Team:Freiburg Software/Meetings

From 2010.igem.org

(Difference between revisions)
 
(9 intermediate revisions not shown)
Line 22: Line 22:
<h1>Meetings</h1>
<h1>Meetings</h1>
<p class="main">
<p class="main">
-
</html>
 
-
=September=
 
-
==<font style="font-size: 12px;">Sep. 24 2010</font>==
 
-
Niklas, Paul, Paresh, Kristian, Fabian
 
-
* Do we need all of the three Requirements for a gold medal or just one of these? -> E-Mail to the HQ
 
-
* Collaboration -> The things we have done are not enough. We could implement a converter for Geneious <-> BioBrick&trade; formate. An other idea was to write a program that helps the Labteam to design primer.
 
-
* Niklas showed us his Blast-Search-Robot. It works good. One question was the menu button position.
+
<h1>September</h1>
-
* Paresh made a translation-Robot. The six-reading-frame still a problem.
+
<h2><font style="font-size: 12px;">Sep. 24 2010</font></h2>
-
* But now they can upload to sourceforge.
+
<p class="main"><i>Niklas, Paul, Paresh, Kristian, Fabian</i></p>
 +
<p class="main"><ul>
 +
<li>Do we need all of the three Requirements for a gold medal or just one of these? -> E-Mail to the HQ<br />
 +
<li>Collaboration -> The things we have done are not enough. We could implement a converter for Geneious <->BioBrick&trade; formate. An other idea was to write a program that helps the Labteam to design primer.<br />
 +
<li>Niklas showed us his Blast-Search-Robot. It works good. One question was the menu button position.<br />
 +
<li>Paresh made a translation-Robot. The six-reading-frame still a problem.<br />
 +
<li>But now they can upload to sourceforge.<br />
-
* For the Human practise we could write a Safety-Test-Robot witch looks for virus information in the sequence.
+
<li>For the Human practise we could write a Safety-Test-Robot witch looks for virus information in the sequence.<br />
-
* For donation: Niklas have a contact person at SAP. We will write a letter, maybe we get some money.
+
<li>For donation: Niklas have a contact person at SAP. We will write a letter, maybe we get some money.<br />
-
* More function in the wave:
+
<li> More function in the wave:</li>
-
** BioBrick import and export with the option to choose/search a Part by No.
+
<ul><li> BioBrick import and export with the option to choose/search a Part by No.</li>
-
** The same for other Databases e.g. Genbank
+
        <li>The same for other Databases e.g. Genbank</li>
-
** seaching for restriction-sites
+
        <li>seaching for restriction-sites</li></ul>
 +
</li>   
 +
</ul>
 +
</p>
-
==<font style="font-size: 12px;">Sep. 27 2010</font>==
+
<h2><font style="font-size: 12px;">Sep. 27 2010</font></h2>
-
Niklas, Paresh, Fabian
+
<p class="main"><i>Niklas, Paresh, Fabian</i></p>
 +
<ul>
 +
<li>Spoke about the conversation Fabian and Paul had with Kristian<br />
 +
<li>Fabian showed some new ideas for robots and explained the biology behind them.<br />
 +
<ul><li>Primer design</li>
 +
        <li>Colored DNA tripplet</li>
 +
        <li>Database download</li>
 +
        <li>Virus check</li>
 +
    </ul>
 +
</ul>
 +
<p class="main">Paresh had the idea for a Umbrella-robot. It lists all the available robots and lets them add in the wave. We meet Fr. 1.oct. 7pm at bio II/III
 +
</p>
-
* Spoke about the conversation Fabian and Paul had with Kristian
+
<h2><font style="font-size: 12px;">Sep. 30 2010</font></h2>
-
* Fabian showed some new ideas for robots and explained the biology behind them.
+
-
** Primer design
+
-
** colored DNA tripplet
+
-
** Database download
+
-
** Virus check
+
-
Paresh had the idea for a Umbrella-robot. It lists all the available robots and lets them add in the wave.<br /><br />
+
-
We meet Fr. 1.oct. 7pm at bio II/III
+
-
==<font style="font-size: 12px;">Sep. 30 2010</font>==
+
<p class="main"><i>Niklas, Paresh, Fabian, Volker (LabTeam)</i></p>
 +
<ul>
 +
<li>Volker explained us the rules for primers design.</li>
 +
<li>The Translation Robot and the Blast Robot are fixed. There are a new local alignment Robot (Niklas)</li>
 +
<li>Kristian is not here tomorrow so we will write him an e-mail to show him the new Robots.</li>
 +
</ul>
 +
</p>
-
Niklas, Paresh, Fabian, Volker (LabTeam)
+
<h1>October</h1>
 +
<h2><font style="font-size: 12px;">Oct. 5 2010</font></h2>
 +
<p class="main"><i>Kristian, Fabian</i></p>
 +
<p class="main">Fabian showed Kristian the new robots and discussed the functionality and the usability.</p>
 +
<p class="main">
-
* Volker explained us the rules for primers design.
+
<ul><li> Translation Robot (translation-beta@appspot.com)</li>
-
* The Translation Robot and the Blast Robot are fixed. There are a new local alignment Robot (Niklas)
+
  <li>The view should be something like 1. original DNA-Strand 2. first Frame (with all proteins) a.s.o. and all among each other.</li>
-
* Kristian is not here tomorrow so we will write him an e-mail to show him the new Robots.
+
  <li> ATGGAATTCTCGCTCTAGCTACGTAGCTATGGAATTCTCGCTCTAG</li>
-
=October=
+
  <li> -M--E--F--S--L--*------------M--E--F--S--L--*- (look for the right positions in the edit window)</li>
-
==<font style="font-size: 12px;">Oct. 5 2010</font>==
+
  <li>In the input matrix there should be an option to choose the start/stop codons and something to choose the organism.</li>
-
Kristian, Fabian<br />
+
</ul>
-
Fabian showed Kristian the new robots and discussed the functionality and the usability.
+
-
* Translation Robot (translation-beta@appspot.com)
+
-
** The view should be something like 1. original DNA-Strand 2. first Frame (with all proteins) a.s.o. and all among each other.
+
-
** ATGGAATTCTCGCTCTAGCTACGTAGCTATGGAATTCTCGCTCTAG
+
-
** -M--E--F--S--L--*------------M--E--F--S--L--*- (look for the right positions in the edit window)<br />
+
-
** In the input matrix there should be an option to choose the start/stop codons and something to choose the organism.<br />
+
-
<br />
+
-
* Primer Design Robot (synbiowave-primerdesigner@appspot.com)
+
-
** An option to choose the add-on-tail (iGEM standard, own sequence, none)
+
-
** Maybe we could implement two different versions to calculate the temperature.
+
-
<br />
+
-
* Restriction Enzymes Robot (REBase)
+
-
** Imput:
+
-
*** Enzymes from the workspace (could be more than 50 to select like the sequences). or something to type it like this: EcoRI, XbaI, ... . One selection for iGEM.
+
-
*** min and max cut (the length the enzymes will cut)
+
-
** output
+
-
*** EcoRI: Start: 10, 55, 126, ... XbaI: Start: 26, 71, 99, ... <br />
+
-
view like this: EcoRI |    XbaI |<br />
+
-
GCATGCGCTAGCTGCTGAGCATGAATTCACTGTTCTAGAATCGTACT (look for the right positions in the edit window)<br /><br />
+
-
* Alignment Robot (alignobot@appspot.com)
+
-
** Show the algorithm which is used (niedelman/wunsch...smith waterman...).
+
-
* Blast Robot
+
-
** restart the BlastRobot Project
+
-
<br />
+
-
Is it possible to scroll the menu with the wave?<br />
+
-
<br />
+
-
3rd wave for graphics like the workspace.
+
-
==<font style="font-size: 12px;">Oct. 7 2010</font>==
+
<ul>
-
Fabian, Kristian, Niklas
+
  <li>Primer Design Robot (synbiowave-primerdesigner@appspot.com)</li>
-
We discussed some (new) Ideas we could implement:
+
  <li> An option to choose the add-on-tail (iGEM standard, own sequence, none)</li>
-
* Ligate Bioprick parts
+
  <li>Maybe we could implement two different versions to calculate the temperature.</li>
-
* Import of GenBank etc is important
+
</ul>
-
* Display features (annotations)
+
<ul>
-
* Is it possible to work with selected Sequences in the main Wave?
+
    <li> Restriction Enzymes Robot (REBase)</li>
 +
      <ul>
 +
          <li>Imput:</li>
 +
          <li>Enzymes from the workspace (could be more than 50 to select like the sequences). or something to type it like this: EcoRI, XbaI, ... . One selection for iGEM.</li>
 +
          <li>min and max cut (the length the enzymes will cut)</li>
 +
      </ul>
 +
    </li>
 +
      <ul>
 +
        <li>output</li>
 +
        <li>EcoRI: Start: 10, 55, 126, ... XbaI: Start: 26, 71, 99, ...
 +
view like this: EcoRI |    XbaI |</li>
 +
        <li>GCATGCGCTAGCTGCTGAGCATGAATTCACTGTTCTAGAATCGTACT (look for the right positions in the edit window)</li>
 +
      </ul>
 +
    </li>
 +
</ul>
-
Keep 5' -> 3' direction!
+
<ul>
 +
    <li>Alignment Robot (alignobot@appspot.com)</li>
 +
    <li>Show the algorithm which is used (niedelman/wunsch...smith waterman...).</li>
 +
</ul>
-
==<font style="font-size: 12px;">Okt. 11 2010</font>==
+
<ul>
-
Niklas, Fabian, Paresh<br />
+
    <li>Blast Robot</li>
-
* Annotation robot: how to display the output. We will try using the GadgetView Gadget and adjust it to display annotations.
+
    <li>restart the BlastRobot Project</li>
-
* Translation Robot output now looks good. A problem is, that Biojava translate seems to take long. Maybe write own translation method?
+
</ul>
-
* Talked about the organism identifier robot. Checked codon usage database.
+
</p>
-
==<font style="font-size: 12px;">Oct. 12 2010</font>==
+
<p class="main">Is it possible to scroll the menu with the wave?</p>
-
Jörg, Paresh, Fabian, Niklas
+
<p class="main">3rd wave for graphics like the workspace.</p>
-
* Paresh presented the latest version of Translation Robot which works well except for some display issues -> we will move the coloring form the robots to the gadget to gain performance
+
-
* Niklas presented the PartsRegistry import function which got included in the main robot.
+
-
* We created a new synbiowave-V2-001.jar as the new developer library.
+
-
* Next meeting: Oct. 14 @Lab(Kitchen)
+
-
==<font style="font-size: 12px;">Oct. 15 2010</font>==
+
-
Paresh, Fabian, Niklas
+
-
* We created a "roadmap" of all the tasks that we still have to do and assigned each of them to one of us
+
-
===<font style="font-size: 12px;">Roadmap</font>===
+
-
*Wiki
+
-
    * Home (Fabian)
+
-
    * Team (Fabian)
+
-
          o 2010
+
-
          o Photos
+
-
          o Collaboration
+
-
    * Project (Paresh) (Summary)
+
-
          o Prospect
+
-
          o History
+
-
    * User (Niklas)
+
-
          o User Guide (Niklas) (Requirements)
+
-
          o The Robots (Paresh, Niklas)
+
-
    * Developer (Niklas)
+
-
          o Code (Niklas)
+
-
          o Technologies (Niklas) (Wave, BioJava, ...)
+
-
          o Architecture (Paresh)
+
-
          o Availability (Paresh)
+
-
    * Notebook (Fabian)(aka lab journal)
+
-
          o months
+
-
          o meetingspha
+
-
    * Human Practise (Niklas)
+
-
*Coding
+
-
** finish existing robots (Paresh, Niklas)
+
-
** Blast search robot (Niklas)
+
-
** "likelihood" robot (Paresh)
+
-
** Genbank, EMBL import (Niklas)
+
-
** Colorcoding to Javascript (Paresh) <br /><br />
+
-
* '''Deadline: Oct. 24 (meeting TBA)'''
+
-
<html>
+
<h2><font style="font-size: 12px;">Oct. 7 2010</font></h2>
 +
<p class="main"><i>Fabian, Kristian, Niklas</i></p>
 +
<p class="main">We discussed some (new) Ideas we could implement:</p>
 +
<ul><li>Ligate Bioprick parts</li>
 +
<li>Import of GenBank etc is important</li>
 +
<li>Display features (annotations)</li>
 +
<li>Is it possible to work with selected Sequences in the main Wave?</li>
 +
</ul>
 +
<p class="main">Keep 5' -> 3' direction!</p>
 +
 
 +
<h2><font style="font-size: 12px;">Okt. 11 2010</font></h2>
 +
<p class="main"><i>Niklas, Fabian, Paresh</i></p>
 +
<p><ul><li>Annotation robot: how to display the output. We will try using the GadgetView Gadget and adjust it to display annotations.</li>
 +
<li>Translation Robot output now looks good. A problem is, that Biojava translate seems to take long. Maybe write own translation method?</li>
 +
<li>Talked about the organism identifier robot. Checked codon usage database.</li>
 +
</ul>
 +
</p>
 +
<h2><font style="font-size: 12px;">Oct. 12 2010</font></h2>
 +
<p class="main"><i>Jörg, Paresh, Fabian, Niklas</i></p><p>
 +
<ul><li>Paresh presented the latest version of Translation Robot which works well. we will move the coloring form the robots to the gadget to gain performance</li>
 +
<li>Niklas presented the PartsRegistry import function which got included in the main robot. </li>
 +
<li>We created a new synbiowave-V2-001.jar as the new developer library.</li>
 +
<li>Next meeting: Oct. 14 @Lab(Kitchen)</li>
 +
</ul>
 +
</p>
 +
 
 +
<h2><font style="font-size: 12px;">Oct. 15 2010</font></h2>
 +
<p class="main"><i>Paresh, Fabian, Niklas</i></p>
 +
<p class="main">We created a "roadmap" of all the tasks that we still have to do and assigned each of them to one of us
 +
</p>
 +
<p class="main"><font style="font-size: 12px;">Roadmap</font></p>
 +
<ul><li>Wiki</li>
 +
    <li>Home (Fabian)</li>
 +
    <li>Team (Fabian)
 +
      <ul>
 +
      <li>2010</li>
 +
      <li>Photos</li>
 +
      <li>Collaboration </li>
 +
      </ul>
 +
    <li>Project (Paresh) (Summary)
 +
      <ul><li>Prospect</li>
 +
          <li>History </li>
 +
      </ul>
 +
    </li>
 +
    <li>User (Niklas)
 +
    <ul><li>User Guide (Niklas) (Requirements)</li>
 +
          <li>The Robots (Paresh, Niklas) </li>
 +
    </ul>
 +
    </li>
 +
    <li>Developer (Niklas)
 +
      <ul><li>Code (Niklas)</li>
 +
          <li>Technologies (Niklas) (Wave, BioJava, ...)</li>
 +
          <li>Architecture (Paresh)</li>
 +
          <li>Availability (Paresh) </li>
 +
      </ul></li>
 +
    <li>Notebook (Fabian)(aka lab journal)
 +
      <ul><li>months</li>
 +
          <li>meetings</li>
 +
        </ul>
 +
    </li>
 +
    <li>Human Practise (Niklas)</li>
 +
</ul>
 +
<ul><li>Coding<ul>
 +
<li> finish existing robots (Paresh, Niklas)</li>
 +
<li>Blast search robot (Niklas)</li>
 +
<li> "likelihood" robot (Paresh)</li>
 +
<li>Genbank, EMBL import (Niklas)</li>
 +
<li>Colorcoding to Javascript (Paresh) </li>
 +
<li>Deadline: Oct. 24 (meeting TBA)</li>
 +
</ul></li></ul>
 +
</p>
 +
 
 +
<h2><font style="font-size: 12px;">Oct. 21 2010</font></h2>
 +
<p class="main"><i>Fabian, Paresh, Jörg, Niklas</i></p>
 +
<p class="main"><ul><li> We discussed some details of the wiki (pictures, ect.)</li>
 +
<li>Worked together on the new circular view</li>
 +
<li>Tried the new Wave-in-a-box -> The client is still in beta stage and its not sure if robots will work, so no alternative for the jamboree.</li>
 +
</ul>
 +
</p>
 +
 
 +
<h2><font style="font-size: 12px;">Oct. 22- 24 2010</font></h2>
 +
<p class="main"><i>Fabian, Paresh, Niklas</i></p>
 +
<p class="main"><ul><li>Wrote the wiki together</li>
 +
</ul>
 +
</p>
 +
 
 +
<h2><font style="font-size: 12px;">Oct. 25 2010</font></h2>
 +
<p class="main"><i>Fabian, Jörg, Niklas</i></p>
 +
<p class="main"><ul><li>We created the new wave window for graphics</li>
 +
</ul>
</p>
</p>

Latest revision as of 11:36, 26 October 2010

Meetings

September

Sep. 24 2010

Niklas, Paul, Paresh, Kristian, Fabian

  • Do we need all of the three Requirements for a gold medal or just one of these? -> E-Mail to the HQ
  • Collaboration -> The things we have done are not enough. We could implement a converter for Geneious <->BioBrick™ formate. An other idea was to write a program that helps the Labteam to design primer.
  • Niklas showed us his Blast-Search-Robot. It works good. One question was the menu button position.
  • Paresh made a translation-Robot. The six-reading-frame still a problem.
  • But now they can upload to sourceforge.
  • For the Human practise we could write a Safety-Test-Robot witch looks for virus information in the sequence.
  • For donation: Niklas have a contact person at SAP. We will write a letter, maybe we get some money.
  • More function in the wave:
    • BioBrick import and export with the option to choose/search a Part by No.
    • The same for other Databases e.g. Genbank
    • seaching for restriction-sites

Sep. 27 2010

Niklas, Paresh, Fabian

  • Spoke about the conversation Fabian and Paul had with Kristian
  • Fabian showed some new ideas for robots and explained the biology behind them.
    • Primer design
    • Colored DNA tripplet
    • Database download
    • Virus check

Paresh had the idea for a Umbrella-robot. It lists all the available robots and lets them add in the wave. We meet Fr. 1.oct. 7pm at bio II/III

Sep. 30 2010

Niklas, Paresh, Fabian, Volker (LabTeam)

  • Volker explained us the rules for primers design.
  • The Translation Robot and the Blast Robot are fixed. There are a new local alignment Robot (Niklas)
  • Kristian is not here tomorrow so we will write him an e-mail to show him the new Robots.

October

Oct. 5 2010

Kristian, Fabian

Fabian showed Kristian the new robots and discussed the functionality and the usability.

  • Translation Robot (translation-beta@appspot.com)
  • The view should be something like 1. original DNA-Strand 2. first Frame (with all proteins) a.s.o. and all among each other.
  • ATGGAATTCTCGCTCTAGCTACGTAGCTATGGAATTCTCGCTCTAG
  • -M--E--F--S--L--*------------M--E--F--S--L--*- (look for the right positions in the edit window)
  • In the input matrix there should be an option to choose the start/stop codons and something to choose the organism.
  • Primer Design Robot (synbiowave-primerdesigner@appspot.com)
  • An option to choose the add-on-tail (iGEM standard, own sequence, none)
  • Maybe we could implement two different versions to calculate the temperature.
  • Restriction Enzymes Robot (REBase)
    • Imput:
    • Enzymes from the workspace (could be more than 50 to select like the sequences). or something to type it like this: EcoRI, XbaI, ... . One selection for iGEM.
    • min and max cut (the length the enzymes will cut)
    • output
    • EcoRI: Start: 10, 55, 126, ... XbaI: Start: 26, 71, 99, ... view like this: EcoRI | XbaI |
    • GCATGCGCTAGCTGCTGAGCATGAATTCACTGTTCTAGAATCGTACT (look for the right positions in the edit window)
  • Alignment Robot (alignobot@appspot.com)
  • Show the algorithm which is used (niedelman/wunsch...smith waterman...).
  • Blast Robot
  • restart the BlastRobot Project

Is it possible to scroll the menu with the wave?

3rd wave for graphics like the workspace.

Oct. 7 2010

Fabian, Kristian, Niklas

We discussed some (new) Ideas we could implement:

  • Ligate Bioprick parts
  • Import of GenBank etc is important
  • Display features (annotations)
  • Is it possible to work with selected Sequences in the main Wave?

Keep 5' -> 3' direction!

Okt. 11 2010

Niklas, Fabian, Paresh

  • Annotation robot: how to display the output. We will try using the GadgetView Gadget and adjust it to display annotations.
  • Translation Robot output now looks good. A problem is, that Biojava translate seems to take long. Maybe write own translation method?
  • Talked about the organism identifier robot. Checked codon usage database.

Oct. 12 2010

Jörg, Paresh, Fabian, Niklas

  • Paresh presented the latest version of Translation Robot which works well. we will move the coloring form the robots to the gadget to gain performance
  • Niklas presented the PartsRegistry import function which got included in the main robot.
  • We created a new synbiowave-V2-001.jar as the new developer library.
  • Next meeting: Oct. 14 @Lab(Kitchen)

Oct. 15 2010

Paresh, Fabian, Niklas

We created a "roadmap" of all the tasks that we still have to do and assigned each of them to one of us

Roadmap

  • Wiki
  • Home (Fabian)
  • Team (Fabian)
    • 2010
    • Photos
    • Collaboration
  • Project (Paresh) (Summary)
    • Prospect
    • History
  • User (Niklas)
    • User Guide (Niklas) (Requirements)
    • The Robots (Paresh, Niklas)
  • Developer (Niklas)
    • Code (Niklas)
    • Technologies (Niklas) (Wave, BioJava, ...)
    • Architecture (Paresh)
    • Availability (Paresh)
  • Notebook (Fabian)(aka lab journal)
    • months
    • meetings
  • Human Practise (Niklas)
  • Coding
    • finish existing robots (Paresh, Niklas)
    • Blast search robot (Niklas)
    • "likelihood" robot (Paresh)
    • Genbank, EMBL import (Niklas)
    • Colorcoding to Javascript (Paresh)
    • Deadline: Oct. 24 (meeting TBA)

Oct. 21 2010

Fabian, Paresh, Jörg, Niklas

  • We discussed some details of the wiki (pictures, ect.)
  • Worked together on the new circular view
  • Tried the new Wave-in-a-box -> The client is still in beta stage and its not sure if robots will work, so no alternative for the jamboree.

Oct. 22- 24 2010

Fabian, Paresh, Niklas

  • Wrote the wiki together

Oct. 25 2010

Fabian, Jörg, Niklas

  • We created the new wave window for graphics

Retrieved from "http://2010.igem.org/Team:Freiburg_Software/Meetings"