Team:Freiburg Software/Meetings

From 2010.igem.org

(Difference between revisions)
Line 18: Line 18:
<h1>Meetings</h1>
<h1>Meetings</h1>
<p class="main">
<p class="main">
 +
</html>
 +
==<font style="font-size: 12px;">Sep. 24 2010</font>==
 +
Niklas, Paul, Paresh, Kristian, Fabian
 +
* Do we need all of the three Requirements for a gold medal or just one of these? -> E-Mail to the HQ
 +
* Collaboration -> The things we have done are not enough. We could implement a converter for Geneious <-> BioBrick&trade; formate. An other idea was to write a program that helps the Labteam to design primer.
 +
 +
* Niklas showed us his Blast-Search-Robot. It works good. One question was the menu button position.
 +
* Paresh made a translation-Robot. The six-reading-frame still a problem.
 +
* But now they can upload to sourceforge.
 +
 +
* For the Human practise we could write a Safety-Test-Robot witch looks for virus information in the sequence.
 +
 +
* For donation: Niklas have a contact person at SAP. We will write a letter, maybe we get some money.
 +
 +
* More function in the wave:
 +
** BioBrick import and export with the option to choose/search a Part by No.
 +
** The same for other Databases e.g. Genbank
 +
** seaching for restriction-sites
 +
 +
==<font style="font-size: 12px;">Sep. 27 2010</font>==
 +
Niklas, Paresh, Fabian
 +
 +
* Spoke about the conversation Fabian and Paul had with Kristian
 +
* Fabian showed some new ideas for robots and explained the biology behind them.
 +
** Primer design
 +
** colored DNA tripplet
 +
** Database download
 +
** Virus check
 +
Paresh had the idea for a Umbrella-robot. It lists all the available robots and lets them add in the wave.<br /><br />
 +
We meet Fr. 1.oct. 7pm at bio II/III
 +
 +
==<font style="font-size: 12px;">Sep. 30 2010</font>==
 +
 +
Niklas, Paresh, Fabian, Volker (LabTeam)
 +
 +
* Volker explained us the rules for primers design.
 +
* The Translation Robot and the Blast Robot are fixed. There are a new local alignment Robot (Niklas)
 +
* Kristian is not here tomorrow so we will write him an e-mail to show him the new Robots.
 +
 +
==<font style="font-size: 12px;">Oct. 5 2010</font>==
 +
Kristian, Fabian<br />
 +
Fabian showed Kristian the new robots and discussed the functionality and the usability.
 +
* Translation Robot (translation-beta@appspot.com)
 +
** The view should be something like 1. original DNA-Strand 2. first Frame (with all proteins) a.s.o. and all among each other.
 +
** ATGGAATTCTCGCTCTAGCTACGTAGCTATGGAATTCTCGCTCTAG
 +
** -M--E--F--S--L--*------------M--E--F--S--L--*- (look for the right positions in the edit window)<br />
 +
** In the input matrix there should be an option to choose the start/stop codons and something to choose the organism.<br />
 +
<br />
 +
* Primer Design Robot (synbiowave-primerdesigner@appspot.com)
 +
** An option to choose the add-on-tail (iGEM standard, own sequence, none)
 +
** Maybe we could implement two different versions to calculate the temperature.
 +
<br />
 +
* Restriction Enzymes Robot (REBase)
 +
** Imput:
 +
*** Enzymes from the workspace (could be more than 50 to select like the sequences). or something to type it like this: EcoRI, XbaI, ... . One selection for iGEM.
 +
*** min and max cut (the length the enzymes will cut)
 +
** output
 +
*** EcoRI: Start: 10, 55, 126, ... XbaI: Start: 26, 71, 99, ... <br />
 +
view like this: EcoRI |    XbaI |<br />
 +
GCATGCGCTAGCTGCTGAGCATGAATTCACTGTTCTAGAATCGTACT (look for the right positions in the edit window)<br /><br />
 +
* Alignment Robot (alignobot@appspot.com)
 +
** Show the algorithm which is used (niedelman/wunsch...smith waterman...).
 +
* Blast Robot
 +
** restart the BlastRobot Project
 +
<br />
 +
Is it possible to scroll the menu with the wave?<br />
 +
<br />
 +
3rd wave for graphics like the workspace.
 +
 +
==<font style="font-size: 12px;">Oct. 7 2010</font>==
 +
Fabian, Kristian, Niklas
 +
We discussed some (new) Ideas we could implement:
 +
* Ligate Bioprick parts
 +
* Import of GenBank etc is important
 +
* Display features (annotations)
 +
* Is it possible to work with selected Sequences in the main Wave?
 +
 +
Keep 5' -> 3' direction!
 +
 +
==<font style="font-size: 12px;">Okt. 11 2010</font>==
 +
Niklas, Fabian, Paresh<br />
 +
* Annotation robot: how to display the output. We will try using the GadgetView Gadget and adjust it to display annotations.
 +
* Translation Robot output now looks good. A problem is, that Biojava translate seems to take long. Maybe write own translation method?
 +
* Talked about the organism identifier robot. Checked codon usage database.
 +
==<font style="font-size: 12px;">Oct. 12 2010</font>==
 +
Jörg, Paresh, Fabian, Niklas
 +
* Paresh presented the latest version of Translation Robot which works well except for some display issues -> we will move the coloring form the robots to the gadget to gain performance
 +
* Niklas presented the PartsRegistry import function which got included in the main robot.
 +
* We created a new synbiowave-V2-001.jar as the new developer library.
 +
* Next meeting: Oct. 14 @Lab(Kitchen)
 +
==<font style="font-size: 12px;">Oct. 15 2010</font>==
 +
Paresh, Fabian, Niklas
 +
* We created a "roadmap" of all the tasks that we still have to do and assigned each of them to one of us
 +
===<font style="font-size: 12px;">Roadmap</font>===
 +
*Wiki
 +
    * Home (Fabian)
 +
    * Team (Fabian)
 +
          o 2010
 +
          o Photos
 +
          o Collaboration
 +
    * Project (Paresh) (Summary)
 +
          o Prospect
 +
          o History
 +
    * User (Niklas)
 +
          o User Guide (Niklas) (Requirements)
 +
          o The Robots (Paresh, Niklas)
 +
    * Developer (Niklas)
 +
          o Code (Niklas)
 +
          o Technologies (Niklas) (Wave, BioJava, ...)
 +
          o Architecture (Paresh)
 +
          o Availability (Paresh)
 +
    * Notebook (Fabian)(aka lab journal)
 +
          o months
 +
          o meetingspha
 +
    * Human Practise (Niklas)
 +
*Coding
 +
** finish existing robots (Paresh, Niklas)
 +
** Blast search robot (Niklas)
 +
** "likelihood" robot (Paresh)
 +
** Genbank, EMBL import (Niklas)
 +
** Colorcoding to Javascript (Paresh) <br /><br />
 +
* '''Deadline: Oct. 24 (meeting TBA)'''
 +
 +
<html>
</p>
</p>

Revision as of 21:35, 20 October 2010

Meetings

Contents

Sep. 24 2010

Niklas, Paul, Paresh, Kristian, Fabian

  • Do we need all of the three Requirements for a gold medal or just one of these? -> E-Mail to the HQ
  • Collaboration -> The things we have done are not enough. We could implement a converter for Geneious <-> BioBrick™ formate. An other idea was to write a program that helps the Labteam to design primer.
  • Niklas showed us his Blast-Search-Robot. It works good. One question was the menu button position.
  • Paresh made a translation-Robot. The six-reading-frame still a problem.
  • But now they can upload to sourceforge.
  • For the Human practise we could write a Safety-Test-Robot witch looks for virus information in the sequence.
  • For donation: Niklas have a contact person at SAP. We will write a letter, maybe we get some money.
  • More function in the wave:
    • BioBrick import and export with the option to choose/search a Part by No.
    • The same for other Databases e.g. Genbank
    • seaching for restriction-sites

Sep. 27 2010

Niklas, Paresh, Fabian

  • Spoke about the conversation Fabian and Paul had with Kristian
  • Fabian showed some new ideas for robots and explained the biology behind them.
    • Primer design
    • colored DNA tripplet
    • Database download
    • Virus check

Paresh had the idea for a Umbrella-robot. It lists all the available robots and lets them add in the wave.

We meet Fr. 1.oct. 7pm at bio II/III

Sep. 30 2010

Niklas, Paresh, Fabian, Volker (LabTeam)

  • Volker explained us the rules for primers design.
  • The Translation Robot and the Blast Robot are fixed. There are a new local alignment Robot (Niklas)
  • Kristian is not here tomorrow so we will write him an e-mail to show him the new Robots.

Oct. 5 2010

Kristian, Fabian
Fabian showed Kristian the new robots and discussed the functionality and the usability.

  • Translation Robot (translation-beta@appspot.com)
    • The view should be something like 1. original DNA-Strand 2. first Frame (with all proteins) a.s.o. and all among each other.
    • ATGGAATTCTCGCTCTAGCTACGTAGCTATGGAATTCTCGCTCTAG
    • -M--E--F--S--L--*------------M--E--F--S--L--*- (look for the right positions in the edit window)
    • In the input matrix there should be an option to choose the start/stop codons and something to choose the organism.


  • Primer Design Robot (synbiowave-primerdesigner@appspot.com)
    • An option to choose the add-on-tail (iGEM standard, own sequence, none)
    • Maybe we could implement two different versions to calculate the temperature.


  • Restriction Enzymes Robot (REBase)
    • Imput:
      • Enzymes from the workspace (could be more than 50 to select like the sequences). or something to type it like this: EcoRI, XbaI, ... . One selection for iGEM.
      • min and max cut (the length the enzymes will cut)
    • output
      • EcoRI: Start: 10, 55, 126, ... XbaI: Start: 26, 71, 99, ...

view like this: EcoRI | XbaI |
GCATGCGCTAGCTGCTGAGCATGAATTCACTGTTCTAGAATCGTACT (look for the right positions in the edit window)

  • Alignment Robot (alignobot@appspot.com)
    • Show the algorithm which is used (niedelman/wunsch...smith waterman...).
  • Blast Robot
    • restart the BlastRobot Project


Is it possible to scroll the menu with the wave?

3rd wave for graphics like the workspace.

Oct. 7 2010

Fabian, Kristian, Niklas We discussed some (new) Ideas we could implement:

  • Ligate Bioprick parts
  • Import of GenBank etc is important
  • Display features (annotations)
  • Is it possible to work with selected Sequences in the main Wave?

Keep 5' -> 3' direction!

Okt. 11 2010

Niklas, Fabian, Paresh

  • Annotation robot: how to display the output. We will try using the GadgetView Gadget and adjust it to display annotations.
  • Translation Robot output now looks good. A problem is, that Biojava translate seems to take long. Maybe write own translation method?
  • Talked about the organism identifier robot. Checked codon usage database.

Oct. 12 2010

Jörg, Paresh, Fabian, Niklas

  • Paresh presented the latest version of Translation Robot which works well except for some display issues -> we will move the coloring form the robots to the gadget to gain performance
  • Niklas presented the PartsRegistry import function which got included in the main robot.
  • We created a new synbiowave-V2-001.jar as the new developer library.
  • Next meeting: Oct. 14 @Lab(Kitchen)

Oct. 15 2010

Paresh, Fabian, Niklas

  • We created a "roadmap" of all the tasks that we still have to do and assigned each of them to one of us

Roadmap

  • Wiki 
   * Home (Fabian)
   * Team (Fabian)
         o 2010
         o Photos
         o Collaboration 
   * Project (Paresh) (Summary)
         o Prospect
         o History 
   * User (Niklas)
         o User Guide (Niklas) (Requirements)
         o The Robots (Paresh, Niklas) 
   * Developer (Niklas)
         o Code (Niklas)
         o Technologies (Niklas) (Wave, BioJava, ...)
         o Architecture (Paresh)
         o Availability (Paresh) 
   * Notebook (Fabian)(aka lab journal)
         o months
         o meetingspha 
   * Human Practise (Niklas)
  • Coding
    • finish existing robots (Paresh, Niklas)
    • Blast search robot (Niklas)
    • "likelihood" robot (Paresh)
    • Genbank, EMBL import (Niklas)
    • Colorcoding to Javascript (Paresh)

  • Deadline: Oct. 24 (meeting TBA)

Retrieved from "http://2010.igem.org/Team:Freiburg_Software/Meetings"