Team:Warsaw/Stage1/PromMeas
From 2010.igem.org
Promoter measurement
Experimental setup
We have measured J23100 and I719005 encoding pT7.
We have used B0034 as our reference RBS and E0040 GFP as a reporter:
<partinfo>BBa_K299009 DeepComponents</partinfo>
<partinfo>BBa_K299024 DeepComponents</partinfo>
Results
Following amplification curves were obtained:
After data analysis we have determined dynamic performance of J23100 and pT7:
Measured promoter strengths are as follows:
pT7 41,8pg RNA/minute/ug substrate DNA
J23100 13,1pg RNA/minute/ug substrate DNA
All measurements were conducted in cell-free system which allowed us simple and precise determination of GFP encoding mRNA. The amount of mRNA was determined using quantitative reverse transcriptase realtime PCR (qRT-PCR). We have done absolute quantification using cDNA standard curve to convert delta-Ct units to RNA concentration.
We have used following protocol:
- All reagents and substrates were RNase free. Experiments were conducted in RNase-free environment.
- 0.5 ug of DNA encoding tested construct was added to 50 ul of cell-free expression master mix containing 350 units of human placental RNase inhibitor.
- Samples were incubated at 37oC with shaking at 800 RPM
- Every 15 minutes 5ul of reaction mixture was collected. Reaction was stopped by freezing at -20. Samples were kept frozen until reverse transcription.
- Subsamples were being collected untill reaction have reached steady state (typically 120 minutes).
- After obtaining all RNA samples DNAse treatment was performed as follows: 5 ul of sample was supplemented with 1ul of 10x DNAse buffer, 3 ul of RNase-free water and 1ul of RNase-free DNase I from Fermentas
- Samples were incubated at 37oC for 30 minutes. After that time 1ul of EDTA was added to each sample.
- DNase was inactivated by heating in 65oC for 10 minutes.
- DNase treated RNA samples were divided in two. One half was used as a substrate for reverse transcription. The other halves were mixed together and used in -RT control reaction.
- Reverse transcription was performed using Maxima First Strand cDNA synthesis kit form Fermentas using manufacturer's instructions. Gene specific primer GFPqPCRr (TCGAAAGGGCAGATTGTG) was used.
- cDNA was diluted 50x and 1ul was used for qRT-PCR reaction. SYBR/ROX qPCR HotStart 2x Master Mix for Fermentas was used to perform the reaction with the following primers: GFPqPCRf (GATGACGGGAACTACAAGAC) and GFPqPCRr (TCGAAAGGGCAGATTGTG). ABI 7500 qPCR system was used. PCR program: 95oC for 10 minutes followed with 40 cycles of 95oC for 15s, 55oC for 30 s, 72oC for 40s. Reaction specificity was confirmed using melting curve analysis.