Team:Warsaw/Stage1/PromMeas

Revision as of 14:12, 19 October 2010 by Olchowik (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

• Team
• Attribution
• Sponsors
• Acknowledgemets

• Idea
• Background
• Promoters Measured
• RBSes Measured
• ExpressIt! Vectors
• Modeling

• Idea
• Background
• Design
• Results

• Idea
• Background and Design
• Results
• Gallery of microphotographs

• Idea
• Background
• Design
• Results
• Modeling

• Parts
• Labbook

• Licensing of biological parts
• Syntetic biology in Poland
• Synthetic BioLectures gallery
• iGEM survey

• About Biobrick Manager
• See Biobrick Manager

Promoter measurement

Experimental setup

We have measured J23100 and I719005 encoding pT7.

We have used B0034 as our reference RBS and E0040 GFP as a reporter:

<partinfo>BBa_K299009 DeepComponents</partinfo>

<partinfo>BBa_K299024 DeepComponents</partinfo>

We expressed known amount if DNA in a cell-free expression system and measured RNA content over time using RTq-PCR. Fig 1 shows the amplification curves that were obtained after RTq-PCR seperately for J23100 and T7 containing construct. Different colours indicate that samples were collected at different times: 15, 30. 45, etc. minutes after DNA addition

After data analysis we have determined dynamic performance of J23100 and pT7:

Measured promoter strengths are as follows:

pT7 41,8pg RNA/minute/ug substrate DNA
J23100 13,1pg RNA/minute/ug substrate DNA

All measurements were conducted in cell-free system which allowed us simple and precise determination of GFP encoding mRNA. The amount of mRNA was determined using quantitative reverse transcriptase realtime PCR (qRT-PCR). We have done absolute quantification using cDNA standard curve to convert delta-Ct units to RNA concentration.

We have used following protocol:

1. All reagents and substrates were RNase free. Experiments were conducted in RNase-free environment.
2. 0.5 ug of DNA encoding tested construct was added to 50 ul of cell-free expression master mix containing 350 units of human placental RNase inhibitor.
3. Samples were incubated at 37^oC with shaking at 800 RPM
4. Every 15 minutes 5ul of reaction mixture was collected. Reaction was stopped by freezing at -20. Samples were kept frozen until reverse transcription.
5. Subsamples were being collected untill reaction have reached steady state (typically 120 minutes).
6. After obtaining all RNA samples DNAse treatment was performed as follows: 5 ul of sample was supplemented with 1ul of 10x DNAse buffer, 3 ul of RNase-free water and 1ul of RNase-free DNase I from Fermentas
7. Samples were incubated at 37^oC for 30 minutes. After that time 1ul of EDTA was added to each sample.
8. DNase was inactivated by heating in 65^oC for 10 minutes.
9. DNase treated RNA samples were divided in two. One half was used as a substrate for reverse transcription. The other halves were mixed together and used in -RT control reaction.
10. Reverse transcription was performed using Maxima First Strand cDNA synthesis kit form Fermentas using manufacturer's instructions. Gene specific primer GFPqPCRr (TCGAAAGGGCAGATTGTG) was used.
11. cDNA was diluted 50x and 1ul was used for qRT-PCR reaction. SYBR/ROX qPCR HotStart 2x Master Mix for Fermentas was used to perform the reaction with the following primers: GFPqPCRf (GATGACGGGAACTACAAGAC) and GFPqPCRr (TCGAAAGGGCAGATTGTG). ABI 7500 qPCR system was used. PCR program: 95^oC for 10 minutes followed with 40 cycles of 95^oC for 15s, 55^oC for 30 s, 72^oC for 40s. Reaction specificity was confirmed using melting curve analysis.