Team:Korea U Seoul/Notebook

From 2010.igem.org

(Difference between revisions)
(→[ Genomic DNA extraction ] 2010-09-06)
(→[ Digestion ] 2010-10-01 ~ 2010-10-03)
 
(33 intermediate revisions not shown)
Line 53: Line 53:
!Sequence ( 5’ → 3’ )
!Sequence ( 5’ → 3’ )
|-
|-
-
|''PyodA(EcoRI)_F''
+
|PyodA(''Eco''RI)_F
|CCGGAATTCCTTCATATTGCCGACAAAGTACG
|CCGGAATTCCTTCATATTGCCGACAAAGTACG
|-
|-
-
|''mAAA(SpeI)_R''
+
|mAAA(''Spe''I)_R
|GGACTAGTTTATCACAGGGGCCGTCCG
|GGACTAGTTTATCACAGGGGCCGTCCG
|-
|-
-
|''PzntA(XbaI)_F''
+
|PzntA(''Xba''I)_F
|GCTCTAGACGTCCGCTCGCTGTATCTC
|GCTCTAGACGTCCGCTCGCTGTATCTC
|-
|-
-
|''RFP(PstI)_R''
+
|RFP(''Pst''I)_R
|AACTGCAGCGGCCGCTACTAGTTTATTAAGCACCGGTGGAGTGA
|AACTGCAGCGGCCGCTACTAGTTTATTAAGCACCGGTGGAGTGA
|-
|-
-
|''ParsR(XbaI)_F''
+
|ParsR(''Xba''I)_F
|GCTCTAGACCAACTCAAAATTCACACCTATTAC
|GCTCTAGACCAACTCAAAATTCACACCTATTAC
|-
|-
-
|''GFP(PstI)_R''
+
|GFP(''Pst''I)_R
|AACTGCAGTTAAGGCCTTTTGTATAGTTCATCC
|AACTGCAGTTAAGGCCTTTTGTATAGTTCATCC
|}
|}
-
<br><br>
 
== [ Preparation of competent cells ] 2010-09-01 ~ 2010-09-03 ==
== [ Preparation of competent cells ] 2010-09-01 ~ 2010-09-03 ==
Line 79: Line 78:
2. Preparation of 200mL 2x LB broth, TSS solution and LB plates with ampicillin(100μg/mL) and chloramphenicol(25μg /mL), respectively
2. Preparation of 200mL 2x LB broth, TSS solution and LB plates with ampicillin(100μg/mL) and chloramphenicol(25μg /mL), respectively
-
3. Inoculation of subcultured E. coli to 200mL 2x LB borth
+
3. Inoculation of subcultured ''E. coli'' to 200mL 2x LB borth
4. Preparation of competent cells by CSBL laboratory protocol
4. Preparation of competent cells by CSBL laboratory protocol
Line 109: Line 108:
2. 20uL suspension by autoclaved distilled water
2. 20uL suspension by autoclaved distilled water
-
3. 3uL transformation to E. coli DH5α
+
3. 3uL transformation to ''E. coli'' DH5α
4. Plating to LB(Amp100), LB(Cm25)
4. Plating to LB(Amp100), LB(Cm25)
Line 118: Line 117:
1. Inoculation for plasmid DNA purification
1. Inoculation for plasmid DNA purification
-
2. E. coli K12 genomic DNA extraction by AccuPrep® Genomic DNA Extraction Kit
+
2. ''E. coli'' K12 genomic DNA extraction by AccuPrep® Genomic DNA Extraction Kit
3. Confirmation of genomic DNA by agarose gel electrophoresis (Figure 1)
3. Confirmation of genomic DNA by agarose gel electrophoresis (Figure 1)
Line 124: Line 123:
4. Quantification of DNA concentration by NanoDrop : 137.5ng/μL
4. Quantification of DNA concentration by NanoDrop : 137.5ng/μL
-
[[Image:Figure1_실험.png‎ |250px|center|frame|figure1. M-pSB1A2-pSB1C3]]
 
 +
[[Image:Real_figure_1.jpg|left|140px|frame|figure1. lane1;M-lane2;''E. coli'' K12 genomic DNA extraction]]
-
 
+
<br><br><br><br><br><br><br><br><br>br>
-
 
+
<br><br><br><br><br><br><br><br><br><br>
-
 
+
<br><br><br><br><br><br><br><br><br><br>
-
 
+
<br><br><br><br><br><br><br><br><br><br>
-
<br/>
+
-
<br/>
+
== [ Plasmid DNA extraction : pSB1A3 and pSB1C3 ] 2010-09-07==
== [ Plasmid DNA extraction : pSB1A3 and pSB1C3 ] 2010-09-07==
Line 142: Line 139:
3. Quantification of DNA concentration by NanoDrop
3. Quantification of DNA concentration by NanoDrop
-
 
+
[[Image:Figure1_실험.png‎ |250px|left|frame|figure2.'''lane1;M-lane2;pSB1A2-lane3;pSB1C3''']]
-
[[Image:Zzzz2.JPG|left|150px|figure 2.]]
+
Line 151: Line 147:
 +
<br><br>
 +
<br><br><br>
 +
<br>
 +
<br><br>
 +
<br>
 +
<br><br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
Line 176: Line 185:
== [ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16==
== [ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16==
<br/>
<br/>
-
1. PCR : ''PyodA''-mAAA, ''PzntA''-RFP(BBa_E1010) and ''ParsR''-GFP(BBa_E0040)
+
1. PCR : PyodA-mAAA, PzntA-RFP(BBa_E1010) and ParsR-GFP(BBa_E0040)
<br/>
<br/>
{| border="2"
{| border="2"
Line 209: Line 218:
4. Quantification of DNA concentration by NanoDrop
4. Quantification of DNA concentration by NanoDrop
-
[[Image:Figure3 실험.png|250px|figure3.]]
 
 +
[[Image:Figure2 실험.png|140px|left|frame|figure3.lane1;M-lane2;(PyodA-mAAA)-lane3;(Pznt-RFP)-lane4;(ParsR-GFP)]]
Line 218: Line 227:
 +
<br/><br/><br/><br/><br/><br/>
 +
<br/><br/><br/><br/><br/><br/>
 +
<br/><br/><br/><br/><br/><br/>
 +
<br/><br/><br/><br/><br/><br/>
<br/>
<br/>
<br/>
<br/>
 +
<br/>
 +
<br/><br/>
 +
<br/><br/><br/><br/><br/><br/><br/>
== [ Digestion] 2010-09-17 ==
== [ Digestion] 2010-09-17 ==
1. Digestion of PCR products and pSB1A2
1. Digestion of PCR products and pSB1A2
-
:1) ''PyodA''-mAAA : EcoRI and SpeI
+
:1) PyodA-mAAA : ''Eco''RI and ''Spe''I
-
:2) ''PzntA''-RFP : XbaI and PstI
+
:2) PzntA-RFP : ''Xba''I and ''Pst''I
-
:3) pSB1A3 : EcoRI and PstI
+
:3) pSB1A3 : ''Eco''RI and ''Pst''I
<br/>
<br/>
{| border="2"
{| border="2"
Line 257: Line 273:
3. Quantification of DNA concentration by NanoDrop
3. Quantification of DNA concentration by NanoDrop
-
[[Image:Figure3 실험.png|250px|figure4]]
 
 +
[[Image:4 Figure3 실험.png|left|140px|frame|figure4.M pSB1A2(''Eco''RI/''Pst''I) PyodA-mAAA(''Eco''RI/''Spe''I) PzntA-RFP(''Xba''I/''Pst''I)]]
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
 +
<br/>
 +
<br/>
 +
 +
<br/>
 +
<br/>
 +
 +
<br/>
 +
<br/>
 +
 +
<br/>
 +
<br/>
 +
 +
<br/>
 +
<br/>
 +
 +
<br/>
 +
<br/>
<br/>
<br/>
Line 315: Line 373:
3. Recombinant plasmid sequencing by COSMO GeneTech
3. Recombinant plasmid sequencing by COSMO GeneTech
-
<br/>
+
[[Image:5_Figure4_실험.png|left|140px|frame|figure5. lane1;M-lane2; (pSB1A2)-[PyodA-mAA-Pznt-RFP] #1,2,3]]
-
<br/>
+
 
 +
<br><br>
 +
<br><br><br><br><br><br><br><br><br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br><br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br><br><br><br><br>
 +
 
== [ Digestion ] 2010-10-01 ~ 2010-10-03==
== [ Digestion ] 2010-10-01 ~ 2010-10-03==
<br/>
<br/>
1. Check : recombinant plasmid sequence
1. Check : recombinant plasmid sequence
2. Selection of correct clones
2. Selection of correct clones
-
3. Digestion of PCR products(''ParsR''-GFP) and pSB1C3
+
3. Digestion of PCR products(ParsR-GFP) and pSB1C3
-
:1) ''ParsR''-GFP : EcoRI and SpeI
+
:1) PyodA-mAAA-PzntA-RFP : ''Eco''RI and ''Spe''I
-
:2) pSB1C3 : EcoRI and PstI
+
:2) ParsR-GFP : ''Eco''RI and ''Spe''I
 +
:3) pSB1C3 : ''Eco''RI and ''Pst''I
<br/>
<br/>
{| border="2"
{| border="2"
Line 349: Line 420:
<br/>
<br/>
4. Confirmation of digested products by agarose gel electrophoresis (Figure 6)
4. Confirmation of digested products by agarose gel electrophoresis (Figure 6)
 +
[[Image:Figure6 aaa.png|left|140px|frame|figure6. lane1; M-lane2; (PyodA-mAAA-PzntA-RFP(EcoRI/SpeI))-lane3; (ParsR-GFP(XbaI/SpeI))-lane4; (pSB1C3(EcoRI/PstI))]]
 +
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
 +
5. Quantification of DNA concentration by NanoDrop
5. Quantification of DNA concentration by NanoDrop
-
6. Ligation of each parts : ''PyodA''-mAAA-''PzntA''-RFP, ''ParsR''-GFP and pSB1C3
+
6. Ligation of each parts : PyodA-mAAA-PzntA-RFP, ParsR-GFP and pSB1C3
<br/>
<br/>
Line 378: Line 478:
<br/>
<br/>
<br/>
<br/>
 +
== [ Confirmation of 2nd cloning ] 2010-10-06==
== [ Confirmation of 2nd cloning ] 2010-10-06==
<br/>
<br/>
Line 385: Line 486:
<br/>
<br/>
<br/>
<br/>
-
== [ Plasmid DNA extraction : pSB1C3-( ''PyodA''-mAAA-''PzntA''-RFP-''ParsR''-GFP) ] 2010-10-07==
+
== [ Plasmid DNA extraction : pSB1C3-( PyodA-mAAA-PzntA-RFP-ParsR-GFP) ] 2010-10-07==
<br/>
<br/>
1. Plasmid DNA purification by LaboPass™ Plasmid Mini
1. Plasmid DNA purification by LaboPass™ Plasmid Mini
Line 392: Line 493:
3. Recombinant plasmid full-sequencing by COSMO GeneTech
3. Recombinant plasmid full-sequencing by COSMO GeneTech
 +
 +
[[Image:Figure7_실험.png|left|100px|frame|figure7. lane1;M-lane2; (psB1A2) Heavy-metal detector #1~3]]
 +
<br/>
<br/>
<br/>
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
== [ Completion : Heavy-metal detector ] 2010-10-18==
== [ Completion : Heavy-metal detector ] 2010-10-18==
<br/>
<br/>

Latest revision as of 03:58, 28 October 2010

무제 문서 Javascript DHTML Drop Down Menu Powered by dhtml-menu-builder.comJavascript DHTML Drop Down Menu Powered by dhtml-menu-builder.com

Contents

Brain storming & Work notes

Click on a date to see notes on the meeting & summary of labwork done on that day.


June
MTWTFSS
  1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30
July
MTWTFSS
      1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30 31
August
MTWTFSS
            1
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30 31
September
MTWTFSS
    1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30
October
MTWTFSS
        1 2 3
4 5 6 7 8 9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 31


Experimental notes

[Discussion] 2010-08-02 ~ 2010-08-29


1. Strategy and overview of iGEM 2010 experiment Kuprojectmain.png

2. Design of primers

Primer Sequence ( 5’ → 3’ )
PyodA(EcoRI)_F CCGGAATTCCTTCATATTGCCGACAAAGTACG
mAAA(SpeI)_R GGACTAGTTTATCACAGGGGCCGTCCG
PzntA(XbaI)_F GCTCTAGACGTCCGCTCGCTGTATCTC
RFP(PstI)_R AACTGCAGCGGCCGCTACTAGTTTATTAAGCACCGGTGGAGTGA
ParsR(XbaI)_F GCTCTAGACCAACTCAAAATTCACACCTATTAC
GFP(PstI)_R AACTGCAGTTAAGGCCTTTTGTATAGTTCATCC

[ Preparation of competent cells ] 2010-09-01 ~ 2010-09-03


1. Inoculation of E. coli DH5α and E. coli BL21(DE3) to 3mL LB broth

2. Preparation of 200mL 2x LB broth, TSS solution and LB plates with ampicillin(100μg/mL) and chloramphenicol(25μg /mL), respectively

3. Inoculation of subcultured E. coli to 200mL 2x LB borth

4. Preparation of competent cells by CSBL laboratory protocol

5. Transformation of pUC19 plasmid(10ng/μL) to competent cells for transformation efficiency check



[ Transformation efficiency ] 2010-09-04


Strain Number of colonies (colonies/μg DNA)
E. coli DH5α Number of colonies (colonies/μg DNA)
E. coli BL21(DE3) 1.5 x 105



[ Amplification of BioBrick parts : pSB1A2 and pSB1C3 ] 2010-09-05


1. Confirmed location : pSB1A2-BBa_E0040 (2010 Kit plate 1/ 14K) and pSB1C3-BBa_J04450 (2010 Kit plate 1/ 3A)

2. 20uL suspension by autoclaved distilled water

3. 3uL transformation to E. coli DH5α

4. Plating to LB(Amp100), LB(Cm25)

[ Genomic DNA extraction ] 2010-09-06


1. Inoculation for plasmid DNA purification

2. E. coli K12 genomic DNA extraction by AccuPrep® Genomic DNA Extraction Kit

3. Confirmation of genomic DNA by agarose gel electrophoresis (Figure 1)

4. Quantification of DNA concentration by NanoDrop : 137.5ng/μL


figure1. lane1;M-lane2;E. coli K12 genomic DNA extraction











br>





























[ Plasmid DNA extraction : pSB1A3 and pSB1C3 ] 2010-09-07


1. Plasmid miniprep by LaboPass™ Plasmid Mini (Plasmid DNA purification kit)

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 2)

3. Quantification of DNA concentration by NanoDrop

figure2.lane1;M-lane2;pSB1A2-lane3;pSB1C3


































[ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16


1. PCR : PyodA-mAAA, PzntA-RFP(BBa_E1010) and ParsR-GFP(BBa_E0040)

Reagent Volume (μL)
2.5mM dNTP 3
10x buffer 5
Plasmid template (20ng/μL) 2
Primers (10pmole/μL) 4
α-Taq DNA polymerase (5U/μL) 0.5
D.W. 35.5/total=50
95˚C(2’)-[95˚C(20”)-55˚C(20”)-72˚C(2’)]30-72˚C(5’)-4˚C


2. Confirmation of PCR products by agarose gel electrophoresis (Figure 3)

3. Purified PCR products

4. Quantification of DNA concentration by NanoDrop


figure3.lane1;M-lane2;(PyodA-mAAA)-lane3;(Pznt-RFP)-lane4;(ParsR-GFP)








































[ Digestion] 2010-09-17

1. Digestion of PCR products and pSB1A2

1) PyodA-mAAA : EcoRI and SpeI
2) PzntA-RFP : XbaI and PstI
3) pSB1A3 : EcoRI and PstI


Reagent Volume (μL)
DNA (about 30ng/μL) 30
10x NEB buffer 2 5
BSA (10mg/mL) 0.5
Appropriate 1st and 2nd restriction enzymes 2 (each 1)
D.W. 12.5 / total = 50
Completely digestion at 37˚C for 2 hours (at least)

and stop at 80˚C for 20min


2. Confirmation of digested products by agarose gel electrophoresis (Figure 4)

3. Quantification of DNA concentration by NanoDrop



figure4.M pSB1A2(EcoRI/PstI) PyodA-mAAA(EcoRI/SpeI) PzntA-RFP(XbaI/PstI)








































[Chuseok, Korean thanksgiving day] 2010-09-20 ~ 2010-09



[ Ligation & Transformation ] 2010-09-27


1. Ligation of each parts : PyodA-mAAA, PzntA-RFP and pSB1A2

Reagent Volume (μL)
10x T4 DNA ligase reaction buffer 2
T4 DNA ligase 2
Each of the digests 2 + 2 + 2 = 8
D.W. 8 / total = 20
Incubation at room temperature for 30min

and stop at 80˚C for 20min


2. Transformation to E. coli DH5α

[ Confirmation of 1st cloning ] 2010-09-28


1. Check : the color of colonies (pSB1A2 : green, recombinant plasmid : white)

2. Inoculation of white colonies to 3mL LB(Amp100)

[ Plasmid DNA extraction : pSB1A2-( PyodA-mAAA-PzntA-RFP) ] 2010-09-29


1. Plasmid DNA purification by LaboPass™ Plasmid Mini

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 5)

3. Recombinant plasmid sequencing by COSMO GeneTech

figure5. lane1;M-lane2; (pSB1A2)-[PyodA-mAA-Pznt-RFP] #1,2,3





































[ Digestion ] 2010-10-01 ~ 2010-10-03


1. Check : recombinant plasmid sequence 2. Selection of correct clones 3. Digestion of PCR products(ParsR-GFP) and pSB1C3

1) PyodA-mAAA-PzntA-RFP : EcoRI and SpeI
2) ParsR-GFP : EcoRI and SpeI
3) pSB1C3 : EcoRI and PstI


Reagent Volume (μL)
DNA (about 30ng/μL) 30
10x NEB buffer 2 5
BSA (10mg/mL) 0.5
Appropriate 1st and 2nd restriction enzymes 2 (each 1)
D.W. 12.5 / total = 50
Completely digestion at 37˚C for 2 hours (at least)

and stop at 80˚C for 20min


4. Confirmation of digested products by agarose gel electrophoresis (Figure 6)

File:Figure6 aaa.png
figure6. lane1; M-lane2; (PyodA-mAAA-PzntA-RFP(EcoRI/SpeI))-lane3; (ParsR-GFP(XbaI/SpeI))-lane4; (pSB1C3(EcoRI/PstI))



























5. Quantification of DNA concentration by NanoDrop

6. Ligation of each parts : PyodA-mAAA-PzntA-RFP, ParsR-GFP and pSB1C3


Reagent Volume (μL)
10x T4 DNA ligase reaction buffer 2
T4 DNA ligase 2
Each of the digests 2 + 2 + 2 = 8
D.W. 8 / total = 20
Incubation at room temperature for 30min

and stop at 80˚C for 20min


7. Transformation to E. coli DH5α

[ Confirmation of 2nd cloning ] 2010-10-06


1. Check : the color of colonies (pSB1C3 : red, recombinant plasmid : white)

2. Inoculation of white colonies to 3mL LB(Amp100)

[ Plasmid DNA extraction : pSB1C3-( PyodA-mAAA-PzntA-RFP-ParsR-GFP) ] 2010-10-07


1. Plasmid DNA purification by LaboPass™ Plasmid Mini

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 7)

3. Recombinant plasmid full-sequencing by COSMO GeneTech

figure7. lane1;M-lane2; (psB1A2) Heavy-metal detector #1~3



























































[ Completion : Heavy-metal detector ] 2010-10-18


1. Check : recombinant plasmid sequence

2. Selection of correct clones

3. Transformation to E. coli BL21(DE3) for expression test



Retrieved from "http://2010.igem.org/Team:Korea_U_Seoul/Notebook"