|
|
| (3 intermediate revisions not shown) |
| Line 20: |
Line 20: |
| | border-right: solid 1px #fff; | | border-right: solid 1px #fff; |
| | } | | } |
| - | a:link, a:visited { color: #fff; } | + | #navigation a:link { color: #fff; } |
| - | a:hover, a:active { color: #000; } | + | #navigation a:visited { color: #fff; } |
| - | a:hover { background-color: #fff; } | + | #navigation a:hover { color: #fff; } |
| | + | #navigation a:active { color: #000; } |
| | + | #navigation a:hover { background-color: #fff;color:#77787C; } |
| | #navigation{align:left;} | | #navigation{align:left;} |
| | #body{float:right;width:81%;padding-bottom:60px;text-align:justify;font-family:calibri,Arial, Helvetica, sans-serif;font-size:12;} | | #body{float:right;width:81%;padding-bottom:60px;text-align:justify;font-family:calibri,Arial, Helvetica, sans-serif;font-size:12;} |
| Line 52: |
Line 54: |
| | <li><a href="https://2010.igem.org/Team:Macquarie_Australia/Parts">Parts Submitted to the Registry</a></li> | | <li><a href="https://2010.igem.org/Team:Macquarie_Australia/Parts">Parts Submitted to the Registry</a></li> |
| | <li><a href="https://2010.igem.org/Team:Macquarie_Australia/Glossary">Glossary</a></li> | | <li><a href="https://2010.igem.org/Team:Macquarie_Australia/Glossary">Glossary</a></li> |
| | + | <li><a href="https://2010.igem.org/Team:Macquarie_Australia/humanpractice">Human practice</a></li> |
| | <li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook">Notebook 1: <i>Agrobacterium Tumefaciens</i> | | <li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook">Notebook 1: <i>Agrobacterium Tumefaciens</i> |
| | </a></li> | | </a></li> |
| Line 107: |
Line 110: |
| | | | |
| | We have established a foundation upon which Macquarie University teams can build on in future years and will encourage students to take part in such a fantastic competition and have as much fun as we have!<p> </b> | | We have established a foundation upon which Macquarie University teams can build on in future years and will encourage students to take part in such a fantastic competition and have as much fun as we have!<p> </b> |
| - |
| |
| - | <hr><h2> Suggestion for amended BiobrickTM instructions </hr></h2> <p>
| |
| - |
| |
| - |
| |
| - |
| |
| - | <p> The instructions that can be accessed on http://partsregistry.org/
| |
| - | Help:Spring_2010_DNA_distribution provide an explanation on how to use the linearised
| |
| - | plasmid backbone. We found these instructions to be slightly confusing and a little misleading,
| |
| - | particularly as it says "All you need to do is cut with EcoRI, PstI and DpnI to leave two ends ready
| |
| - | to be ligated to a Biobrick™ part". Used in this way, it effectively incapacitates the ability to
| |
| - | further use this BioBrick in an assembly process.</p>
| |
| - |
| |
| - | <p>
| |
| - | The protocol given (http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones) is
| |
| - | one that describes how to use these linearised backbones to assemble two parts together in a
| |
| - | single ligation reaction. This is not the same as using the linearised backbone to insert a single
| |
| - | Biobrick™ part into the linearised vector as implied in the usage instructions. </p>
| |
| - |
| |
| - | <p>Below is a modification of this protocol to describe how to ligate in a single Biobrick part as well
| |
| - | as renaming the use as previously described to make the usage clearer. </p>
| |
| - |
| |
| - |
| |
| - | <h3><u> Primers</u> </h3>
| |
| - |
| |
| - | <p> gccgctgcagtccggcaaaaaaacg,SB-prep-3P </p>
| |
| - | <p> atgaattccagaaatcatccttagcg,SB-prep-2Ea </p>
| |
| - |
| |
| - | <p> Dilute to 30 pmol/ul </p><p>
| |
| - |
| |
| - | <b> PCR </b>
| |
| - |
| |
| - | <p>• 100 ul PCR supermix high fidelity</p>
| |
| - | <p>• 0.7 ul each primer</p>
| |
| - | <p>• 0.5 ul template DNA at 10 ng/ul (Note: Do not use a sample of linearized plasmid backbones</p>
| |
| - |
| |
| - | (pcred) as a template.) <p>
| |
| - |
| |
| - | cycle 94/30s; 36x(94/30s;55/30s;68/3:00 min); 68/10 min
| |
| - | Ethanol precipitate (This step does not appear necessary)
| |
| - | Digest with DpnI enzyme in 100 ul 2 ul DpnI
| |
| - | Incubate 37/overnight hour; heat kill 80/20 min </p> <p>
| |
| - |
| |
| - | <b>Cleanup </b>
| |
| - |
| |
| - |
| |
| - | <p>
| |
| - |
| |
| - |
| |
| - | <p>•Add 500 ul Qiagen buffer PB</p>
| |
| - |
| |
| - | <p>•Spin through a column twice, discard flowthrough</p>
| |
| - | <p>•Wash 1x with 700 ul buffer PB</p>
| |
| - | <p>•Wash 2x with 760 ul buffer PE</p>
| |
| - | <p>•Discard liquid, spin dry at 17000g for 3 min</p>
| |
| - | <p>•Elute into a new tube twice with 50 ul of TE (100 ul total)</p><p>
| |
| - |
| |
| - | <b> Quality Control </b> </p><p>
| |
| - |
| |
| - | •Run 3 ul on a gel to verify the correct band and concentration and lack of side products </p>
| |
| - | <p>• Quantify concentration on a nanodrop. Expect around 10 ug from a 100 ul PCR reaction (100 ng/ul in 100 ul)</p>
| |
| - | <p> <b>Perform a ligation test</b><p></p>
| |
| - | <p>Test for both the EcoRI and PstI cutting and ligation efficiency</p>
| |
| - | <p>• Digest in a 15 ul final volume</p>
| |
| - | <p>•1 ul DNA (approximately 100 ng)</p>
| |
| - | <p>•1.5 ul NEB Buffer 2 (Not buffer 4; see E-Gel Buffer Compatibility)</p>
| |
| - | <p>•0.15 ul BSA</p>
| |
| - | <p>•0.5 ul either EcoRI-HF or PstI enzyme (not both!)</p>
| |
| - | <p>•12 ul water</p>
| |
| - | <p>•Digest 37/1 hour; 80/20 min</p>
| |
| - | <p>•Add 5 ul of a 4x ligation master mix</p>
| |
| - | <p>•Ligate 30 min at room temperature</p>
| |
| - | <p>•Heat kill the ligase 80/20 min</p>
| |
| - | <p>•run all 20 ul on a gel</p>
| |
| - | <p>•Compare intensity of the single and double length bands. Good product should show mostly double length bands.</p>
| |
| - |
| |
| - |
| |
| - | <p> <b> Ligation master mix </b></p>
| |
| - | <p>• 50 ul final</p>
| |
| - | <p>• 20 ul T4 DNA ligase buffer</p>
| |
| - | <p>•5 ul T4 DNA ligase</p>
| |
| - | <p>•25 ul water</p>
| |
| - |
| |
| - | <p><b>Transformation test</b></p><p>
| |
| - | <p>•Transform 1 ul of the diluted final product into highly competent cells</p>
| |
| - | <p>•Control transform 10 pg of pUC19</p>
| |
| - | <p>•plate on the appropriate antibiotic and observe few colonies. Any colonies represent background to the three antibiotic assembly process</p>
| |
| - | <p>•Quantify the effective amount of remaining circular DNA able to transform </p>
| |
| - |
| |
| - |
| |
| - | <h3> <u>Bulk production</u> </h3><p>
| |
| - |
| |
| - | <p>•PCR with PCR supermix high fidelity</p>
| |
| - | add 19 ul primer SB-prep-2Eb</p>
| |
| - | <p>•add 19 ul primer SB-prep-3P</p>
| |
| - | <p>•add 1 ul 10 ng/ul template DNA</p>
| |
| - | <p>•aliquot 100ul/well in 96 well plate</p>
| |
| - | <p>•cycle 1 min/94C 40x(30s 94; 30s 58; 3min 68) 10 min/68 hold 4C</p>
| |
| - |
| |
| - | <p><b>purify Promega SV96 pcr cleanup </b></p>
| |
| - |
| |
| - |
| |
| - | <p>•Add 100 ul pcr cleanup buffer using 8 well pipet, mix</p>
| |
| - | <p>•transfer to cleanup plate, allow to sit 1 min, vacuum dry</p>
| |
| - | <p>•wash 3x with 200 ul 80% ethanol, vacuum after each</p>
| |
| - | <p>•remove from the wash manual, blot on paper towels, reinstall in wash manifold</p>
| |
| - | <p>•dry 4 min on vacuum</p>
| |
| - | <p>•transfer to collection manifold</p>
| |
| - | <p>•elute with 2x 50 ul TE buffer</p>
| |
| - | <p>• Measure concentration on nanodrop, adjust to 25 ng/ul with TE</p>
| |
| - |
| |
| - | <p><h3>Use for assembly of two biobrick parts</p></h3>
| |
| - |
| |
| - | <p>•Prepare 2x Enzyme master mix (25 ul)</p>
| |
| - | <p>•5.0 ul NEB Buffer 4</p>
| |
| - | <p>•0.5 ul NEB BSA</p>
| |
| - | <p>•0.5 ul EcoRI-HF</p>
| |
| - | <p>•0.5 ul PstI</p>
| |
| - |
| |
| - | <p>•0.5 ul DpnI</p>
| |
| - | <p>•18 ul water</p>
| |
| - | <p>•flick mix, spin down</p>
| |
| - |
| |
| - | <p><b> Digest construction plasmid </b></p></b>
| |
| - |
| |
| - | </b><p>•Add 4 ul prepared construction plasmid (25 ng/ul)</p>
| |
| - | <p>•Add 4 ul 2x Enzyme mix</p>
| |
| - | <p>•digest in a pcr cycler 37C/30 min, heat kill 80C/20 min using a hot lid</p>
| |
| - |
| |
| - | <p><b> Ligation</p></b></b>
| |
| - | </b><p>•Add 2ul of digested construction plasmid (25 ng)</p>
| |
| - | <p>•Add equimolar amount of EcoRI-HF SpeI digested fragment which will stay at 5' end of Biobrick assembly (< 3 ul)</p>
| |
| - |
| |
| - | <p>•Add equimolar amount of XbaI PstI digested fragment which will stay at 5' end of Biobrick assembly (< 3 ul)</p>
| |
| - | <p>•Add 1 ul NEB T4 DNA ligase buffer</p>
| |
| - | <p>•Add 0.5 ul T4 DNA ligase</p>
| |
| - | <p>•Add water to 10 ul if necessary</p>
| |
| - | <p>•ligate 16C/30 min, heat kill 80C/20 min</p>
| |
| - | <p>•transform with 1-2 ul of product</p>
| |
| - |
| |
| - |
| |
| - | <h3>Use for insertion of a single BioBrick part or composite into the plasmid</h3><p>
| |
| - |
| |
| - | <p>•Prepare 2x Enzyme master mix (25 ul)</p>
| |
| - | <p>•5.0 ul NEB Buffer 4</p>
| |
| - | <p>•0.5 ul NEB BSA</p>
| |
| - | <p>•0.5 ul XbaI</p>
| |
| - | <p>•0.5 ul SpeI</p>
| |
| - | <p>•0.5 ul DpnI</p>
| |
| - | <p>•18 ul water</p>
| |
| - | <p>•flick mix, spin down</p>
| |
| - |
| |
| - |
| |
| - |
| |
| - | <b><b>Digest construction plasmid</b></p></b>
| |
| - | </b><p>•Add 4 ul prepared construction plasmid (25 ng/ul)</p>
| |
| - | <p>•Add 4 ul 2x Enzyme mix</p>
| |
| - | <p>•digest in a pcr cycler 37C/30 min, heat kill 80C/20 min using a hot lid</p>
| |
| - |
| |
| - | <p><b> Ligation</b></p></b>
| |
| - | <p>•Add 2ul of digested construction plasmid (25 ng)</p>
| |
| - | <p>•Add equimolar amount of XbaI SpeI digested Biobrick part (< 3 ul)</p>
| |
| - | <p>•Add 1 ul NEB T4 DNA ligase buffer
| |
| - | <p>•Add 0.5 ul T4 DNA ligase
| |
| - | <p>•Add water to 10 ul if necessary
| |
| - | <p>•ligate 16C/30 min, heat kill 80C/20 min
| |
| - | <p>•transform with 1-2 ul of product
| |
Acknowledgements
Thanks to Macquarie University , the MQ Biomolecular Frontiers Research Centre and U@MQ for funding and support, without which we would never have been able to enter into the iGEM competition, be able to travel to America in November. And thanks for the team shirts which we will gladly wear to represent our team in representing Macquarie University at MIT.
A big thanks to Associate Professor Rob Willows , the man behind the project, Professor Nicki Packer for all your support and a special thanks to Dr Louise Brown for all of her organisation, time, support and effort in the team and competition and as an awesome lecturer, and Professor Helena Nevalainen for her expertise in experimental design and planning.
Thankyou to Professor Ian Paulsen for all of his advisory and technical support and for allowing us to use his ideas, kits and lab. And to Professor Michael Gillings also for his advisory support and for helping us to interpret experimental results and use of his lab.
Thanks to our wiki expert Manish K Sharma for all of his help and efforts on the wiki.
And thanks to Karl Hassan for coming to Jamboree with the team!
Thanks to Yagiz Alp Aksoy and Hilal Varinli , for all of the hours spent in the lab, your awesome laboratory skills and brains! We really appreciate your hard work over these months.
Thanks to Joanna Hare , Olga Ibrahim for all the time and effort spent into getting the Wiki done.
Thanks also to Katie Mackenzie and Sangeev Santhirasegaram for being part of the team and for desiging the poster that we are taking to Boston.
And finally to Yagiz , Hilal , Joanna and Olga for flying over to Boston to represent the Macquarie University team at iGEM Jamboree 2010!
Macquarie's first year in the iGEM competition:
what we have achieved
This is the first time that we have been lucky enough to enter this competition. We should note that all the gene cloning experiments conducted over the past 5 months have been carried out by the six Undergraduate team members. Professor Robert Willows kindly provided us with the pET-3A vector with the Heme Oxygenase gene already inserted and the sequencing was done by the Macquarie Sequencing Facility.
We have established a foundation upon which Macquarie University teams can build on in future years and will encourage students to take part in such a fantastic competition and have as much fun as we have!
"
