From 2010.igem.org

Revision as of 00:04, 28 October 2010 by Hartlmueller (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Project

Learn more about our project

What is our project about? What is the idea behind our project? This page is a good starting point if you are interested in our project and want to learn more about it.

Software

Build your own network

To demonstrate our vision about Biobrick networks, we developed a software, that enables you to interconnect Biobricks of your choice to your personal network. It will generate a DNA sequence that encodes all your logical connections. Just give it a try!

Modeling

Understand our RNA devices

On this page we show how we analyzed and estimated the switching process of our RNA devices. This is a basic requirement for the creation of better RNA devices.

Lab

Learn more about our experiments

This page provides an overview as well as detailed information about the experiments and measurements we performed. Protocols as well as our daily lab book will clarify any question about our lab proceedings.

BioBricks

Our contribution to the registry

Our project required the analysis and modification of existing Biobricks from the part registry as well as the creation of new Biobricks. This page contains more information about these steps.

Team

Get to know us

Who are we? Where are we from? What do we do in our spare time? Here you can find the answers to all these questions.

Glossary

Get the meaning of a term

To understand our project description more easily, we put together a list of terms that might be unknown or forgotten. Here you will find explanations concerning these terms.

Partners & Press

Thanks a lot to our supporters

This project would not have been possible without the help and support of various people, institutions and companies. We want to say thank you to all of them!

Beyond the Lab

iGEM is more than biology

The iGEM competition not only aims to drive the development of new Biobricks. It also encourages to think about responsibilities, safety and risks in the field of biotechnology. Furthermore, iGEM is about working together and helping other teams in various aspects. Read more how we want to contribute to these goals.

Overview

In the modeling part of our project we investigated the static (in silicio design) and the dynamical (diffusion and RNA Folding Dynamics) properties of our signal-terminator constructs (switch).

As descirbed on the Team:TU_Munich/Project project page, one key aspect of our switches is the idea, that a RNA transmitter molecule is capable to shift the state of a switch only if its trigger site is present and at the same its identity site corresponds to the recognition site of the switch.

We also probed the dynamical properties our switch with two subsequent approaches: 1) finding of a terminator and a corresponding signal, 2) investigating signal-terminator binding dynamics.
We simulated the termination and antitermination properties of our signal-terminator constructs with the Kinefold web server^[1] and used some standard estimations for diffusive terms. Our main goal was to prove that our constructs work and that termination is stopped efficiently, that is, that the signal molecule binds and antitermination occurs before the RNA polymerase falls off.
The Kinefold web server provides a web interface for stochastic folding simulations of nucleic acids and offers the choice of renaturation or co-transcriptional folding. The folding paths are simulated at the level of helix formation and dissociation as these stochastic formation and the removal of individual helices are known to be the limiting steps of RNA folding kinetics.
For our purposes, co-transcriptional folding was the appropriate choice: Folding proceeds while the sequence is being synthesized from its 5' to 3' ends at a speed of 3 ms per newly added base (for RNA polymerase T7 phage). Thus, the transcript starts to fold before the whole sequence is fully available.
Kinefold offers the possibility to include additional bases (X) which do not pair to model hybridization dynamics between two sequences. In order to simulate how the binding of the signal molecule prevents termination we linked the signal via a linker sequence consisting of 'X' bases to the sequence of the terminator.
For each signal-terminator pair we did batch simulations with various random seeds in order to guarantee accuracy.
We also varied signal length from two base pairs to full signal length which provides insight in how long the signal needs to be in order to bind to the terminator and how long this process takes at least.
We also examined whether diffusion plays a role in the dynamics of our constructs or not.

Results

We successfully constructed several switches and their corresponding transmitter RNA in silico on a thermodynamical basis. We modified different transcriptional terminators in such a way, that the formation of the terminator was prevented by a transmitter molecule. As desired, this only occured if the transmitter molecule contained both, a trigger and an identity site. Analogously, we were able to design and verify a NOT gate using the same thermodynical approach.
Our estimations for the switches obtained by the in silico approach indicated that diffusion is negligible. Our RNA dynamics simulations showed for each switch that for appropriate transmitter length the terminator is not folding, hence antitermination is successful. We also found that much smaller transmitter length is suitable for antitermination. Finally, we showed using the example of an AND gate that logic gates based on our transmitter-switch constructs work well.

in silico design based on thermodynamic calculations

In the following section we will describe how we theoretically designed our switches and their respective transmitter molecules. Our goal was to develop synthetic modified terminators consisting of a target and recognition site in the described manner(compare Implementation. As explained, only the complete transmitter RNA may shift the switches´ state and not the trigger site nor the identity site on their own. This is the prerequisite to fulfill all mentioned requirements for a functional switch allowing to construct logical gates as discussed previously. We implemented this by optimizing the thermodynamically parameters for pairing of each subsegment (identity site, trigger site, recognition site, target site).

switches based on attenuation principle

On a first approach, we designed switches based on terminators performing antitermination in the context of their natural occurrence within the scope of attenuation, the His and Trp terminator.^[1]^[2]. A 20 bp random sequence was derived from [http://www.faculty.ucr.edu/~mmaduro/random.htm| random sequence generator] and put upstream the terminator loop. A complementary sequence, reaching within the terminator´s stem loop (the transmitter) was stepwise shortened to find the length, where the formation of the terminator is thermodynamically favored compared to the strand displacement by this sequence. The final transmitter sequence was then defined by selecting this shortest strand which is still able to "destroy" the stem loop. Subsequently, the complementary random sequence (identity site) was removed an the remaining trigger site was tested in regard of not being able to resolve the stem loop on its on. As illustrated for the His-based switch below, the terminator is thermodynamically favored toward the trigger unit, but in combination with the identity site, destroying the terminator´s stem loop becomes possible.

element	free energy [kcal/mol]	ratio of pairing [%]
switch (terminator secondary structure)	-30.10	-
transmitter + switch	-72.88	100
trigger site binding to single target site	-24.21	0
identity site binding to single recognition site	-38.78	0

switch based on His terminator^[1], using a 20 bp recognition site: Comparison of free energy for secondary structure formation at 37°C in the presence and absence of a respective transmitter, simulated by using NUPACK analysis.

Pairing probabilities of the His-Terminator based switch simulated by NUPACK secondary structure analysis tool	Illustration of the His-Terminator based switch secondary structure, generated by NUPACK utility tools
Pairing probabilities of the His-Terminator based switch in presence of the respective transmitter RNA, simulated by NUPACK secondary structure analysis tool	Illustration of the His-Terminator based switch secondary structure in presence of the respective transmitter RNA, generated by NUPACK utility tools
Pairing probabilities of the His-Terminator based switch in presence of the transmitter RNA´s trigger site only, simulated by NUPACK secondary structure analysis tool	Illustration of the His-Terminator based switch secondary structure in presence of the transmitter RNA´s trigger site only, generated by NUPACK utility tools
Pairing probabilities of the His-Terminator based NOT-gate in presence of the transmitter RNA´s identity site only, simulated by NUPACK secondary structure analysis tool	Illustration of the His-Terminator based NOT-gate secondary structure in presence of the transmitter RNA´s identity site only, generated by NUPACK utility tools

NOT Gate based on His terminator switch
The basic composition of the NOT-gate was described in the implementation section. Putting this principle into practice based on the His terminator switch by further NUPACK simulation was successful. The terminator is only built in presence of a transmitter molecule and the trigger or identity site are not able to shift this state on their on. Results are presented in the following:

element	free energy [kcal/mol]	ratio of paaring [%]
switch (NOT-gate secondary structure)	-68.18	-
transmitter + switch	-98,18	100
trigger unit + target site	-24.01	0
identity site + recognition site	-38.78	0

NOT-gate based on modified His terminator^[1] based switch:Comparison of free energy for secondary structure formation at 37°C, simulated by using NUPACK analysis.

Pairing probabilities of the His-Terminator based NOT-gate simulated by NUPACK secondary structure analysis tool	Illustration of the His-Terminator based NOT-gate secondary structure, generated by NUPACK utility tools
Pairing probabilities of the His-Terminator based NOT-gate in presence of the respective transmitter RNA, simulated by NUPACK secondary structure analysis tool	Illustration of the His-Terminator based NOT-gate secondary structure in presence of the respective transmitter RNA, generated by NUPACK utility tools
Pairing probabilities of the His-Terminator based NOT-gate in presence of the transmitter RNA´s trigger site only, simulated by NUPACK secondary structure analysis tool	Illustration of the His-Terminator based NOT-gate secondary structure in presence of the transmitter RNA´s trigger site only, generated by NUPACK utility tools
Pairing probabilities of the His-Terminator based NOT-gate in presence of the transmitter RNA´s identity site only, simulated by NUPACK secondary structure analysis tool	Illustration of the His-Terminator based NOT-gate secondary structure in presence of the transmitter RNA´s identity site only, generated by NUPACK utility tools

Furthermore, we successfully designed a switch based on the Trp terminator^[2], using the same approach as pointed out above. We could show the length of the identity site can be varied. Nevertheless, How this will influence kinetic parameters discussed in the !!!!!!!!!!SINAS SECTION!!!!!link

element	free energy [kcal/mol]	ratio of pairing [%]
switch (terminator secondary structure)	-73,88	-
transmitter + switch	-73,88	100

switch based on Trp terminator^[2], using a 20 bp recognition site:Comparison of free energy for secondary structure formation at 37°C in the presence and absence of a respective transmitter, simulated by using NUPACK analysis.

switches using ubiquitous terminators

We applied the same principle to terminators which do not exhibit a natural occurring antitermination and were able to establish switches based on the synthetic terminator BBa_B1006 ^[3] and the T500 terminators^[4].

element	free energy [kcal/mol]	ratio of pairing [%]
switch (terminator secondary structure)	-19.70	-
transmitter + switch	-70.98	100

switch based on BBa_B1006 synthetic terminator^[3], using a 20 bp recognition site:Comparison of free energy for secondary structure formation at 37°C in the presence and absence of a respective transmitter, simulated by using NUPACK analysis.

element	free energy [kcal/mol]	ratio of pairing [%]
switch (terminator secondary structure)	-29.80	-
transmitter + switch	-81.08	100

switch based on T500 terminator^[4], using a 30 bp recognition site:Comparison of free energy for secondary structure formation at 37°C in the presence and absence of a respective transmitter, simulated by using NUPACK analysis.

element	free energy [kcal/mol]	ratio of pairing [%]
switch (terminator secondary structure)	-29.80	-
transmitter + switch	-81.08	100

switch based on T500 terminator^[4], using a 10 bp recognition site:Comparison of free energy for secondary structure formation at 37°C in the presence and absence of a respective transmitter, simulated by using NUPACK analysis.

switches relying on tiny abortive RNAs

We also implemented switches based on a the phenomenon of tiny abortive RNAs [5]. This principle is in contradiction to NUPACK-simulations, suggesting the T7-terminator to be less stable than simulated in NUPACK. Nevertheless, we tried to implement switches integrating tiny abortive RNAs in different length as trigger site. Results are illustrated in the FLOS LINK -section.

Close

Diffusion

The question whether antitermination occurs is not only guided by the folding process of the signal-terminator pair, but also by how long the signal takes to diffuse to the terminator sequence.

To account for the diffusion time, we estimated the hit rate τ^[2], which is the time until the signal meets the terminator sequence for the first time:

where D is the diffusion constant, a the radius of gyration of the signal molecule and r the radius of the compartment.
For E. coli r is approximately 1 μm. The radius of gyration a can be estimated using the worm-like-chain model^[3] by

where n is the length of the signal which is 0,3 nm/monomer, l is the persistency length^[4] which is 2nm for single-stranded RNA. Thus, for a signal of length 32 nt, a = 6,4 nm.

The diffusion constant D was obtained by

where k_B is the Boltzmann constant and T is the absolute temperature.
Using the a we calculated above and T = 300 K, we get D = 3,4318 m²/s.

Thus, for a cell containing 100 signal molecules, the signal needs approximately 0,1518 sec until it first hits the terminator sequence.

Close

Results

As the folding time (at least 1,7 sec for full signal length) is significantly larger than the estimated diffusion time (0,1518 sec), diffusion does not play an important role and thus can be neglected in the modeling our signal-terminator constructs.

Switch

To understand the RNA-folding dynamics of our switch including switching process, we performed Kinefold simulations for the His-terminator, the Trp-terminator and for the T7-terminator, each with the corresponding signal. For each terminator-signal construct, there are folding path videos available below and we optimized the signal sequences.
We checked that our toogle switch works well for all three terminators.

I. His-terminator

Terminator sequence:
5' UCGGCUUCAACGUGCUCCACGAAAGCCCCCGGAAGAUGCAUCUUCCGGGGGCUUUUUUUUU 3'
Signal sequence:
5' CCGGGGGCUUUCGUGGAGCACGUUGAAGCCGA 3'

Both terminator and signal sequence comprise two parts:

His-terminator and a part which partially binds to the His-terminator respectively (marked green),
a random signaling part and an antisense to the random signaling part respectively (marked red).

For further details on the switch design see the Project page.

We modeled the signal-terminator interaction for 2, 4-32 nt signal length and find that the signal sequence binds to the terminator sequence and impedes the terminator folding, thus the polymerase doesn't fall off and the output signal can be produced.

The minimal free-energy structure of the folded terminator including the random signaling part is shown in the figure "His-terminator" below:

His-terminator

Our full signal sequence of length 32 nt completly binds to the terminator leading to antitermination.

His-terminator plus signal 32 nt

On the other hand the picture for a signal length of only 2 nt shows that such a small signal length is not sufficient to induce antitermination. But already a signal of length 16 nt binds to the terminator so that it cannot fold completely anymore leading to antitermination.

signal length 2 nt

signal length 16 nt

Furthermore, we explored whether the artificial linker has any influence on the results.

As we observed a dependence of the folding time and minimal energy respectively from the linker length we used linkers of length 12, 16, 20, 24, 30, 34, 40, 50, 60, 120 'X' bases. For the minimal energy there is only a very small linker length dependence as one can see in the figure below.
The figure also shows that the minimal free-energy structure for the signal sequence bound to the terminator sequence is much more stable, around 35 kcal/mol, than the minimal free-energy structure for the terminator sequence alone which -31,3 kcal/mol (and thus close to the minimal free-energy for the terminator connected to a signal of length only 2 nt).

Linker length dependence: minimal energy

However, for the folding time the linker length dependence is significant as one can see in the figure below.

Linker length dependence: folding time

But, as, for us, the fact whether the terminator is folding or not is crucial and the videos below show that for appropriate signal length the terminator is not folding. Concerning this fact, for all linker lengths we tested there was only a dependence on the signal length but the results were independent from the linker length. Hence, the linker length dependence and thus the linker itself can be neglected since it only affects the folding process quantitatively but not qualitatively.

Close

RNA folding path videos

The video on the left for 16 nt signal length shows that the terminator is already hindered from folding completely and the video on the right, which is done for full signal length of 32 nt, displays that the terminator does not fold at all as the signal immediately binds to the terminator sequence as it is synthesized.

Finally we optimized the signal sequence and obtained a signal sequence of only 8 nt length.

Close

Optimization of the signal sequence

We also tried to optimize our signal sequence to find the minimal sequence length which still enables antitermination. For this optimization kept the random signaling part constant and varied the part which partially binds to the His-terminator and vice versa to see which length is sufficient for antitermination for each case. Then we combined the results to find a optimal signal.

When varying the part which partially binds to the His-terminator we found that having only the 2 nt of this part together with the random signaling part suffices for antitermination as the picture and the corresponding video below show.

Signal consists of the random signaling part (20 nt) and only 2 nt of the part which partially binds to the His-terminator.

For the full 12 nt of the part which partially binds to the His-terminator, the random signaling part has to have at least 2 nt in order to prevent termination as one can see in the picture below.

Signal consists of the part which partially binds to the His-terminator (12 nt) and only 2 nt of the random signaling part.

We then combined these two results: Above one always had the full length of either one of the two parts of the signal, as we now wanted to modify both parts and only 2 nt of each part were not sufficient for antitermination, we finally discovered that a signal with overall 8 nt, 4 nt for the random signaling part and 4 nt for the part which partially binds to the His-terminator, 5' UUUCGUGG 3', suffices to enable antitermination as the picture and the corresponding video below display.

Signal consists of 4 nt for the part which partially binds to the His-terminator and 4 nt of the random signaling part.

TU Munich iGEM2010 sstraub signalopt.gif

Close