Team:Korea U Seoul/Notebook

From 2010.igem.org

(Difference between revisions)
(→[ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16)
(→[ Digestion ] 2010-10-01 ~ 2010-10-03)
 
(21 intermediate revisions not shown)
Line 53: Line 53:
!Sequence ( 5’ → 3’ )
!Sequence ( 5’ → 3’ )
|-
|-
-
|''PyodA(EcoRI)_F''
+
|PyodA(''Eco''RI)_F
|CCGGAATTCCTTCATATTGCCGACAAAGTACG
|CCGGAATTCCTTCATATTGCCGACAAAGTACG
|-
|-
-
|''mAAA(SpeI)_R''
+
|mAAA(''Spe''I)_R
|GGACTAGTTTATCACAGGGGCCGTCCG
|GGACTAGTTTATCACAGGGGCCGTCCG
|-
|-
-
|''PzntA(XbaI)_F''
+
|PzntA(''Xba''I)_F
|GCTCTAGACGTCCGCTCGCTGTATCTC
|GCTCTAGACGTCCGCTCGCTGTATCTC
|-
|-
-
|''RFP(PstI)_R''
+
|RFP(''Pst''I)_R
|AACTGCAGCGGCCGCTACTAGTTTATTAAGCACCGGTGGAGTGA
|AACTGCAGCGGCCGCTACTAGTTTATTAAGCACCGGTGGAGTGA
|-
|-
-
|''ParsR(XbaI)_F''
+
|ParsR(''Xba''I)_F
|GCTCTAGACCAACTCAAAATTCACACCTATTAC
|GCTCTAGACCAACTCAAAATTCACACCTATTAC
|-
|-
-
|''GFP(PstI)_R''
+
|GFP(''Pst''I)_R
|AACTGCAGTTAAGGCCTTTTGTATAGTTCATCC
|AACTGCAGTTAAGGCCTTTTGTATAGTTCATCC
|}
|}
-
 
-
[[Image:AaaaaaaaFigure_1.jpg|left|140px|frame|figure1. lane1;M-lane2;''E. coli'' K12 genomic DNA extraction]]
 
-
<br><br><br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
-
<br><br>
 
== [ Preparation of competent cells ] 2010-09-01 ~ 2010-09-03 ==
== [ Preparation of competent cells ] 2010-09-01 ~ 2010-09-03 ==
Line 95: Line 78:
2. Preparation of 200mL 2x LB broth, TSS solution and LB plates with ampicillin(100μg/mL) and chloramphenicol(25μg /mL), respectively
2. Preparation of 200mL 2x LB broth, TSS solution and LB plates with ampicillin(100μg/mL) and chloramphenicol(25μg /mL), respectively
-
3. Inoculation of subcultured E. coli to 200mL 2x LB borth
+
3. Inoculation of subcultured ''E. coli'' to 200mL 2x LB borth
4. Preparation of competent cells by CSBL laboratory protocol
4. Preparation of competent cells by CSBL laboratory protocol
Line 125: Line 108:
2. 20uL suspension by autoclaved distilled water
2. 20uL suspension by autoclaved distilled water
-
3. 3uL transformation to E. coli DH5α
+
3. 3uL transformation to ''E. coli'' DH5α
4. Plating to LB(Amp100), LB(Cm25)
4. Plating to LB(Amp100), LB(Cm25)
Line 134: Line 117:
1. Inoculation for plasmid DNA purification
1. Inoculation for plasmid DNA purification
-
2. E. coli K12 genomic DNA extraction by AccuPrep® Genomic DNA Extraction Kit
+
2. ''E. coli'' K12 genomic DNA extraction by AccuPrep® Genomic DNA Extraction Kit
3. Confirmation of genomic DNA by agarose gel electrophoresis (Figure 1)
3. Confirmation of genomic DNA by agarose gel electrophoresis (Figure 1)
4. Quantification of DNA concentration by NanoDrop : 137.5ng/μL
4. Quantification of DNA concentration by NanoDrop : 137.5ng/μL
 +
 +
 +
[[Image:Real_figure_1.jpg|left|140px|frame|figure1. lane1;M-lane2;''E. coli'' K12 genomic DNA extraction]]
 +
 +
 +
<br><br><br><br><br><br><br><br><br>br>
 +
<br><br><br><br><br><br><br><br><br><br>
 +
<br><br><br><br><br><br><br><br><br><br>
 +
<br><br><br><br><br><br><br><br><br><br>
== [ Plasmid DNA extraction : pSB1A3 and pSB1C3 ] 2010-09-07==
== [ Plasmid DNA extraction : pSB1A3 and pSB1C3 ] 2010-09-07==
Line 193: Line 185:
== [ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16==
== [ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16==
<br/>
<br/>
-
1. PCR : ''PyodA''-mAAA, ''PzntA''-RFP(BBa_E1010) and ''ParsR''-GFP(BBa_E0040)
+
1. PCR : PyodA-mAAA, PzntA-RFP(BBa_E1010) and ParsR-GFP(BBa_E0040)
<br/>
<br/>
{| border="2"
{| border="2"
Line 241: Line 233:
<br/>
<br/>
<br/>
<br/>
 +
<br/>
 +
<br/><br/>
 +
<br/><br/><br/><br/><br/><br/><br/>
== [ Digestion] 2010-09-17 ==
== [ Digestion] 2010-09-17 ==
1. Digestion of PCR products and pSB1A2
1. Digestion of PCR products and pSB1A2
-
:1) ''PyodA''-mAAA : EcoRI and SpeI
+
:1) PyodA-mAAA : ''Eco''RI and ''Spe''I
-
:2) ''PzntA''-RFP : XbaI and PstI
+
:2) PzntA-RFP : ''Xba''I and ''Pst''I
-
:3) pSB1A3 : EcoRI and PstI
+
:3) pSB1A3 : ''Eco''RI and ''Pst''I
<br/>
<br/>
{| border="2"
{| border="2"
Line 277: Line 272:
3. Quantification of DNA concentration by NanoDrop
3. Quantification of DNA concentration by NanoDrop
-
 
-
[[Image:Figure2 실험.png|140px|left|frame|figure3.lane1;M-lane2;(PyodA-mAAA)-lane3;(Pznt-RFP)-lane4;(ParsR-GFP)]]
 
-
 
Line 285: Line 277:
 +
[[Image:4 Figure3 실험.png|left|140px|frame|figure4.M pSB1A2(''Eco''RI/''Pst''I) PyodA-mAAA(''Eco''RI/''Spe''I) PzntA-RFP(''Xba''I/''Pst''I)]]
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
<br/>
<br/>
<br/>
<br/>
Line 360: Line 373:
3. Recombinant plasmid sequencing by COSMO GeneTech
3. Recombinant plasmid sequencing by COSMO GeneTech
-
<br/>
+
[[Image:5_Figure4_실험.png|left|140px|frame|figure5. lane1;M-lane2; (pSB1A2)-[PyodA-mAA-Pznt-RFP] #1,2,3]]
-
<br/>
+
 
 +
<br><br>
 +
<br><br><br><br><br><br><br><br><br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br><br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br><br><br><br><br>
 +
 
== [ Digestion ] 2010-10-01 ~ 2010-10-03==
== [ Digestion ] 2010-10-01 ~ 2010-10-03==
<br/>
<br/>
1. Check : recombinant plasmid sequence
1. Check : recombinant plasmid sequence
2. Selection of correct clones
2. Selection of correct clones
-
3. Digestion of PCR products(''ParsR''-GFP) and pSB1C3
+
3. Digestion of PCR products(ParsR-GFP) and pSB1C3
-
:1) ''ParsR''-GFP : EcoRI and SpeI
+
:1) PyodA-mAAA-PzntA-RFP : ''Eco''RI and ''Spe''I
-
:2) pSB1C3 : EcoRI and PstI
+
:2) ParsR-GFP : ''Eco''RI and ''Spe''I
 +
:3) pSB1C3 : ''Eco''RI and ''Pst''I
<br/>
<br/>
{| border="2"
{| border="2"
Line 394: Line 420:
<br/>
<br/>
4. Confirmation of digested products by agarose gel electrophoresis (Figure 6)
4. Confirmation of digested products by agarose gel electrophoresis (Figure 6)
 +
[[Image:Figure6 aaa.png|left|140px|frame|figure6. lane1; M-lane2; (PyodA-mAAA-PzntA-RFP(EcoRI/SpeI))-lane3; (ParsR-GFP(XbaI/SpeI))-lane4; (pSB1C3(EcoRI/PstI))]]
 +
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
 +
5. Quantification of DNA concentration by NanoDrop
5. Quantification of DNA concentration by NanoDrop
-
6. Ligation of each parts : ''PyodA''-mAAA-''PzntA''-RFP, ''ParsR''-GFP and pSB1C3
+
6. Ligation of each parts : PyodA-mAAA-PzntA-RFP, ParsR-GFP and pSB1C3
<br/>
<br/>
Line 431: Line 486:
<br/>
<br/>
<br/>
<br/>
-
== [ Plasmid DNA extraction : pSB1C3-( ''PyodA''-mAAA-''PzntA''-RFP-''ParsR''-GFP) ] 2010-10-07==
+
== [ Plasmid DNA extraction : pSB1C3-( PyodA-mAAA-PzntA-RFP-ParsR-GFP) ] 2010-10-07==
<br/>
<br/>
1. Plasmid DNA purification by LaboPass™ Plasmid Mini
1. Plasmid DNA purification by LaboPass™ Plasmid Mini
Line 438: Line 493:
3. Recombinant plasmid full-sequencing by COSMO GeneTech
3. Recombinant plasmid full-sequencing by COSMO GeneTech
 +
 +
[[Image:Figure7_실험.png|left|100px|frame|figure7. lane1;M-lane2; (psB1A2) Heavy-metal detector #1~3]]
 +
<br/>
<br/>
<br/>
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
== [ Completion : Heavy-metal detector ] 2010-10-18==
== [ Completion : Heavy-metal detector ] 2010-10-18==
<br/>
<br/>

Latest revision as of 03:58, 28 October 2010

무제 문서 Javascript DHTML Drop Down Menu Powered by dhtml-menu-builder.comJavascript DHTML Drop Down Menu Powered by dhtml-menu-builder.com

Contents

Brain storming & Work notes

Click on a date to see notes on the meeting & summary of labwork done on that day.


June
MTWTFSS
  1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30
July
MTWTFSS
      1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30 31
August
MTWTFSS
            1
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30 31
September
MTWTFSS
    1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30
October
MTWTFSS
        1 2 3
4 5 6 7 8 9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 31


Experimental notes

[Discussion] 2010-08-02 ~ 2010-08-29


1. Strategy and overview of iGEM 2010 experiment Kuprojectmain.png

2. Design of primers

Primer Sequence ( 5’ → 3’ )
PyodA(EcoRI)_F CCGGAATTCCTTCATATTGCCGACAAAGTACG
mAAA(SpeI)_R GGACTAGTTTATCACAGGGGCCGTCCG
PzntA(XbaI)_F GCTCTAGACGTCCGCTCGCTGTATCTC
RFP(PstI)_R AACTGCAGCGGCCGCTACTAGTTTATTAAGCACCGGTGGAGTGA
ParsR(XbaI)_F GCTCTAGACCAACTCAAAATTCACACCTATTAC
GFP(PstI)_R AACTGCAGTTAAGGCCTTTTGTATAGTTCATCC

[ Preparation of competent cells ] 2010-09-01 ~ 2010-09-03


1. Inoculation of E. coli DH5α and E. coli BL21(DE3) to 3mL LB broth

2. Preparation of 200mL 2x LB broth, TSS solution and LB plates with ampicillin(100μg/mL) and chloramphenicol(25μg /mL), respectively

3. Inoculation of subcultured E. coli to 200mL 2x LB borth

4. Preparation of competent cells by CSBL laboratory protocol

5. Transformation of pUC19 plasmid(10ng/μL) to competent cells for transformation efficiency check



[ Transformation efficiency ] 2010-09-04


Strain Number of colonies (colonies/μg DNA)
E. coli DH5α Number of colonies (colonies/μg DNA)
E. coli BL21(DE3) 1.5 x 105



[ Amplification of BioBrick parts : pSB1A2 and pSB1C3 ] 2010-09-05


1. Confirmed location : pSB1A2-BBa_E0040 (2010 Kit plate 1/ 14K) and pSB1C3-BBa_J04450 (2010 Kit plate 1/ 3A)

2. 20uL suspension by autoclaved distilled water

3. 3uL transformation to E. coli DH5α

4. Plating to LB(Amp100), LB(Cm25)

[ Genomic DNA extraction ] 2010-09-06


1. Inoculation for plasmid DNA purification

2. E. coli K12 genomic DNA extraction by AccuPrep® Genomic DNA Extraction Kit

3. Confirmation of genomic DNA by agarose gel electrophoresis (Figure 1)

4. Quantification of DNA concentration by NanoDrop : 137.5ng/μL


figure1. lane1;M-lane2;E. coli K12 genomic DNA extraction











br>





























[ Plasmid DNA extraction : pSB1A3 and pSB1C3 ] 2010-09-07


1. Plasmid miniprep by LaboPass™ Plasmid Mini (Plasmid DNA purification kit)

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 2)

3. Quantification of DNA concentration by NanoDrop

figure2.lane1;M-lane2;pSB1A2-lane3;pSB1C3


































[ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16


1. PCR : PyodA-mAAA, PzntA-RFP(BBa_E1010) and ParsR-GFP(BBa_E0040)

Reagent Volume (μL)
2.5mM dNTP 3
10x buffer 5
Plasmid template (20ng/μL) 2
Primers (10pmole/μL) 4
α-Taq DNA polymerase (5U/μL) 0.5
D.W. 35.5/total=50
95˚C(2’)-[95˚C(20”)-55˚C(20”)-72˚C(2’)]30-72˚C(5’)-4˚C


2. Confirmation of PCR products by agarose gel electrophoresis (Figure 3)

3. Purified PCR products

4. Quantification of DNA concentration by NanoDrop


figure3.lane1;M-lane2;(PyodA-mAAA)-lane3;(Pznt-RFP)-lane4;(ParsR-GFP)








































[ Digestion] 2010-09-17

1. Digestion of PCR products and pSB1A2

1) PyodA-mAAA : EcoRI and SpeI
2) PzntA-RFP : XbaI and PstI
3) pSB1A3 : EcoRI and PstI


Reagent Volume (μL)
DNA (about 30ng/μL) 30
10x NEB buffer 2 5
BSA (10mg/mL) 0.5
Appropriate 1st and 2nd restriction enzymes 2 (each 1)
D.W. 12.5 / total = 50
Completely digestion at 37˚C for 2 hours (at least)

and stop at 80˚C for 20min


2. Confirmation of digested products by agarose gel electrophoresis (Figure 4)

3. Quantification of DNA concentration by NanoDrop



figure4.M pSB1A2(EcoRI/PstI) PyodA-mAAA(EcoRI/SpeI) PzntA-RFP(XbaI/PstI)








































[Chuseok, Korean thanksgiving day] 2010-09-20 ~ 2010-09



[ Ligation & Transformation ] 2010-09-27


1. Ligation of each parts : PyodA-mAAA, PzntA-RFP and pSB1A2

Reagent Volume (μL)
10x T4 DNA ligase reaction buffer 2
T4 DNA ligase 2
Each of the digests 2 + 2 + 2 = 8
D.W. 8 / total = 20
Incubation at room temperature for 30min

and stop at 80˚C for 20min


2. Transformation to E. coli DH5α

[ Confirmation of 1st cloning ] 2010-09-28


1. Check : the color of colonies (pSB1A2 : green, recombinant plasmid : white)

2. Inoculation of white colonies to 3mL LB(Amp100)

[ Plasmid DNA extraction : pSB1A2-( PyodA-mAAA-PzntA-RFP) ] 2010-09-29


1. Plasmid DNA purification by LaboPass™ Plasmid Mini

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 5)

3. Recombinant plasmid sequencing by COSMO GeneTech

figure5. lane1;M-lane2; (pSB1A2)-[PyodA-mAA-Pznt-RFP] #1,2,3





































[ Digestion ] 2010-10-01 ~ 2010-10-03


1. Check : recombinant plasmid sequence 2. Selection of correct clones 3. Digestion of PCR products(ParsR-GFP) and pSB1C3

1) PyodA-mAAA-PzntA-RFP : EcoRI and SpeI
2) ParsR-GFP : EcoRI and SpeI
3) pSB1C3 : EcoRI and PstI


Reagent Volume (μL)
DNA (about 30ng/μL) 30
10x NEB buffer 2 5
BSA (10mg/mL) 0.5
Appropriate 1st and 2nd restriction enzymes 2 (each 1)
D.W. 12.5 / total = 50
Completely digestion at 37˚C for 2 hours (at least)

and stop at 80˚C for 20min


4. Confirmation of digested products by agarose gel electrophoresis (Figure 6)

File:Figure6 aaa.png
figure6. lane1; M-lane2; (PyodA-mAAA-PzntA-RFP(EcoRI/SpeI))-lane3; (ParsR-GFP(XbaI/SpeI))-lane4; (pSB1C3(EcoRI/PstI))



























5. Quantification of DNA concentration by NanoDrop

6. Ligation of each parts : PyodA-mAAA-PzntA-RFP, ParsR-GFP and pSB1C3


Reagent Volume (μL)
10x T4 DNA ligase reaction buffer 2
T4 DNA ligase 2
Each of the digests 2 + 2 + 2 = 8
D.W. 8 / total = 20
Incubation at room temperature for 30min

and stop at 80˚C for 20min


7. Transformation to E. coli DH5α

[ Confirmation of 2nd cloning ] 2010-10-06


1. Check : the color of colonies (pSB1C3 : red, recombinant plasmid : white)

2. Inoculation of white colonies to 3mL LB(Amp100)

[ Plasmid DNA extraction : pSB1C3-( PyodA-mAAA-PzntA-RFP-ParsR-GFP) ] 2010-10-07


1. Plasmid DNA purification by LaboPass™ Plasmid Mini

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 7)

3. Recombinant plasmid full-sequencing by COSMO GeneTech

figure7. lane1;M-lane2; (psB1A2) Heavy-metal detector #1~3



























































[ Completion : Heavy-metal detector ] 2010-10-18


1. Check : recombinant plasmid sequence

2. Selection of correct clones

3. Transformation to E. coli BL21(DE3) for expression test



Retrieved from "http://2010.igem.org/Team:Korea_U_Seoul/Notebook"