User contributions
From 2010.igem.org
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 15:26, 26 October 2010 (diff | hist) N File:Photopicscotopic.png (top)
- 15:18, 26 October 2010 (diff | hist) N File:Solar Spectrum.png (top)
- 15:14, 26 October 2010 (diff | hist) N File:Fischerispectrum.jpg (Emission Spectrum of Vibrio Fischeri and Vibrio Harveii Taken from: Comparison of the spectral emission of lux recombinant and bioluminescent marine bacteria† Gerald Thouand, Philippe Daniel, Habib Horry, Pascal Picart, Marie Jose Durand, Ken Killham, O) (top)
- 15:11, 26 October 2010 (diff | hist) Team:Cambridge/Tools/Lighting
- 19:37, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 19:36, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 19:35, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 19:32, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 19:31, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 4: Gibson Assembly)
- 19:31, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 19:30, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 19:29, 24 October 2010 (diff | hist) m Team:Cambridge/Gibson/Mechanism
- 19:28, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 19:28, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 19:17, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 19:16, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 19:09, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 19:07, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 1: Design Primers)
- 19:06, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 5: Transformation)
- 19:00, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 18:58, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Important:)
- 18:58, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 18:56, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 18:56, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 18:55, 24 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 20:41, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 20:40, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 4: Gibson Assembly)
- 20:39, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 20:39, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 20:32, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 20:30, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 1: Design Primers)
- 20:29, 23 October 2010 (diff | hist) N File:Gibthon.png (top)
- 20:26, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 20:22, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 20:21, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 20:18, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 20:18, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 20:16, 23 October 2010 (diff | hist) N File:Phusion.jpg (The structure of Phusion™ High-Fidelity DNA Polymerases. The double-strand DNA-binding domain (purple) is fused to a novel Pyrococcus-like enzyme (green) forming a unique high-performance polymerase - Phusion DNA Polymerase. Developed & Manufactured B) (top)
- 20:14, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 20:14, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 3: PCR)
- 20:07, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Important:)
- 20:07, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Disadvantages)
- 20:06, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 20:05, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 20:00, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 19:58, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 16:16, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 16:06, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 16:03, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 15:59, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 15:57, 23 October 2010 (diff | hist) N File:GibsonAssembly.jpg (Figure 1 Nature Methods 6, 343 - 345 (2009) Published online: 12 April 2009 | doi:10.1038/nmeth.1318 Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & ) (top)
- 15:56, 23 October 2010 (diff | hist) N File:Nmeth.1318-F1.jpg (Figure 1 Nature Methods 6, 343 - 345 (2009) Published online: 12 April 2009 | doi:10.1038/nmeth.1318 Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & ) (top)
- 15:49, 23 October 2010 (diff | hist) Team:Cambridge/TheTeam (→Hannah Copley)
- 15:47, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 15:40, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 14:53, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 19:43, 9 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:20, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/MasterMix (top)
- 13:18, 30 September 2010 (diff | hist) N Team:Cambridge/Gibson/MasterMix (New page: {|class="wikitable" |- | |Volume/µl |- |Taq ligase (40u/µl) |50 |- |5x isothermal buffer |100 |- |T5 exonuclease (1u/µl) |2 |- |Phusion polymerase (2u/µl) |6.25 |- |Nuclease-free wate...)
- 13:18, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 4) Gibson Assembly)
- 13:17, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Master mix)
- 13:16, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 4) Gibson Assembly)
- 13:14, 30 September 2010 (diff | hist) m Team:Cambridge/Gibson/Protocol (→Step 4) Gibson Assembly)
- 13:13, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 13:08, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 13:08, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:03, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:03, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:01, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:00, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 12:59, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 12:58, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 12:39, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 10:16, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 10:07, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 1) Design Primers)
- 10:07, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 09:56, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Master mix)
- 09:54, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 11:10, 29 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 09:28, 29 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:59, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:54, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:53, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:33, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:02, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 14:39, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 14:31, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 17:19, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:17, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:05, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:04, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:04, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:03, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:03, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:02, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:02, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:31, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:30, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:20, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:19, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:15, 9 September 2010 (diff | hist) Team:Cambridge/Notebook/9 (top)
- 09:14, 9 September 2010 (diff | hist) Team:Cambridge/Notebook/8 (top)
- 09:12, 9 September 2010 (diff | hist) Team:Cambridge/Notebook/7 (top)
- 09:05, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 08:45, 9 September 2010 (diff | hist) Team:Cambridge/Tools/Gibson
- 08:45, 9 September 2010 (diff | hist) Team:Cambridge/Tools/Gibson
- 11:36, 24 August 2010 (diff | hist) Team:Cambridge/OligoOrderVibrio17.08.10 (top)
- 08:59, 20 August 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Relevant Physics)
- 10:28, 18 August 2010 (diff | hist) N Team:Cambridge/OligoOrderVibrio17.08.10 (New page: luxCstart.r.pBadend ATTTATTCATTATTTTCCCTgctagcccaaaaaaacgggt pBADend.f.luxCstart acccgtttttttgggctagcAGGGAAAATAATGAATAAAT luxDend.f.luxAstart AATTATTAGAATTGGCTTAAATAAACAGAATCACCAAAAA luxAs...)
- 10:27, 18 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone) (top)
- 10:20, 18 August 2010 (diff | hist) Team:Cambridge/Oligos (→The Phosphoreum Lux operon)
- 09:39, 18 August 2010 (diff | hist) N Team:Cambridge/biobrickingoligosfirefly (New page: 1 ttcgctaaggatgatttctg gaattcgcggccgcttctag ag Tm:70.14 dG:1.54 2 ttgcccgtttttttgccgga ctgcagcggccgctactagta Tm:68.73 dG:-0.26 3 tactagtagcggccgctgcag Tm:68.73 dG:0.57 4 ctctagaag...) (top)
- 14:27, 17 August 2010 (diff | hist) N Team:Cambridge/mutagenesisprimers17.08.10 (New page: Melting temps set to 55deg salt conc 50mM Val239-->Ile CCGGGTACGGCTaTTCTGACTGTTGTCCCTTTTCACCATGG Tm:84.29 dG:0.38 CCATGGTGAAAAGGGACAACAGTCAGAAtAGCCGTACCCGG Tm:84.29 dG:0.48 Asn286-->...) (top)
- 14:26, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→Firefly Oligos to be ordered)
- 14:25, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→Our first attempts at oligo design (a little excessive))
- 14:25, 17 August 2010 (diff | hist) N Team:Cambridge/LuxR (New page: ATGAAAAACATAAATGCCGACGACACATACAGAATAATTAATAAAATTAA AGCTTGTAGAAGCAATAATGATATAATCAATGCTTATCTGATATGACTAA AATGGTACATTGTGAATATTATTTATTCGCGATCATTTATCCTCATTCTA TGGTTAAATCTGATATTTCAATCTAGATAATTAC...) (top)
- 14:25, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→luxR)
- 14:24, 17 August 2010 (diff | hist) N Team:Cambridge/luxICDABEoperon (New page: gtcgaccttcctggttcagagcctcatatccatattacgaccacttcaat gggcgatcaaaaagtacattacatgattttttgcccaacagaaaaagcct ctcatttagagcagcttattcgtcaagatttcatggaaatgtatgagatc aattttccacaaaaaacagagtaacaaagagaaa...) (top)
- 14:23, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→luxICDABE operon)
- 14:22, 17 August 2010 (diff | hist) N Team:Cambridge/Biobrickingluxoperon (New page: =lux oligos= ==luxI== ===forward=== gaattcgcggccgcttctagagAAGGGAGGTTGGTATGACTAT dG=0.11 Tm=58.45 ===reverse coding=== atgatcatcgccggcgacgtcTTAATTTAAGACTGCTTTTTTAAACT dG=-0.34 T...) (top)
- 14:22, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→Our first attempts at oligo design (a little excessive))
- 14:22, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→lux oligos)
- 14:17, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→Firefly Oligos to be ordered)
- 14:17, 17 August 2010 (diff | hist) Team:Cambridge/Oligos
- 11:45, 13 August 2010 (diff | hist) N Team:Cambridge/OligoOrderVibrio13.08.10 (New page: BioBrick Prefix: If following part is coding or contains ATG: gaattcgcggccgcttctag Otherwise: gaattcgcggccgcttctagag BioBrick Suffix: tactagtagcggccgctgcag Pb...)
- 11:44, 13 August 2010 (diff | hist) Team:Cambridge/Oligos
- 09:14, 13 August 2010 (diff | hist) Team:Cambridge/Oligos
- 11:33, 10 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 13:59, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 13:20, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 12:20, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 12:12, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 12:07, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 12:03, 9 August 2010 (diff | hist) Team:Cambridge/Oligos
- 10:37, 9 August 2010 (diff | hist) Team:Cambridge/Oligos
- 10:35, 9 August 2010 (diff | hist) Team:Cambridge/Oligos
- 09:53, 9 August 2010 (diff | hist) Team:Cambridge/Templates/headerMinimalprototype
- 09:47, 9 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 09:43, 9 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 09:11, 9 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 09:07, 9 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 13:50, 6 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 13:29, 6 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 13:17, 6 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 13:08, 6 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 12:53, 6 August 2010 (diff | hist) N Team:Cambridge/LabBook/Week3 (New page: =Lab Book= ==27.07.10== ===Streaking out of bacterial cultures (Peter & Anja)=== On LB agar plates: TOP10 MG1655 W3110 hns 93-1 BW25113 On LB agar + kan plates: BW25113 Δhns::kan BW25113 ...)
- 12:50, 6 August 2010 (diff | hist) Team:Cambridge/Logistics (top)
- 12:49, 6 August 2010 (diff | hist) Team:Cambridge/Logistics
- 13:41, 3 August 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Wavelengths)
- 13:40, 3 August 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Wavelengths)
- 14:48, 2 August 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Inclusion Bodies)
- 14:46, 2 August 2010 (diff | hist) Team:Cambridge/TheTeam (→Students)
- 14:45, 2 August 2010 (diff | hist) N File:CambridgeTeamWill2.jpg
- 14:43, 2 August 2010 (diff | hist) Team:Cambridge/TheTeam (→Students)
- 14:32, 2 August 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/LightLevel/SourceCode (top)
- 11:10, 2 August 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Plasmid experiment)
- 22:43, 1 August 2010 (diff | hist) N Team:Cambridge/ProjectBioluminescence/LightLevel/SourceCode (New page: #include <iostream> #include <vector> #include <fstream> #include <math.h> #ifndef __mjdmatrix_h #define __mjdmatrix_h #include <iostream> using namespace std; // generic object (class) d...)
- 22:42, 1 August 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Light Output)
- 15:47, 29 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Relevant Physics)
- 15:46, 29 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Relevant Physics)
- 14:32, 29 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence (→The Plan)
- 14:31, 29 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence (→The Plan)
- 11:20, 26 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Transformation Experiment to test Firefly luciferase in registry)
- 11:20, 26 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Transformation Experiment to test Firefly luciferase in registry)
- 11:11, 26 July 2010 (diff | hist) N Team:Cambridge/ProjectBioluminescence/Characterisation (New page: {{:Team:Cambridge/Templates/header}} {{:Team:Cambridge/LumNavTemplate}} =Characterisation= *A good example of [http://partsregistry.org/wiki/index.php/Part:BBa_F2620 characterisation] {{...) (top)
- 11:03, 26 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Transformation Experiment to test Firefly luciferase in registry)
- 09:38, 23 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Light Output)
- 16:30, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Relevant Physics)
- 16:20, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Relevant Physics)
- 16:17, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Light Output)
- 15:48, 22 July 2010 (diff | hist) N Team:Cambridge/References/ProjectBioluminescence/LightLevel (New page: =Light Output= ==Relevant Physics== *The [http://en.wikipedia.org/wiki/Candela Candela] measures how much light is being emitted by a source of radiation. It is related to [http://en.wiki...)
- 14:58, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Plasmid experiment)
- 14:57, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Plasmid experiment)
- 14:41, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase
- 14:40, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase
- 14:39, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase
- 14:36, 22 July 2010 (diff | hist) N File:4449975.pdf (top)
- 14:29, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 14:28, 22 July 2010 (diff | hist) N File:Luxoperondiagram.jpg (top)
- 14:22, 22 July 2010 (diff | hist) N Team:Cambridge/ProjectBioluminescence/Luciferase/IMPORTANT INFO (New page: *Vibrio fischeri has adapted to a cooler environment (the ocean) and, therefore, the proteins for bioluminescence are heat denatured at 37°C.) (top)
- 14:21, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 14:02, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 14:01, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence (→Bacterial stuff)
- 14:00, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 12:53, 22 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→Operon Structure) (top)
- 11:12, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 10:55, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 09:34, 22 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→Operon Structure)
- 09:30, 22 July 2010 (diff | hist) N File:Luxoperon.png (top)
- 09:30, 22 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→Operon Structure)
- 09:18, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 09:18, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 09:13, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 09:09, 22 July 2010 (diff | hist) N Team:Cambridge/ProjectBioluminescence/Luciferase/Notes (New page: *Lumazine and YFP (yellow fluorencent protein)) (top)
- 09:05, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→Bacterial Bioluminescence)
- 09:04, 22 July 2010 (diff | hist) File:CambridgeTeamAnja.jpg (uploaded a new version of "Image:CambridgeTeamAnja.jpg": Reverted to version as of 09:33, 19 July 2010)
- 09:03, 22 July 2010 (diff | hist) m Team:Cambridge/TheTeam (→Note to other iGEM teams)
- 08:59, 22 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→luxCDABE (Vibrio Fischeri/Harvyi))
- 08:50, 22 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→The Genetics of the Vibrio Lux operon - a short introduction)
- 08:50, 22 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→The Genetics of the Vibrio Lux operon - a short introduction)
- 16:03, 19 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→Mechanism)
- 16:03, 19 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→Mechanism)
- 15:46, 19 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→Luciferase)
- 15:38, 19 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→The Genetics of the Vibrio Lux operon - a short introduction)
- 15:35, 19 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→Luciferase)
- 15:28, 19 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→The Genetics of the Vibrio Lux operon - a short introduction (adapted from wikipedia))
- 15:27, 19 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→The Genetics of the Vibrio Lux operon - a short introduction (adapted from wikipedia))
- 15:18, 19 July 2010 (diff | hist) Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (→The Genetics of the Vibrio Lux operon - a short introduction (adapted from wikipedia))
- 15:10, 19 July 2010 (diff | hist) N Team:Cambridge/ProjectBioluminescence/Luciferase/WikiGeneticsLuxCDABE (New page: ==The Genetics of the Vibrio Lux operon - a short introduction (adapted from wikipedia)== In V. fischeri five genes (LuxCDABE) have been identified as active in the emission of visible l...)
- 14:57, 19 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→luxCDABE (Vibrio Fischeri/Harvyi))
- 14:54, 19 July 2010 (diff | hist) Team:Cambridge/VibrioFischeri (top)
- 14:52, 19 July 2010 (diff | hist) Team:Cambridge/VibrioFischeri
- 14:50, 19 July 2010 (diff | hist) Team:Cambridge/VibrioFischeri
- 14:49, 19 July 2010 (diff | hist) Team:Cambridge/VibrioHarvei (top)
- 14:48, 19 July 2010 (diff | hist) N Team:Cambridge/VibrioFischeri (New page: Vibrio fischeri *gram-negative *rod-shaped bacterium *marine *heterotrophic(eats other micro organisms, as oppose to autotrophs (which are plants)) on decaying organic matter (saprotrop...)
- 14:46, 19 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→luxCDABE (Vibrio Fischeri/Harvyi))
- 14:45, 19 July 2010 (diff | hist) N Team:Cambridge/VibrioHarvei (New page: Vibrio Harvei *Gram-negative,bioluminescent, marine bacteria in the genus vibrio *rod-shaped, motile (via polar flagella), *facultatively anaerobic *halophilic (extremophile for high sa...)
- 14:44, 19 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→luxCDABE (Vibrio Fischeri/Harvyi))
- 14:43, 19 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→luxCDABE (Vibrio Fischeri/Harvyi))
- 14:41, 19 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→luxCDABE (Vibrio Fischeri/Harvyi))
- 14:39, 19 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→luxCDABE (Vibrio Fischeri/Harvyi))
- 14:36, 19 July 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/Luciferase (→luxCDABE (Vibrio Fischeri/Harvii))
- 14:35, 19 July 2010 (diff | hist) N Team:Cambridge/References/ProjectBioluminescence/Luciferase (New page: ==Photinus Pyralis (Firefly Luciferase)== ==EPIC luciferase== ==luxCDABE (Vibrio Fischeri/Harvii)==)
- 13:06, 16 July 2010 (diff | hist) Team:Cambridge/Description (→Preliminary description)
- 11:38, 16 July 2010 (diff | hist) Team:Cambridge/QuantumYield (top)
- 11:21, 16 July 2010 (diff | hist) N Team:Cambridge/EmissionEstimationNotes (New page: *According to [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WB5-4DXBGFJ-D5&_user=1495569&_coverDate=05%2F31%2F1960&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_...) (top)
- 11:20, 16 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 11:15, 16 July 2010 (diff | hist) N Team:Cambridge/Katal (New page: *A katal is the amount of enzyme required to catalyse one mole of reactions in one second. *e.g: One katal of trypsin is that amount of trypsin which breaks one mole of peptide bonds per s...) (top)
- 11:13, 16 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 11:12, 16 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 11:07, 16 July 2010 (diff | hist) N Team:Cambridge/QuantumYield (New page: Quantum Yield is defined as the probability of photon emission per luciferin molecule reacted.)
- 11:06, 16 July 2010 (diff | hist) Team:Cambridge/QuantumYield Definition: Quantum Yield (Q) (Removing all content from page) (top)
- 11:06, 16 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 11:04, 16 July 2010 (diff | hist) N Team:Cambridge/QuantumYield Definition: Quantum Yield (Q) (New page: Quantum Yield is defined as the probability of photon emission per luciferin molecule reacted)
- 11:04, 16 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 10:39, 16 July 2010 (diff | hist) Team:Cambridge/emissionEstimationNotes General Notes for emission estimation (top)
- 10:39, 16 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 09:53, 16 July 2010 (diff | hist) Team:Cambridge/emissionEstimationNotes General Notes for emission estimation
- 09:39, 16 July 2010 (diff | hist) Team:Cambridge/emissionEstimationNotes General Notes for emission estimation
- 09:25, 16 July 2010 (diff | hist) Team:Cambridge/emissionEstimationNotes General Notes for emission estimation
- 09:24, 16 July 2010 (diff | hist) Team:Cambridge/emissionEstimationNotes General Notes for emission estimation
- 09:23, 16 July 2010 (diff | hist) N Team:Cambridge/emissionEstimationNotes General Notes for emission estimation (New page: According to "Spectral emission and quantum yield of firefly bioluminescence" (H. H. Seliger and W. D. McElroy) 1. The emission spectrum of in vitro firefly bioluminescence has been foun...)
- 09:22, 16 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 09:18, 16 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 09:17, 16 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 13:43, 15 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Will's section)
- 13:43, 15 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Bioluminescence)
- 13:41, 15 July 2010 (diff | hist) Team:Cambridge/BioluminescenceLinks (→Bioluminescence)
- 08:53, 15 July 2010 (diff | hist) Team:Cambridge/Quiescence Notes
- 16:06, 14 July 2010 (diff | hist) Team:Cambridge/Quiescence Notes
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)