
@@ Line 1,408: / Line 1,301: @@
 Apart from the dilution, the transduction was performed according to the standart protocol.
-Investigators: Johannes, Patrick
 ===<p style="font-size:17px; background-color:#00dd77;">38.Labortag 22.06.2010:</p>===
 ====<p style="font-size:15px; background-color:#66bbff;"> Midiprep of pHelper plasmid; cloning of the rfc25 MCS</p>====
-Investigators: Bea, Chris W, Adrian, Achim
+<b>Investigators: Bea, Chris W, Adrian, Achim</b>
 *Hybridisation of o'''ligos RFC25 EcoR1+BglII for & RFC25 EcoR1+BglII rev'''
@@ Line 1,472: / Line 1,364: @@
 ===<p style="font-size:17px; background-color:#00dd77;">39.Labortag 23.06.2010:</p>===
-===<p style="font-size:15px; background-color:#66bbff;"> Preparation of Viral Stock, Seeding cells</p>===
+====<p style="font-size:15px; background-color:#66bbff;"> Preparation of Viral Stock, Seeding cells</p>====
 ====<p style="font-size:15px; background-color:#66bbff;">Design of Primer</p>====
-Achim, Hanna
+<b>Investigators: Achim, Hanna</b>
-In order to sequence the hGH (polyadenylation) sequence and in general the GOI (gene of interest :) ) primer were designed: [[Image:Primer GOI+polyA pAAV iGEM-MCS mVenus YFP.pdf]]
+In order to sequence the hGH (polyadenylation) sequence and in general the GOI (gene of interest :) ) primers were designed: [[Media:Primer GOI+polyA pAAV iGEM-MCS mVenus YFP.pdf]]
 <br>
 These primer will be used in order to sequence P38 (pAAV_iGEM_mVenus-YFP) which delivered fluorescencing HT1080 cells - in comparison to the already sequenced P39 clone. Further on they can be used in general for sequencing any GOI. <br>
@@ Line 1,486: / Line 1,378: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Sequencing of pKEX-VP1</p>====
-Achim, Hanna, Adrian, Chris W.
+<b>Investigators: Achim, Hanna, Adrian, Chris W.</b>
 <br>
 Primer:
@@ Line 1,497: / Line 1,389: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Thaw HT1080 and AAV-293 cells </p>====
-Achim, Hanna (guided by Sven)<br>
+<b> Investigators: Achim, Hanna (guided by Sven)</b><br>
 Thawing of HT1080 and AAV-293 cells was performed following this protocol: [[Media:Freiburg10 Thawing cells.pdf]]
 <br>
-====<p style="font-size:15px; background-color:#66bbff;">Picking clones of pAAV_RFC25 and inoculating 250 mL DYT with pAAV_iGEM_mVenus-YFP (P38) for Midi-Prep </p>====
+====<p style="font-size:15px; background-color:#66bbff;">Picking clones of pAAV_RFC25</p>====
-Achim, Chris W., Hanna<br>
+<b>Investigators: Achim, Chris W., Hanna</b><br>
-Bacteria cultures are stored in 37°C room over night.
+Clones were picked, 250 mL DYT were inoculated.<br/>
+Bacteria cultures are stored at 37°C over night.
 <br>
-Adrian, Sven
+====<p style="font-size:15px; background-color:#66bbff;"> Transduction results </p>====
-<gallery widths=500px heights=300px perrow=2 caption="Results of transduction, ~ 1% of the HT1080 showed expression of mVenus.">
+<b>Investigators: Adrian (guided by Sven)</b>
+<gallery widths=400px heights=200px perrow=2 caption="Results of transduction, ~ 1% of the HT1080 showed expression of mVenus.">
 Image:YFP-Transduction-1.jpg|Bright light image 1
 Image:YFP-Transduction-2.jpg|Fluoresce microscopy image 1
@@ Line 1,513: / Line 1,407: @@
 Image:YFP-Transduction-4.jpg|Fluoresce microscopy image 1
 </gallery>
+<br />
 ====<p style="font-size:15px; background-color:#66bbff;">Preparation of viral stocks</p>====
-Investigator: Johannes, Bea
+<b>Investigator: Johannes, Bea</b>
 <br>
@@ Line 1,532: / Line 1,425: @@
 Benzonase (will be used fur viral stock preparation)
 <br>
-Primer for for ITR-Conversion to iGEM-Standart
+Primer for for ITR-conversion to iGEM-standars
-*Presentations of Adrian and Patrick: [[Image:Adrian.ppt]] [[Image:Patrick.ppt‎]]
+*Presentations of Adrian and Patrick: [[Media:Adrian.ppt]] [[Media:Patrick.ppt‎]]
 <br>
 ====<p style="font-size:15px; background-color:#66bbff;">Midi-Prep of pAAV_iGEM_mVenus-YFP</p>====
- <br/>
+'''Investigators: Hanna, Chris W''' (Adrian inserted RNAse and Ethanol into Buffers)
-Investigators: Hanna, Chris W (Adrian inserted RNAse and Ethanol into Buffers)
 * new kit from Qiagen was used
 * 35 ml of the over-night culture was filled into a 50 mL falcon and centrifuged at '''5000 g''' at '''4°C''' for '''5 minutes'''.
@@ Line 1,549: / Line 1,442: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Mini Prep of P42 and P43 pAAV-RFC-25</p>====
-Investigator: Bea
+<b>Investigator: Bea</b>
 * Mini-Prep was performed following standard protocols
 * conc: P42: 321,5 µg/µl
@@ Line 1,558: / Line 1,451: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Work on pKEX backbones</p>====
-Volker
+<b>Investigator: Volker</b>
 The sequencing data was evaluated and BLAST searches were carried out on NCBI to answer the question weather the sequence belongs to the backbone pKEX. This question could be answered positively. <br>
 There are standard Primers from GATC that prime in the sequence. The three expression plasmids from PD Kleinschmidt will therefor be sequenced tomorrow.<br>
-Additionnaly nine primers for sequences in the AAV Rep and Cap genes were disigned.
+Additionnaly nine primers for sequences in the AAV Rep and Cap genes were designed.
-'
 <br>
 ===<p style="font-size:17px; background-color:#00dd77;">41.Labortag 25.06.2010:</p>===
 ====<p style="font-size:15px; background-color:#66bbff;">PCR of ITRs, Splitting HT1080 and AAV-293 cells, Seeding of HT1080 cells, Creating Virus Stock Economics, Medium check</p>====
-<br>
 <p style="font-size:15px; font-weight: bold; color: fuchsia;">Preparation for PCR of ITRs</p>
+<b>Investigator: Bea</b><br>
 ''' Digestion of pAAV_MCS (P9)'''
 <ul>
 <li> experiment date: 25.06.2010
-<li> name of investigator: Bea
 <li> plasmid: name: pAAV_MCS number: P9 production date: 08.05.2010 origin: SH
 <li> buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:113) NgoMIV ; Enzyme 2 (no.Lab:120) AlwNI
@@ Line 1,605: / Line 1,497: @@
 <li> Loading plan: Marker (8 µL), pAAV_MCS 1 (24 µL), paav_MCS 2 (24 µL)
 <br>
 ====<p style="font-size:15px; background-color:#66bbff;">Splitting of HT1080 and AAV-293 cells, Seeding of HT1080 cells</p>====
-Investigator: Hanna <br>
+<b>Investigator: Hanna </b><br>
 '''HT1080:'''
@@ Line 1,626: / Line 1,517: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Creating Virus Stock Economics</p>====
-Investigators: Adrian
+'''Investigator: Adrian'''
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Medium check </u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Medium check</p>====
-Investigator: Adrian
+'''Investigator: Adrian'''
 *three little culture bottles got prepared (H-DMEM, DMEM and PBS) and set into the incubator. In the following days they'll get checked for bacerial growth.<br>
 ====<p style="font-size:15px; background-color:#66bbff;">Sequencing results of pAAV_RFC25</p>====
-investigators: Adrian, Bea, Hanna<br>
+'''Investigators: Adrian, Bea, Hanna'''<br>
-[[Image:Freiburg10 SeqAnalysis pAAV RFC25 25 06 2010.jpg|900px|thumb|left|SpeI restriction site deletion in sequenced data (on bottom).]]
+[[Image:Freiburg10 SeqAnalysis pAAV RFC25 25 06 2010.jpg|600px|thumb|center|SpeI restriction site deletion in sequenced data (on bottom).]]
 <br>
 <p style="clear:both;">'''sequenced sample''': pAAV_RFC25 clone 2 (P43)</p>
@@ Line 1,650: / Line 1,541: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Annotation and studies of the AAV structure</p>====
-Investigator: Volker
+'''Investigator: Volker'''
 The NGR- and the HPSG motif were annotated in the gene sequences according to [[Media: Freiburg10_Michelfelder Trepel 2009 AAV and Their Redirection to Cell-Type Specific Receptors.pdf|[Michelfelder & Trepe; 2009]]]
 The pdb sequence were visualized with the programm [http://www.pymol.org| PyMOL] and the important motifs were highlighted.
-<gallery widths=500px heights=300px perrow=2 caption="Impressions from PyMOL">
+'''Impressions from PyMOL'''
-Image:Freiburg10_The viral structure of AAV-2.png|thumb|left| The viral structure of AAV-2
-Image:Freiburg10_Sturcture of a single AAV-2 VP2 monomer.png|900px|thumb|left| Sturcture of a single AAV-2 VP2 monomer
+[[Image:Freiburg10_The viral structure of AAV-2.png|800px|thumb|center|The viral structure of AAV-2.]]
-Image:Freiburg10_B-Factor indicating mobility in the crystal.png|900px|thumb|left| B-Factor indicating mobility in the crystal
+[[Image:Freiburg10_Sturcture of a single AAV-2 VP2 monomer.png|800px|thumb|center|Sturcture of a single AAV-2 VP2 monomer]]
-Image:Freiburg10_HPSG-binding-motif.png|900px|thumb|left| HPSG-binding-motif
+[[Image:Freiburg10_B-Factor indicating mobility in the crystal.png|800px|thumb|center|B-Factor indicating mobility in the crystal]]
-Image:Freiburg10_Residues of the HPSG-binding-motif zoom.png|900px|thumb|left| Residues of the HPSG-binding-motif
+[[Image:Freiburg10_HPSG-binding-motif.png|600px|thumb|center|HPSG-binding-motif]]
-Image:Freiburg10_NGR-motif.png|900px|thumb|left| The NGR-motif that is responsible for the integrin a5β1 binding
+[[Image:Freiburg10_Residues of the HPSG-binding-motif zoom.png|800px|thumb|center|Residues of the HPSG-binding-motif]]
-</gallery>
+[[Image:Freiburg10_NGR-motif.png|800px|thumb|center|The NGR-motif that is responsible for the integrin a5β1 binding]]
-<br>
 <br>
 ===<p style="font-size:17px; background-color:#00dd77;">42.Labortag 26.06.2010</p>===
-<br>
 ====<p style="font-size:15px; background-color:#66bbff;">Transduction of HT1080 cells</p>====
-Investigator: Adrian
+'''Investigator: Adrian'''
 * Transduction of 2x6 wells was successfully done (14.25)
@@ Line 1,687: / Line 1,576: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Paper reading session</p>====
-Investigators: Igor, Anna, Patrick, Stefan and Volker
+'''Investigators: Igor, Anna, Patrick, Stefan and Volker'''
+<br />
 Several papers were read and infomation on cap-modifications were extracted.
 *Trasitions of seven Tyrosines (252, 272, 444, 500, 700, 704 and 730) to Phenylalanines as described in [[Media:Freibur10_Next_generation_of_adeno-associated_virus_2_vectors-_point_mutations_in_tyrosines_lead_to_high-efficiency_transduction_at_lower_doses.pdf|[Zhong et al. 2008]]]
 *Transitions of two amino acids (R459D and N551D) leading to reduced sero prevalence as described in [[Media:Designer_Gene_Delivery_Vectors-_Molecular_Engineering_and_Evolution_of_Adeno-Associated_Viral_Vectors_for_Enhanced_Gene_Transfer.pdf|[Inchan Kwonand, David V. Schaffer]‎]]
-[[Image:Freiburg_Results from the journal club at the 26th june.png|900px|thumb|left|Proposed transitions Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F in red & R459D and N551D in green]]
+[[Image:Freiburg_Results from the journal club at the 26th june.png|900px|thumb|center|Proposed transitions Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F in red & R459D and N551D in green]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
 <br>
 <br>
@@ Line 1,731: / Line 1,588: @@
 ===<p style="font-size:17px; background-color:#00dd77;">43.Labortag 28.06.2010: </p>===
 ====<p style="font-size:15px; background-color:#66bbff;">Checking HT1080 for YFP-Expression, Creating plan: urgent things to do</p>====
+'''Investigator: Sven, Patrick, Adrian'''
 <br>
 <p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Checking HT1080 for YFP-Expression </u></p>
 *Hannas 2*6 wells (24.6) transduced by (Adrian 25.6)
-Investigator: Sven, Patrick, Adrian
-<gallery widths=500px heights=300px perrow=2 caption="Results of transduction nr.2">
+<gallery widths=400px heights=200px perrow=2 caption="Results of transduction nr.2">
 Image: Freiburg10_2Transd10µg_unverd_2_(c1).JPG|10µg_unverd_2_(c1).JPG 48h post transduction
 Image: Freiburg10_2Transd10µg_unverd_1_(c1).JPG|10µg_unverd_1_(c1).JPG 48h post transduction
@@ Line 1,752: / Line 1,610: @@
 ====<p style="font-size:15px; background-color:#66bbff;">Sequencing results of P42</p>====
-Hanna <br>
+<b>Investigator: Hanna</b> <br>
 Sequencing of pAAV_RFC25 (P42):
-[[Image:Freiburg10 P42.jpg]]
+[[Image:Freiburg10 P42.jpg|thumb|center|800px]]
 Sequencing delivered, that there weren't any base exchanges or deletions in this clone. Therefore P43 was dismissed (Plasmid and glycerol stock). <br>
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Theoretical construction of our biobricks</u></p>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Theoretical cloning</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Theoretical construction of our biobricks</p>====
-Investigators: Hanna, Adrian, Chris W, Patrick, Volker
+<b>Investigators: Hanna, Adrian, Chris W, Patrick, Volker</b>
+Theoretical cloning
 ====<p style="font-size:15px; background-color:#66bbff;">Urgent Things to do:</p>====
@@ Line 1,774: / Line 1,633: @@
 ***bispecific AK -> order Diabodys (are there any restriction sites?) Investigator: kristian???
 <br>
-*Ordering the ITRs Investigator: Hanna
+*Ordering the ITRs '''Investigator: Hanna'''
 **Stratagene: right and left
 **wild-type
 <br>
-*Modification: REP Investigator: Volker
+*Modification: REP '''Investigator: Volker'''
 ** 3 restriction sites -> site directed mutagenisis vs. synthetic? ->order (check which is the cheaper approach)
 <br>
-*HGH Investigator: Hanna
+*HGH '''Investigator: Hanna'''
 ** restriction sites? -> are there any available biobricks?
 **biobrick production
@@ Line 1,799: / Line 1,658: @@
 ** telomerase specific promoters!!!
 <br>
-====<p style="font-size:15px; background-color:#66bbff;"><u>Continuation of ITR PCR</u></p>====
-Hanna, Chris W., Adrian <br>
+====<p style="font-size:15px; background-color:#66bbff;">Continuation of ITR PCR</p>====
+'''Investigators: Hanna, Chris W., Adrian''' <br>
 * Analytic gel was run: 1.7 µL loading dye (6x) was added to 8.3 µL of each sample (left ITR: 5 µL DMSO + 10 µL DMSO; right ITR: 5 µL DMSO + 10 µL DMSO).
 * 110 V, 35 minutes
@@ Line 1,807: / Line 1,667: @@
 <br>
-====<p style="font-size:15px; background-color:#66bbff;">><u>ITRs (theoretical)</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">ITRs (theoretical)</p>====
-Adrian, Achim, Hanna <br>
+'''Investigators:Adrian, Achim, Hanna''' <br>
 * trs sequences (GTTGG) are present in both ITRs (Stratagene)!
 * assumption: transcription despite of ITR-secondary structure - no single-strand nick at trs-sequence in transduced cells ?
@@ Line 1,814: / Line 1,674: @@
 ===<p style="font-size:17px; background-color:#00dd77;">44.Labortag 29.06.2010:</p>===
-====<p style="font-size:15px; background-color:#66bbff;"> Discussionround 3/p> ====
+====<p style="font-size:15px; background-color:#66bbff;"> Discussionround </p> ====
 *Affibodys
-**Investigator: Anna
+**'''Investigator: Anna'''
 ***Affibodys are 6-7kD Proteins derived from Protein A/Z
 ***they are binding to domain 3 from IGFR
@@ Line 1,824: / Line 1,684: @@
 <br>
 *Tyrosine Mutants
-**Investigator: Adrian
+**'''Investigator: Adrian'''
 ***replacements are done in VP3! => Volker?!
 ***no multi-mutants are available (instead of single mutations many Y->F)
 ***best candidates are: Y730F and Y444F.
 <br>
-*Second strand DNA-synthesis in Transduced cells
+*Second strand DNA-synthesis in transduced cells
-**Investigator: Achim
+**'''Investigator: Achim'''
-*** Dual strand synthesis is the main limiting for transduction/transgen expression.
+*** Second strand synthesis is the main limiting for transduction/transgen expression.
-<br>
+<br />
-====<p style="font-size:15px; background-color:#66bbff;"><u>Seeding HT-cells for transfection and titering</u></p>====
-Investigators: Sven, Adrian, Bea
+====<p style="font-size:15px; background-color:#66bbff;">Seeding HT-cells for transfection and titering</p>====
+'''Investigators: Sven, Adrian, Bea'''
 *The pellet was resolved in 4ml we had a 550.000 cells/ml
 * 2x6 well dishes got prepared:
@@ Line 1,858: / Line 1,719: @@
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Seeding HT1080-cells for transduction and qPCR</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Seeding HT1080-cells for transduction and qPCR</p>====
-Hanna  <br>
+'''Investigator: Hanna'''  <br>
 * Cell density was determined with trypan blue and counting chamber: 2 x 20 x 10^4 cells/mL
 * wanted: 5 x 10^4 cells --> 125 µL cell suspension per well
@@ Line 1,868: / Line 1,729: @@
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Transduction of HT1080 cells for qPCR</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">Transduction of HT1080 cells for qPCR</p>====
-Chris W. <br>
+'''Investigator: Chris W. <br>'''
 ===<p style="font-size:17px; background-color:#00dd77;">45.Labortag 30.06.2010:</p>===
-====<p style="font-size:15px; background-color:#66bbff;"> Titering Procedure via qPCR, Transduction of 6well plates nr.4, (Seeding HEK293 for Transfection?), further Gene-Order-Investigation</p>====
+====<p style="font-size:15px; background-color:#66bbff;"> Titering Procedure via qPCR, Transduction of 6well plates no.4</p>====
 <p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Harvesting cells for qPCR</u></p>
-Investigators: Chris W, Hanna <br>
+'''Investigators: Chris W, Hanna''' <br>
 Transduced HT1080 cells were harvested following Sven's standard protocol.
 <br>
-<p style="font-size:15px; font-weight: bold; color: blue;"><u>Transduction of 2 x 6well plates nr.4</u></p>
+<p style="font-size:15px; font-weight: bold; color: blue;">Transduction of 2 x 6well plates nr.4</p>
-Investigators: Bea, Adrian...
+'''Investigators: Bea, Adrian'''
 *Master plan: Different Transduction Mechanisms
@@ Line 1,926: / Line 1,787: @@
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>(Seeding HEK293 for Transfection?)</u></p>
+====<p style="font-size:15px; background-color:#66bbff;">beta-globin intron</p>====
-Investigators: ...
+'''Investigators: Adrian, Bea'''
-====<p style="font-size:15px; background-color:#66bbff;"><u>beta-globin intron</u></p>====
-Investigators: Adrian, Bea
 <br>
-We found some interesting literature which point out that introns have an influence on the eucaryotic gene expression on DNA and RNA level. Next steps are going to be the designing of the beta-globin intron and maybe further analysis of the other mentioned introns. Maybe two or three more introns can be ordered.
+We found some interesting literature which points out that introns have an influence on the eucaryotic gene expression on DNA and RNA level. Next steps are going to be the designing of the beta-globin intron and maybe further analysis of the other mentioned introns. Maybe two or three more introns can be ordered.
 <br>
 [[Media:Freiburg10_LeHir_et_al_How_introns_influence_and_enhance_eukaryotic_gene_expression_2003.pdf]]
@@ Line 1,944: / Line 1,801: @@
 <br>
 <br>
-====<p style="font-size:15px; background-color:#66bbff;"><u>hGH sequence</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">hGH sequence</p>====
-Hanna
+'''Investigator: Hanna'''
-* orientation in pAAV_MCS is reverse annotated... but in the same orientation as in human growth hormone I gene!
+* orientation in pAAV_MCS is reverse annotated, but in the same orientation as in human growth hormone I gene!
 * Blast and alignment with other expression vectors and the human growth hormone I revealed that Stratagene annotated 1 bp too much
 * "A common feature of mRNA in higher eukaryotes (but not in yeast) is the presence of the highly conserved sequence AAUAAA in the region from 11-30 nucleotides upstream of the site of poly(A) addition. (...) The signal is needed for both cleavage and polyadenylation." (Genes VIII, Lewin, P. 720)
@@ Line 1,954: / Line 1,811: @@
 <br>
-====<p style="font-size:15px; background-color:#66bbff;"><u>ITRs: new strategy</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">ITRs: new strategy</p>====
-Hanna <br>
+'''Investigator: Hanna''' <br>
 Plan:
 * Digest pAAV_MCS with AlwNI. Result: one large fragment containing the left ITR + a small fragment containing right ITR.
@@ Line 1,963: / Line 1,820: @@
 <br>
-====<p style="font-size:15px; background-color:#66bbff;"><u>Sequencing of pAAV_iGEM-mVenus-YFP</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Sequencing of pAAV_iGEM-mVenus-YFP</p>====
-Hanna, Chris W. <br>
+'''Investigators: Hanna, Chris W'''. <br>
 * 3 µL of O28, 29 and 30 each were mixed with 27 µL water -> primer fpr sequencing of GOI and of hGH sequence
 * 11.1 µL plasmid + 18.9 µL H<sub>2</sub>O
 <br>
-====<p style="font-size:15px; background-color:#66bbff;"><u>Investigation of the Kleinschmidt sequencing</u></p>====
+====<p style="font-size:15px; background-color:#66bbff;">Investigation of the Kleinschmidt sequencing</p>====
-Investigator: Volker
+'''Investigator: Volker'''
-[[Image:Freiburg_VP3ex sequencing.png|800px|thumb|right|The CMV promoter sequence was found in front of the expression constructs of VP2 and VP3]]
+[[Image:Freiburg_VP3ex sequencing.png|700px|thumb|center|The CMV promoter sequence was found in front of the expression constructs of VP2 and VP3]]
 The sequencing of den unknown backbone pKEX revealed that the construct VP1ex from the DKFZ seemed not to contain a regulatory region for the expresion of the VP1 ORF, but in the backbonesequence there were some standard primers from GATC that could be used to sequence the insert of all expression constructs.<br><br>
@@ Line 1,978: / Line 1,835: @@
 The fact that VP2ex and VP3ex contained a CMV promoter element which was not included in VP1ex was unexpected. The sequencing with the standard primer GATC_std_CMV_f which binds at the 3' end of the CMV promoter and will probably sequence the ORF of VP2ex and VP3ex was ordered.<br><br>
+<center>[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July '''=> Go to Labjournal July (labday 46 - 75)''']</center><br>
 <html>
-</div>
 </html>

Team:Freiburg Bioware/NoteBook/Labjournal/June

From 2010.igem.org

Latest revision as of 21:36, 27 October 2010

Contents

18. Labortag 01.06.2010:

Modifying MCS of pAAV_MCS vector

19. Labortag 02.06.2010:

Picking clones of pAAV_RFC25MCS

Design and ordering of Oligos (NotI)

Sponsoring work:

20. Labortag 03.06.2010:

pAAV_RFC25_MCS -> problem

Picking clones of Thymindinkinase of Amor

21. Labortag 04.06.2010:

DKFZ plasmid Retrafos, TK/GMK Mini-Prep

22. Labortag 05.06.2010:

Insertion of iGEM expression parts into pAAV_MCS

23. Labortag 07.06.2010:

Mini-Preps (Kleinschmidt-plasmids and pAAV_iGEM-MCS)

Kleinschmidt-plasmids

Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)

24. Labortag 08.06.2010:

Cloning of mVenus_YFP into pAAV_iGEM-MCS, continuation of site-directed mutagenesis

Continuation of site-directed mutagenesis

25. Labortag 09.06.2010:

pAAV_iGEM-MCS_mVenus-YFP, Site-directed mutagenesis

Picking of Clones from pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben

26. Labortag 10.06.2010:

Site-directed mutagenesis of PstI in ITRs

Mini-Prep of pAAV_iGEM_Venus_YFP and test digestion

27. Labortag 11.06.2010:

Site directed mutagenisis of 10.06.2010

28. Labortag 12.06.2010:

Transformation plates stored in 4°C room

29. Labortag 13.06.2010:

30. Labortag 14.06.2010:

Site-directed mutagenesis:

TK-GMK-Plasmid

Cell culture

31. Labortag 15.06.2010:

Solutions for transfection were prepared

32. Labortag 16.06.2010:

Sponsoring:

Sequencing of TK-GMK:

Mega primer PCR:

33. Labortag 17.06.2010:

Primer designing: VP1 primer for pKEX forward/reverse

Primer designing: CMV_forward/reverse_qPCR

Ordering of required reagents:

34. Labortag 18.06.2010

Transfection

Theoretical: Digestion of pAAV_MCS for PCR to design ITR BioBrick

35. Labortag 19.06.2010: Literature seminar

36.Labortag 20.06.2010:

Picking clones of sequenced pAAV_igEM_mVenus_YFP

37.Labortag 21.06.2010:

Second Transfection, Transduction

Feching dry ice for the experiments

Annotation of the BRs and the PLA2 domains

Endotoxin-free Midi-Prep of pAAV_iGEM_mVenus-YFP

Second Transfection

Preparing Viral Stocks

HT1080 Transduction

38.Labortag 22.06.2010:

Midiprep of pHelper plasmid; cloning of the rfc25 MCS

39.Labortag 23.06.2010:

Preparation of Viral Stock, Seeding cells

Design of Primer

Sequencing of pKEX-VP1

Thaw HT1080 and AAV-293 cells

Picking clones of pAAV_RFC25

Transduction results

Preparation of viral stocks

40.Labortag 24.06.2010:

Labmeeting, Presentation/Update by Patrick and Adrian

Midi-Prep of pAAV_iGEM_mVenus-YFP

Mini Prep of P42 and P43 pAAV-RFC-25

ITR modification via PCR

Work on pKEX backbones

41.Labortag 25.06.2010: