Team:UNAM-Genomics Mexico/Notebook

From 2010.igem.org

Revision as of 01:49, 27 October 2010 by Kurupaclau (Talk | contribs)



Notebook

Our notebook is organized in different main sections to facilitate the access and exchange of information. We will be updating it, so new sections and notes will be added continuously. Besides, all members´ notes are available at our respective Open Wet Ware profiles. Please check the Team page for more information.

Wetlab Progress

E.coli strain mutant

We have to test the mutant strain CY15001 (trpR-) that Dr. Charles Yanofsky kindly provided us. As the mutation consists of a frame shift, ake a PCR reaction and then sequence the amplified products.

The primers used are:

Forward (5'->3'): CGC ACG TTT ATG ATA TGC TAT CG

Reverse:(5'->3'): AGG CCT ACA AAA TCA ATC G

These primers would amplify trpR coding region (326nt), 87nt upstream from the start codon and 12nt after the stop codon. Thus, obtaining a final PCR product of 426nt long.

Samples: The trpR mutant colonies that were selected to make the colony PCR were: 1,5,8.

Colony control: E.coli k12 wild type.


Experimental Procedure

11-13 August 2010

PCR colony: Protocol

1. Take with a toothpick a sample of the colony.

2. Dissolve the sample in 200μL of Tris-ETA 10/1-NaCl 10mM solution.

3. Heat the sample during 10 min at 95°.

4. Centrifugate at 14 000 rpm during 2 min.

5. Take 10μL as DNA template for PCR reaction.

6.The PCR products around the expected lenght - 421 nt - for E.coli k12 wt and trpR mutant colonies use them to sequence and analyze the trpR frameshifth mutation.

24 August 2010

Sequencing Results:

>trpR gene sequence from mutant strain colony 3.

AGCTGTCTGTCATCACTGGCGCAGCTCGACGGGCGCGGCTTTCAGGCTGTTAGATCCACGCGTAATCGTCGGGATGCCTG CGCCGAGTTCATTTTTTAACTCACGCTGGCTCGTTTCGCCGCGCAACAGCTCTTCGACAATACGCACGCGAGTCCCCAAC GCTTCGCGCTCATCTGGCGTCAGCATCAGGTTTAACAACGGTAAATGGAGATCGTTTTGGTAGGCATTCTTAAGCAGGTC GACAAAACGTAACCACTCCTGGTGACGCTGTTCTGCCATCGCTGCTGAATAGGGTGATTGTTGGGCCATAATATGTCCCC ATTGTTAGCGGGGGAAGCCAAATGCCTCCCCTGGTTGGACTAGGTGTTGCTGAAAATCGCTTATCTTTGTAGTGCATCTG CTTTTTTTCCACACATTGGGGAATCTGTTACCCCCCCTTGTTTTTTTTTAACCGGAACTTAATTGAATCCTTACCTAGGG GGGAGGGGGGGAAACCACATTCCCGGCATAATTGACAA

>Wild type trpR gene sequence from E.coli K12. TCCTGCTGCGACTGTGCGCGCGCTCGACGGGCGCGGCTTTCAGGCTGTTAGATCCACGCGTAATCGTCCCGATGCCTGCG CCGAGTTCATTTTTTAACTCACGCTGGCTCGGTTCGCCGCGCAACAGCTCTTCAACAATGCGCACGCGAGTCCCCAACGC TTCGCGCTCATCTGGCGTCAGCATCAGGTTTAACAACGGTAAATGGAGATCGTTTTGGTAGGCATTCTTAAGCAGGTCGA CAAAACGTAACCACTCCTGGTGACGCTGTTCTGCCATCGCTGCTGAAGAGGGTGATTGTTGGGCCATGATATGTCCCCAT TGTTAGCGGGGGAAGCAAAATGCCTCCCCCGGTTGGACTAGGTGTTGATTACGATAGCTTGACTTTGAAGTGCGAACCCG CTTTTTTGCACAACATGGGGGATCATGTAACCCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGGG GGGGGGTGACACCACGATACCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTT CCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGG TTTATTGCTGATAAACTGGAGCCCGTGAGCGTGGAATCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTC CCGTATCGTAATTATCTACACGACGGGTAG

The trpR gene from the mutant strain doesn’t have a frameshift, instead of that it has a non synonymous mutation (Alanine to Proline) corresponding to the aminoacid 80. We hypothesized that this change might causes a dramatic structural change to the protein thus being non functional.


LovTAP promoters

In order to test the new LovTAP, designed considering Dr. Devin advices and Lausanne team modeling results. We had to choose the proper promoters under which LovTAP expression will be regulated.

After looked up the promoter in the registry of biological parts. We decided to use the following members of the family J23: J23117, j23114, J23105 and J23102.

All these promoters are contained inside J61002 plasmid, and control the expression of RFP protein. Besides, the plasmid harbors an ampicillin resistance.

Experimental Procedure

11 August - 18 August 2010

1.Get the plasmids harboring each promoter, from the corresponding plates.

2.Transform cells.

3.Grow up the transformed cells in LB medium with ampicillin antibiotic. This is because the plasmids harboring each promoter have a resistance against ampicillin.

4. Once the cells are correctly transformed with the plasmid J61002 harboring each promoter, start the plasmid extraction procedure, using the High Pure Plasmid Isolation kit from Roche.

5. After finishing the isolation of plasmid J61002 with each promoter , make the restriction enzyme assay (SpeI/PstI)in order to remove the RBS site, the RFP gene and the double terminator from plasmid J61002 to replace them with LovTAP gene.

21 August 2010.

6. Once the plasmids harboring the promoters are correctly digested with the enzymes SpeI and PstI, make the dephosphatation reaction for each one in order to prepare them for ligation.


Mr. Gene plasmid harboring LovTAP

Once we received the synthesis shipment, we started to work with it in order to assemble it with the selected constitutive promoters.

Experimental Procedure

12 August – 16 August 2010

1.Transform cells with the Mr. Gene plasmid 2.Grow up the transformed cells in LB medium with kanamycin antibiotic. 3. Once the cells are correctly transformed with the Mr. Gene plasmid, start the plasmid extraction procedure, using the High Pure Plasmid Isolation kit from Roche.

4. After finishing the isolation of the plasmid, make the restriction enzyme assay (XbaI/PstI) in order to remove the LovTAP designed sequence to join it with the respective promoters.


18 August – 23 August 2010

5. As the plasmid from Mr. Gene included the enzyme restriction sites used in the biobrick assembly kit, extract the corresponding gel band of LovTAP, using the gel extraction protocol from QIAGEN.


LovTAP Mr. gene + Promoters

Assembly of the constitutive promoters with LovTAP Mr. gene sequence


Experimental Procedure

25-26 August 2010.

1. Prepare the ligation mixture taking into account the quantity of the DNA insert -LovTAP- and the receiver DNA -plasmids harboring the promoters-.

2. Incubate the sample at 16°C overnight.

3. Transform the cells. Click here for the protocol.

4. Culture the cells in the proper selective medium.

5. Incubate the petri dishes at 37°C overnight.

6. Re-culture the resultant colonies in the proper selective medium; incubate them at 37°C overnight.

7. Analyze the colonies with Colony PCR to confirm that they contain the correct ligation

Primers: Forward (5'->3'): Preffix primer. Reverse:(5'->3'): Suffix primer.

8. Use SalI restriction enzyme, in order to confirm LovTAP ligations, because there is a recognition site for that enzyme inside LovTAP coding region, approximately at the middle of the gene. The SalI recognition site is not present in RFP gene nor in plasmid J61002. So that cutting with this enzyme, LovTAP ligations will be confirmed as true positives (the insert is LovTAP and not RFP gene).


LovTAP Mr. gene + Promoters in different Backbones

The constructions of LovTAP plus constitutive promoters were correctly obtained in plasmid J61002 but we need to transfer them to plasmid psb1c3 for the iGEM DNA submission and to plasmid psb3k3 for characterization.

Experimental Procedure

1 September 2010. 1. Once the ligations of LovTAP with promoters were confimed, digest them with EcoRI and PstI in order to fuse them to backbones pSB3K3 and pSB1C3. 2. Isolate and digest the plasmids Psb3k3 and psb1c3 with EcoRI and PstI, in order to remove the RFP gene.

3 September 2010.

3.Once the plasmids are correctly digested with the enzymes EcoRI and PstI, started the dephosphatation reaction in order to prepare them for ligation with promoters-LovTAP. 4. Prepare the ligation mixture taking into account the quantity of the DNA insert -LovTAP- and the receiver DNA -plasmids harboring the promoters-. 5. Incubate the sample at 16°C overnight. 6. Transform the cells. Click here for the protocol. 7. Culture the cells in the proper selective medium. 8. Incubate the petri dishes at 37°C overnight. 9. Re-culture the resultant colonies in the proper selective medium; incubate them at 37°C overnight. 8 – 11 September 2010. 10. Analyze the colonies with Colony PCR to confirm that they contain the correct ligation Primers: Forward (5'->3'): Preffix primer. Reverse:(5'->3'): Suffix primer. 14-29 September 2010. 11. Use SalI restriction enzyme, in order to confirm LovTAP ligations, because there is a recognition site for that enzyme inside LovTAP coding region, approximately at the middle of the gene. The SalI recognition site is not present in RFP gene nor in plasmids pSB3K3/pSB1C3. So that cutting with this enzyme, LovTAP ligations will be confirmed as true positives (the insert is LovTAP and not RFP gene).

trpL promoter In order to construct the reporter system regulated by LovTAP, we have to fuse the promoter trpL with a reporter gene.

Experimental Procedure

First attempt 1.Insert the trpL promoter through a PCR reaction to the plasmid Psb3k3. -trpL promoter sequence tggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgcAagttcacgtaaaaagggtat Primer designed with the trpL sequence: Preffix +Promoter(functional elements only)+EcoRI

gaattcgcggccgcttctagag gctgttgacaattaatcatcgaactagttaactagtacgcaag cggaattccg

Zepeda screw it up twice when doing this, the first one was placing an SpeI site instead of an EcRI to use it to ligate to an XbaI site of the cI inverter, but then when he re synthesize it with the SpeI and had successfully ligated it to the cI inverter and GFP, he realized that the promoter itself had two SpeI sites, ergo the ligation could not be used.

Second attempt 3 -4 October 2010 In order to overcome the previous problem Claudia designed a primer to change the SpeI site to an NheI site, which is also compatible with XbaI, the PCR was done on the pSB1C3 plasmid because backbone Psb3k3 has an NheI restriction site. New Primer designed with the trpL sequence: -Primer_trpL_reverse (5'->3'): NheI site + trpL promoter + XbaI site + EcoRI site TTGCTAGCGTGAACTTGCGTACTAGTTAACTAGTTCGATGATTAATTGTCAACAGCCTCTAGAAGCGGCCGCGAATTC -Primer forward (5'->3'): Suffix -Template: Plasmid pSB1C3

7 October 2010. We tested several Tm temperatures (55°C, 58°C , 60°C, 63°C and 65°C) and plasmid template dilutions because we were obtaining two amplified bands around the expected size. We got the best results at 63°C and using a dilution of the purified plasmid PSB1C3 of 1:100.

LovTAP Reporter systems • LovTAP activator activity: Reporter system trpL promoter fused to lambda Repressor cI: Part:BBa_P0451 + Part:BBa_K098991 regulating GFP protein:Part:BBa_E0240.

Experimental Procedure

First attempt Zepeda searched in the Registry of Standard Biological Parts for an appropriate inverter which is a repressor followed by its binding site. We chose an inverter because it is going to be constitutively repressing anything downstream of it, but when it gets transcriptionally repressed (by LovTAP), whatever is downstream of it is going to be activated.

We chose the cI inverter from Lambda phage (BBa_Q04510) and proceeded to extract it from the 2009 kit plate 1, Zepeda transformed it by heat shock, extracted plasmid and digested it with EcoRI and PstI.

When checking the digestions on an agarose gel, the 1kb band expected from the cI inverter was absent or very thin, so He performed a PCR using the prefix and suffix as primers. The PCR came out very well with the expected size. As the double digestions were good enough to ligate, we hypothesize that not all plasmids had the inverter that is why it looks very weak on the digestions, but comes out very well in the PCR.

Zepeda did more PCRs for the cI inverter using RTTH polymerase (hot start), purified them and digested with EcoRI and PstI in order to ligate them to GFP.

In order to introduce the GFP with the new RBS he digested the GPF with SpeI/PstI and plasmid pSB1T3 with XbaI/PstI then he ligate them.

He tried several times to ligate the cI inverter to the GFP-PCR with new RBS in the plasmid pSB1T3 with no success. As non of the attempts to ligate the 2009 cI inverter PCR were successful and the digestions were doubtful, he decided to extract the cI inverter from the 2010 kit plate.

After the transformation, plasmid extraction and double digestion with EcoRI/PstI he noticed there was something wrong with the plasmid because the in the gel there were always more that the two bands expected, so he extracted the inverter by PCR, digested it with EcoRI/PstI and cloned it into the commercial vector pBluescript II KS + hoping it would work for the ligations.

It was successfully cloned in the new vector so he proceeded to ligate it with the GFP (BBa_E0240) into the pSB1T3, then he extracted plasmid and double digested it with EcoRI/PstI, in the gel we can see the two bands expected one for the ligation product about 1900 bp and the other for about 2500 bp corresponding to the plasmid, ergo it seems that it came out well. The only problem is that it doesn’t seem to glow when exposed to UV light, but it should as the cI repressor protein is not being transcribed.

Second attempt

30 August 2010 1.Transform and isolate the plasmids pSB1AK3 and pSB1A2, harboring the parts BBa_P0451 (RBS+cI repressor) and BBa_K098991(cI regulated promoter+RBS+GFP) respectively. 3 September 2010. 2. Once the plasmids are correctly isolated digest them with the proper enzymes: BBa_P0451 (EcoRI/SpeI) and BBa_K098991 (XbaI/PstI).

6 September 2010. 3. Prepare the ligation mixture taking into account the quantity of the DNA inserts -BBa_P0451 and BBa_K098991- and the receiver DNA -plasmids PSB1C3, PSB1T3 and PSB3K3 digested with EcoRI/PstI -. 4. Incubate the sample at 16°C overnight. 5. Transform the cells. Click here for the protocol. 6. Culture the cells in the proper selective medium. 7. Incubate the petri dishes at 37°C overnight. 8. Re-culture the resultant colonies in the proper selective medium; incubate them at 37°C overnight. 2 October 2010 After several unsuccessful attempts using different ligation mixtures with the three backbones aforementioned, we finally obtained a possible well done ligation with the whole cI inverter + GFP in plasmid PSB1C3. 9. Analyze the colonies with Colony PCR to confirm that they contain the correct ligation Primers: Forward (5'->3'): Preffix primer. Reverse:(5'->3'): Suffix primer. 4 October 2010 10. Verify the colony phenotype, it should be expressing GFP, because the cI repressor doesn’t have a promoter, thus it´s not represshttps://2010.igem.org/wiki/skins/common/images/button_bold.pnging the GFP production. Although we successfully got the cI inverter we didn’t have enough time to ligate it to trpL promoter due to both constructions are in the same antibiotic resistance plasmid psb1c3 and the PCR reactions to obtain the whole cI inverter were not obtained on time.

LovTAP repressor activity: Reporter system

trpL promoter fused to GFP protein:Part:BBa_E0240 .

trpL promoter fused to RFP protein: Part: BBa_E1010.

Experimental procedure

30 August 2010 and 4 October 2010. 1.Transform and isolate the plasmids pSB1A2 and pSB2K3, harboring the parts BBa_E0240 (RBS+ GFP + double terminator) and BBa_E1010 (RBS+RFP) respectively. 2. Once the plasmids are correctly isolated digest them with the proper enzymes for ligation (XbaI/PstI). 7 October 2010. 3.Digest the PCR product of the trpLp plus pSB1C3 with NheI/ PstI and ligate it to both GFP (BBa_E0240) and RFP(BBa_E1010). 4. Incubate the sample at 16°C overnight. 5. Transform the cells. Click here for the protocol. 6. Culture the cells in the proper selective medium. 7. Incubate the petri dishes at 37°C overnight. 8. Re-culture the resultant colonies in the proper selective medium; incubate them at 37°C overnight. 17 October 2010 The phenotype of the transformed colonies with the ligation, should be RED or yellow because the trpL promoter is not being repressed by LovTAP thus both RFP and GFP are being produced. 18 October 2010. 4. Isolate the plasmid with the correct phenotype and digest it, to test that the insert is around the expected size. Only trpL + RFP ligation was correctly done according to the phenotype observed and to the restriction pattern obtained once the plasmid was isolated.

RESULTS: CHARACTERIZING LOVTAP

18-26 October 2010. Once LovTAP with the three weak constitutive promoters (J23117,123114 and J23105) was correctly obtained in plasmid Psb3k3, and the reporter system trpL+RFP was also finished by our team , we started the co-transformation procedure in order to have the whole system inside the cells both trpR wild type and trpR mutant. Besides, we also receive the trpL+RFP construction from Lausanne team that was kindly sent it by Edinburgh team, because we didn’t get any response from the members of Lausanne team to provide us with their reporter systems. We are using both our trpL-RFP reporter system and the Lausanne system as a reference, expecting to obtain the same results. The difference between the reporter systems is that ours doesn’t have the double terminator. Experimental procedure Qualitative experiment: 1.Co-transform the cells using 5 micro liters of each plasmid in the trpR mutant and in the wild type. J23117/ 123114 / J23105 LovTAP + our trpL+RFP reporter system. J23117/ 123114 / J23105 LovTAP + Lausanne trpL+RFP reporter system. 2.Grow up the transformed cells overnight (~15hrs) in 5ml of LB medium at 37°C with spinning at 250rpm, with the respective antibiotics (Kanamicyn and chloramphenicol/ Kanamicyn and ampicillin ) in dark conditions. 3. Take 1 mL of the broth and transfer it into 5 ml of fresh LB medium with antibiotics


Journal

These are our Reports. Each link contains the report of a the given person.


  • Report for Augusto Berrocal, dealing with the lux operon.
  • Report for Jorge Buendia, dealing with the Blue Promoter.
  • Report for Jorge Zepeda, dealing with the CI inverter used in the Blue, and Red reception modules.
  • Report for Fabricio Lopez, dealing with the sponsors, notes, and kappa.

TimeLine

This is a timeline of the project, including the overall progress, collaborations, and Human Practices.

iGEM

iGEM is the International Genetically Engineered Machines Competition, held each year at MIT and organized with support of the Parts Registry. See more here.

Synthetic Biology

This is defined as attempting to manipulate living objects as if they were man-made machines, specifically in terms of genetic engineering. See more here.

Genomics

We are students on the Genomic Sciences program at the Center for Genomic Sciences of the National Autonomous University of Mexico, campus Morelos. See more here.

Locations of visitors to this page

This site is best viewed with a Webkit based Browser (eg: Google's Chrome, Apple's Safari),

or a Gecko one (eg: Mozilla's Firefox, Netscape). Some of the code requires an up-to-date browser.


Trident based (Microsoft's Internet Explorer) or Presto based (Opera) are not currently supported. Sorry.