Meetings

September

Sep. 24 2010

Niklas, Paul, Paresh, Kristian, Fabian

• Do we need all of the three Requirements for a gold medal or just one of these? -> E-Mail to the HQ
  
• Collaboration -> The things we have done are not enough. We could implement a converter for Geneious <->BioBrick™ formate. An other idea was to write a program that helps the Labteam to design primer.
  
• Niklas showed us his Blast-Search-Robot. It works good. One question was the menu button position.
  
• Paresh made a translation-Robot. The six-reading-frame still a problem.
  
• But now they can upload to sourceforge.
  
• For the Human practise we could write a Safety-Test-Robot witch looks for virus information in the sequence.
  
• For donation: Niklas have a contact person at SAP. We will write a letter, maybe we get some money.
  
• More function in the wave:
• BioBrick import and export with the option to choose/search a Part by No.
• The same for other Databases e.g. Genbank
• seaching for restriction-sites

Sep. 27 2010

Niklas, Paresh, Fabian

• Spoke about the conversation Fabian and Paul had with Kristian
  
• Fabian showed some new ideas for robots and explained the biology behind them.
  
  • Primer design
  • Colored DNA tripplet
  • Database download
  • Virus check

Paresh had the idea for a Umbrella-robot. It lists all the available robots and lets them add in the wave. We meet Fr. 1.oct. 7pm at bio II/III

Sep. 30 2010

Niklas, Paresh, Fabian, Volker (LabTeam)

• Volker explained us the rules for primers design.
• The Translation Robot and the Blast Robot are fixed. There are a new local alignment Robot (Niklas)
• Kristian is not here tomorrow so we will write him an e-mail to show him the new Robots.

October

Oct. 5 2010

Kristian, Fabian

Fabian showed Kristian the new robots and discussed the functionality and the usability.

• Translation Robot (translation-beta@appspot.com)
• The view should be something like 1. original DNA-Strand 2. first Frame (with all proteins) a.s.o. and all among each other.
• ATGGAATTCTCGCTCTAGCTACGTAGCTATGGAATTCTCGCTCTAG
• -M--E--F--S--L--*------------M--E--F--S--L--*- (look for the right positions in the edit window)
• In the input matrix there should be an option to choose the start/stop codons and something to choose the organism.

• Primer Design Robot (synbiowave-primerdesigner@appspot.com)
• An option to choose the add-on-tail (iGEM standard, own sequence, none)
• Maybe we could implement two different versions to calculate the temperature.

• Restriction Enzymes Robot (REBase)
• Imput:
• Enzymes from the workspace (could be more than 50 to select like the sequences). or something to type it like this: EcoRI, XbaI, ... . One selection for iGEM.
• min and max cut (the length the enzymes will cut)
• output
• EcoRI: Start: 10, 55, 126, ... XbaI: Start: 26, 71, 99, ... view like this: EcoRI | XbaI |
• GCATGCGCTAGCTGCTGAGCATGAATTCACTGTTCTAGAATCGTACT (look for the right positions in the edit window)

• Alignment Robot (alignobot@appspot.com)
• Show the algorithm which is used (niedelman/wunsch...smith waterman...).

• Blast Robot
• restart the BlastRobot Project

Is it possible to scroll the menu with the wave?

3rd wave for graphics like the workspace.

Oct. 7 2010

Fabian, Kristian, Niklas

We discussed some (new) Ideas we could implement:

• Ligate Bioprick parts
• Import of GenBank etc is important
• Display features (annotations)
• Is it possible to work with selected Sequences in the main Wave?

Keep 5' -> 3' direction!

Okt. 11 2010

Niklas, Fabian, Paresh

• Annotation robot: how to display the output. We will try using the GadgetView Gadget and adjust it to display annotations.
• Translation Robot output now looks good. A problem is, that Biojava translate seems to take long. Maybe write own translation method?
• Talked about the organism identifier robot. Checked codon usage database.

Oct. 12 2010

Jörg, Paresh, Fabian, Niklas

• Paresh presented the latest version of Translation Robot which works well. we will move the coloring form the robots to the gadget to gain performance
• Niklas presented the PartsRegistry import function which got included in the main robot.
• We created a new synbiowave-V2-001.jar as the new developer library.
• Next meeting: Oct. 14 @Lab(Kitchen)

Oct. 15 2010

Paresh, Fabian, Niklas

We created a "roadmap" of all the tasks that we still have to do and assigned each of them to one of us

Roadmap

• Wiki
• Home (Fabian)
• Team (Fabian)
  • 2010
  • Photos
  • Collaboration
• Project (Paresh) (Summary)
  • Prospect
  • History
• User (Niklas)
  • User Guide (Niklas) (Requirements)
  • The Robots (Paresh, Niklas)
• Developer (Niklas)
  • Code (Niklas)
  • Technologies (Niklas) (Wave, BioJava, ...)
  • Architecture (Paresh)
  • Availability (Paresh)
• Notebook (Fabian)(aka lab journal)
  • months
  • meetings
• Human Practise (Niklas)

• Coding
  • finish existing robots (Paresh, Niklas)
  • Blast search robot (Niklas)
  • "likelihood" robot (Paresh)
  • Genbank, EMBL import (Niklas)
  • Colorcoding to Javascript (Paresh)
  • Deadline: Oct. 24 (meeting TBA)

Oct. 21 2010

Fabian, Paresh, Jörg, Niklas

• We discussed some details of the wiki (pictures, ect.)
• Worked together on the new circular view
• Tried the new Wave-in-a-box -> The client is still in beta stage and its not sure if robots will work, so no alternative for the jamboree.

Oct. 22- 24 2010

Fabian, Paresh, Niklas

• Wrote the wiki together

Oct. 25 2010

Fabian, Jörg, Niklas

• We created the new wave window for graphics