Team:Harvard/flavor/notebook

From 2010.igem.org

Revision as of 01:31, 25 October 2010 by AGedeon (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

notebook calendar [ top ]

Week 1	06-14-2010	06-15-2010	06-16-2010	06-17-2010	06-18-2010
Week 2	06-21-2010	06-22-2010	06-23-2010	06-24-2010	06-25-2010
Week 3	06-28-2010	06-29-2010	06-30-2010	07-01-2010	07-02-2010
Week 4	07-05-2010	07-06-2010	07-07-2010	07-08-2010	07-09-2010
Week 5	07-12-2010	07-13-2010	07-14-2010	07-15-2010	07-16-2010
Week 6	07-19-2010	07-20-2010	07-21-2010	07-22-2010	07-23-2010
Week 7	07-26-2010	07-27-2010	07-28-2010	07-29-2010	07-30-2010
Week 8	08-02-2010	08-03-2010	08-04-2010	08-05-2010	08-06-2010
Week 9	08-09-2010	08-10-2010	08-11-2010	08-12-2010	08-13-2010

06-14-2010 [ top ]

Miraculin and brazzein constructs due to arrive on Wednesday from Mr. Gene

BioBrick Transformation

BioBrick parts from the 2010 iGEM kit were transformed and grown in highly competent TURBO bacteria.

Wintergreen Scent Pathway:

BBa_J45700 - entire pathway, Ampicillin
BBa_J45004 - BSMT1 only, Ampicillin
(Not in 2010 BB Kit: BBa_J45017 - PchB, PchA)

Banana Scent Pathway:

BBa_J45250 - ATF3 + Promoter, Ampicillin?
BBa_J45014 - ATF3 only, Ampicillin
(Not in BB 2010 Kit: BBa_J45400 - BAT2 and THI3)

06-15-2010 [ top ]

Primer Designs for Agrobacterium Vector

Primers were designed to amplify from the Expression Series pORE Agrobacterium plasmid (e3) 1)the pENTcup2 promoter, 2) the tNOS stop sequence, 3) the tNOS stop sequence + additional stop codon and 4) the pHLP promoter.

Note: the NOSterm_BB_R primer works for both tNOS and tNOS+STOP codon sequences.

   pENTcup2_BB_F
   CCTTTCTAGAGGGATCTTCTGCAAGCATCT

   pENTcup2_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTTCCGGTGGGTTTTGAGGT

   STOP_NOSterm_BB_F
   CCTTTCTAGATGAGATCGTTCAAACATTTGG

   NOSterm_BB_F
   CCTTTCTAGAGATCGTTCAAACATTTGGCA

   NOSterm_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTGATCTAGTAACATAGATGACA

   pHPL_BB_F
   CCTTTCTAGAAACGTGGATACTTGGCAGTG

   pHPL_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTCTTTTGAGCTTAGAGGTTTTT

BioBrick Transformation

Colonies were observed after overnight culture growth, but in low quantities.
- J45700 and J45004 (both Wintergreen Pathway) showed minimal number of colonies on both 10μL and 100μL cultures.
- J45250 and J45014 (both Banana Pathway) showed no colonies on either the 10μL or 100μL cultures.

Codon Usage in Arabidopsis

Using http://gcua.schoedl.de/

Valencene Extraction

Used RNeasy Plant Mini Kit to extract RNA from the flavedo of an Organic Valencia Orange.

06-16-2010 [ top ]

MiniPrep

MiniPrep of Wintergreen parts from Registry (J45004 and J45700) following Qiagen MiniPrep protocol. MiniPrep three samples of each part.
- DNA concentrations:

         J45004-1: 59.1 ng/μL
         J45004-2: 72.9 ng/μL
         J45004-3: 88.1 ng/μL
 
         J45700-1: 146.7 ng/μL
         J45700-2: 187.4 ng/μL
         J45700-3: 175.5 ng/μL

Digestion with Enzymes

For J45004, we added: 9μL DNA, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast).
For J45700, we added 5μL DNA, 4μL H2O, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast).
We let mixtures sit for 30 minutes due to the use of xbaI restriction enzyme (slow). After the 30 minutes, we added 2.5μL dye to each mix.

Gel

We loaded 12.5μL of 1kb ladder to well 1 of the gel (numbered left to right). We then loaded 12.5μL of J45004-1, J45004-2, and J45004-3 to wells 2,3, and 4, respectively. We loaded J45700-1, J45700-2, J4500-3 in wells 5, 6, and 7, respectively (see images below for well locations).
Ran on 1% agarose gel.

06-17-2010 [ top ]

PCR Purification of pORE Vector Parts

Following QIAgen PCR Purification Kit Protocol the following PCR products were purified:

pENTCUP2 Promoter - 16.1 ng/μL
NOSterminator Sequence - 76.3 ng/μL
STOP codon + NOSterminator Sequence - 76.5 ng/μL

To do: follow up with restriction digest ✓ and Agarose gel ✓ to confirm PCR and PCR purification.

Restriction Digest and Agarose Gel

Restriction Digest reactions were set up as follows:

pENTCUP2 Promoter:

27μL PCR product
3μL Loading Buffer w/ dye
1μL Xba1 Fast Enzyme
1μL Pst1 Fast Enzyme

NOSterm and NOSterm + STOP:

9μL PCR product
1μL Loading Buffer w/ dye
0.5μL Xba1 Fast Enzyme
0.5μL Pst1 Fast Enzyme

BioBrick Plasmid V0120 (Ampicillin Resistance):

3μL DNA
1μL Loading Buffer w/ dye
6μL diH₂O
0.5μL Xba1 Fast Enzyme
0.5μL Pst1 Fast Enzyme

Reactions were allowed to proceed for 45 minutes at 37°C.

06-25-2010 [ top ]

We began this week trying to ligate the pENTCUP2 promoter, NosT terminator, and NosT terminator plus stop codon into the V0120 vector. We ran into several problems during this process.

We had previously digested the three inserts as well as the promoter with XbaI and PstI fast digest enzymes, ligated, and transformed the ligated vectors into e. coli. Unfortunately, we did not find any colonies of cells after over 14 hours of incubation. Furthermore, on Friday June 18th, after digesting all three inserts and vector and running them on a gel, we did not see any NosT + stop DNA. Therefore, on Monday June 21, we began by digesting more NosT + stop and V0120 vector with xba1 and pstI fast digestive enzymes. The gel showed DNA length to be consistent with the given parts. (See gel below)

Gel Lanes (both inserts and vector were digested with xbaI/pstI): 1. 1kb plus ladder. 2. pENTCUP2 promoter. 3. NosT terminator. 4. NosT + stop terminator 5. V0120 digested.

Gel Lanes (both inserts and vector were digested with xbaI/pstI): 1. 1kb plus ladder. 2. NosT + stop terminator. 3. V0120 digested.

Upon gel extraction and gel purification, we ligated the inserts into the vectors with a 2:1 insert to vector ratio (previously we had been using a 4:1 insert to vector ratio). We then transformed the plasmids into e.coli and plated; no colony growth was seen the next morning.

We used Team Vector's R3 ligation (they have successfully ligated and transformed) as a positive control. However, the bacteria containing the ligated plasmids were plated on Ampicillin plates, which turned out to be the wrong resistance.

Troubleshooting

In order to get a better understanding of the problem with our ligation, we ran a diagnostic gel with the V0120 backbone and vectors B15 and B21.

   Gel Lanes: 
   1. 1 kb plus ladder
   2. v0120 undigested
   3. v0120 eco/spe
   4. v0120 eco/xba
   5. v0120 spe/pstI
   6. v0120 xba/pst
   7. v0120 ecoRI
   8. v0120 xba1
   9. v0120 pstI
   10. v0120 spe
   11. blank
   12. B15 (StrepII tag) xba/pstI
   13. B21 (YFP) xba/pstI

We concluded from the gel that xba1 is the problem in our ligation step. The pattern of bands in the v0120 xba1/pstI digest along with the v0120 xba1 digest illustrate that xba1 is not cutting correctly.

We began a slow enzyme xba1/pstI digest on Friday, but the gel was run in mismatching buffers (TAE and TBE).

Gel Lanes (inserts and vector digested with xba1/pstI): 1. 1 kb plus ladder. 2. pENTCUP2 3. NosT 4. NosT & stop 5. v0120

Valencene

Digestion of PCR products aimed to isolate valencene gene showed very short length on gel. These are not the correct size and are most likely primer dimers. PCR products were digested with EcoRI/SpeI. 5 μL of each sample was digested with pstI to be sure that the pstI site was in the sequence of DNA.

Gel Lanes: 1. 1 kb plus ladder. 2. Flavedo EcoRI/SpeI. 3. Flavedo PstI 4. Open 5. Fruit EcoRI/SpeI. 6. Fruit pstI

06-28-2010 [ top ]

Miniprep of Miraculin and Brazzein Constructs

Protocol used was from the Qiagen Miniprep Kit

Nanodrop Specs
Name	Concentration (ng/μL)
Miraculin 1	159.6
Miraculin 2	182.2
Brazzein 1	91.2
Brazzein 2	33.7

DTL (Digestion, Ligation, Transformation) of The Big Three (pENTCUP2, NOSt, NOSt + STOP)

Digestion Reactions
	pENTCUP2	NOSt	NOSt+STOP	B15
DNA	4	7	12	7
NEB Buffer 3 (10x)	2	2	2	2
diH₂O	10	7	2	7
Xba1	1	1	1	1
Pst1	1	1	1	1
BSA (10x)	2	2	2	2

Digestions were left for 1:30 at 37°C
2.2 μL of DNA Loading Buffer were added to each reaction and loaded onto a 1% Agarose gel (TAE buffer). Gel was ran at 125 V for 30 min.

Lanes
Lane	Contents
Lane 1	1KB Plus Ladder
Lane 2	pENTCUP2
Lane 3	NOSt
Lane 4	NOSt+STOP
Lane 5	B15 digested
Lane 6	B15 undigested

The undigested B15 in lane 6 appears as two bands on account of supercoiling of the B15 plasmid.
Bands in lanes 2 - 5 were cut out and purified using a Qiagen Gel Purification kit
- The gel purification was done with 300 μL Buffer PB and 400 μL Buffer QG

Nanodrop Specs
Name	Concentration (ng/μL)
pENTCUP2	16.5
NOSt	10.2
NOSt+STOP	0.4
B15 (backbone vector)	10.9

Note the very low concentration of NOSt+STOP. It is uncertain as to what caused such a concentration, but transformation proceeded anyways with max volume
The ligation reactions were preformed at at 2:1 (insert to backbone) Molar Ratio
- The sole exception being the NOSt+STOP ligation, in which the lack of product forced us to use 1.8 ng DNA

Ligation Reactions
	pENTCUP2	NOSt	NOSt+STOP	Control
Insert	1	1	1	1
Vector	2	2	2	2
Buffer (10x)	5	5	5	5
Ligase	1	1	1	1
H₂O	11	11	0	12

Ligation reactions were preformed as per the Silver Lab ligation protocol (with the differences in concentration and ratio made as per the table above).
Transformations to E. Coli were preformed as per the Silver lab transformation protocol with ampicillin plates.
Plates were left overnight.

06-29-2010 [ top ]

Results of ligation and transformation of The Big Three (pENTCUP2, NosT, NosT + stop) with B15 backbone into E.coli

A few colonies were found on the pENTCUP2 + Backbone plate, NosT + stop and backbone plate, and b15 backbone control plate. Colonies were picked from the plates and placed in 3ml of LB and agarose in a culture tube. The tubes were placed in the 37°C shaker for 8 hours. 2 mL of LB+AMP was added to the cultures, bring the total volume to 5 mL of LB+AMP. Cultures were left to shake overnight.

DLT of the Sweethearts - Miraculin and Brazzein (and B21)

Digestion Reactions
	Miraculin	Brazzein	B21
DNA	6	11	7
FD Buffer (10x)	2	2	2
diH₂O	10	5	9
EcoRI	1	1	1
SpeI	1	1	1

Placed in 37°C waterbath for 20 minutes.

Digestion Gel

   Gel Lanes:
    1. 1 kb plus ladder
    2. Miraculin digested with EcoRI/SpeI
    3. Brazzein digested with EcoRI/SpeI
    4. B21 digested with EcoRI/SpeI
    5. 1 kb plus ladder

Nanodrop Specs (from gel purification)
Name	Concentration (ng/μL)
Miraculin	9.5
Brazzein	10.2
B21 Vector (V0120)	8.4

Ligation Reactions
	Miraculin	Brazzein	Control
Insert	3.5	0.75	0
Vector	6	6	6
Buffer (10x)	2	2	2
Ligase	1	1	1
H₂O	6.5	10.25	0

The ligation of Miraculin was done at a 3:1 ratio (insert to vector) due to its larger size (~700 bp)
The ligation of Brazzein was done at a 2:1 ratio due to its smaller size (~200 bp)

06-30-2010 [ top ]

Miraculin, Brazzein

Colonies did grow!
Started 5 mL cultures of Miraculin and Brazzein biobrick constructs (5 cultures each)

The Big Three

Began miniprep of cultures of pENT, NOSt+STOP and our Control (for experimental purposes)

*OD specs*
	OD
pENTCUP2 #1	248.5 ng/μL
pENTCUP2 #2	447.7 ng/μL
NosT + stop #1	427.7 ng/μL
NosT + stop #2	303.9 ng/μL
Control #1	366.8 ng/μL
Control #2	359.2 ng/μL

Digestion

We digested miniprep samples with xbaI/pstI fast digest enzymes in order to determine if ligation was successful.

*Digestion Reactions*
	Control #1	Control #2	pENTCUP2 #1	pENTCUP2 #2	NosT & stop #1	NosT & stop #2
DNA	2	2	3	2	2	3
Green FD buffer	2	2	2	2	2	2
diH₂O	14	14	13	14	14	13
xbaI	1	1	1	1	1	1
pstI	1	1	1	1	1	1

Digestion mixes were placed in 37°C water bath for approximately 1 hr.

Big Three PCR digestion

We simultaneously digested PCR purified pENTCUP2, NosT, and NosT & stop inserts with xbaI/pstI. This way if the above digestion showed the ligation of the inserts into v0120 backbone was not successful, we can continue with these inserts.

*Digestion Reactions*
	pENTCUP2	NosT	NosT & stop
DNA	4	7	2
Green FD buffer	2	2	2
diH₂O	12	9	14
xbaI	1	1	1
pstI	1	1	1

Placed in 37°C water bath for 20 minutes.

07-01-2010 [ top ]

We made glycerol stocks from our Miraculin & v0120 and Brazzein & v0120. 333 μL cultures with 666μL glycerol and placed in -80°C freezer.

We miniprepped our Miraculin and v0120 cultures and our Brazzein and v0120 cultures. Miniprep done per Qiagen protocol.

ODs

Sample	OD
Miraculin and v0120 #1	171.3ng/μL
Miraculin and v0120 #2	202.0ng/μL
Miraculin and v0120 #3	106.4ng/μL
Miraculin and v0120 #4	115.6ng/μL
Miraculin and v0120 #5	40.5ng/μL
Brazzein and v0120 #1	41.7ng/μL
Brazzein and v0120 #2	42.8ng/μL
Brazzein and v0120 #3	38.8ng/μL
Brazzein and v0120 #4	0ng/μL
Brazzein and v0120 #5	N/A

Valencia orange surgery (part two)

RNA extraction per Qiagen RNAeasy protocol.
- We made sure to apply RNAzap (RNAase-free) spray to all surfaces and instruments.

ODs

Sample	OD
RNA Flavedo extraction #1	93.1ng/μL
RNA Flavedo extraction #2	28.7ng/μL

07-02-2010 [ top ]

NosT + stop and v0120

We ran an xba/pstI fast enzyme digest on our miniprepped NosT + stop and v0120 plasmid. The gel was consistent with a successful ligation. (See lanes 7-10 in gel image below).

Valencene

After running a reverse transcriptase reaction on our RNA extraction, we ran PCR on the cDNA with Valencene specific primers. The gel did not show the proper fragment length of the Valencene gene. Instead, it appears primer dimers formed again. (See lanes 2-5)

07-05-2010 [ top ]

07-06-2010 [ top ]

Tagging Miraculin and Brazzein with YFP and StrepII tags

Tag: -E--N--X--STREP/YFP--S--N--P-
Insert: E--N--X--Miraculin/Brazzein--S--N--P-

The 'tag' biobrick (either YFP or STREPII) was used as the vector; Miraculin and Brazzein were used as the insert.
Tags were ligated to both the N- and C-terminal of Miraculin and Brazzein

*BioBrick Digest Combinations*
	Vector	Insert
N-Terminus	Spe1/Pst1	Xba1/Pst1
C-Terminus	EcoR1/Xba1	EcoR1/Spe1

*Digestion Reactions*
	B21 S/P	B21 E/X	Miraculin X/P	Miraculin E/S	Brazzein X/P	Brazzein E/S
diH₂O	13	13	11	11	0	0
Green FD buffer (10x)	2	2	2	2	2	2
DNA	3	3	5	5	16	16
Spe1	1	-	-	1	-	1
PstI	1	-	1	-	1	-
EcoR1	-	1	-	1	-	1
Xba1	-	1	1	-	1	-

Gel

The gel showed DNA fragments consistent with Miraculin and Brazzein. The digestion of B21 appeared to be succesful, but the DNA sequence cut out was too small to see on the gel.

   Gel Lanes:
    1. 1 kb plus ladder
    2. B21 speI/pstI
    4. B21 ecoRI/xbaI
    6. Miraculin xbaI/pstI
    8. Miraculin ecoRI/speI
    10. Brazzein xbaI/pstI
    12. Brazzein ecoRI/pstI
    14. 1kb plus ladder

We extracted the circled bands and gel purified the gel per the Qiagen gel purification protocol.

   ODs of gel purified DNA
    B21 speI/pstI:  15.9 ng/μL
    B21 ecoRI/xbaI:  11.0 ng/μL
    Miraculin xbaI/pstI:  9.7 ng/μL
    Miraculin ecoRI/speI:  7.1 ng/μL
    Brazzein xbaI/pstI:  2.6 ng/μL
    Brazzein ecoRI/pstI:  5.0 ng/μL

Ligation

We did 6 different ligation reactions. The chart below shows the different reactions. Ligation reactions were left at room temperature for 15 minutes.

*Ligation Reactions*
	Miraculin xbaI/pstI w/ B21 speI/pstI	Miraculin ecoRI/speI w/ B21 ecoRI/xbaI	Brazzein xbaI/pstI w/ B21 speI/pstI	Brazzein ecoRI/speI w/ B21 ecoRI/xbaI	Control B21 speI/pstI	Control B21 ecoRI/xbaI
DNA Insert	2	3	3	1	0	0
T4 DNA ligase buffer (10x)	2	2	2	2	2	2
diH₂O	12	9	11	11	14	12
T4 DNA ligase	1	1	1	1	1	1
DNA Backbone	1	1	1	1	1	1

Transformation

We mixed 5μL ligation mix with 15μL Turbo e. coli cells. These were placed in ice for 30 minutes and then heat shocked in 42°C water bath for 30 seconds. The cells were placed back on ice for 2 minutes. 170 μL of SOC broth was added to each Eppendorf tube. The transformed e. coli were then plated on LB Ampicillin plates and left in the 37°C incubator overnight.

07-07-2010 [ top ]

Sequencing

V0120 Plasmids containing the pENTCUP2 plant promoter, NOS terminator and NOS terminator + STOP were sent to GENEWIZ for sequencing. Sequencing results are expected tomorrow.

Cultures

5 mL cultures were started from the YFP-2x construct from yesterday, as well as the B15 (StrepII) tag.

2 x B21 E/X + Brazz E/S - C-Terminus
2 x B21 S/P + Brazz X/P - N-Terminus
2 x B21 E/X + Mira E/S - C-Terminus
2 x B21 S/P + Mira X/P - N-Terminus
2 x B15 Plate #1
2 x B15 Plate #2

Cultures were placed in a 37°C incubator and left to shake overnight.

Primers for Wintergreen pathway parts

J45004

Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)

J45017

Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'

07-08-2010 [ top ]

Re-submitted sequencing order, with correct primers, to GeneWiz
Did a confirmation digest of the Miraculin/Brazzein + YFP-2x constructs

Ladder
B15 E/X
B15 S/P
Mira+YFP N1
Mira+YFP N2
Mira+YFP C1
Mira+YFP C2
Brazz+YFP N1
Brazz+YFP N2
Brazz+YFP C1
Brazz+YFP C2
Ladder

- It appears that the digestion of Mira+YFP C2 (lane 7) did not work properly. This could have been the result of choosing a bacterial colony that was the result of contamination, or from simply an error in the digestion step.

Transformed two pDUET expression vectors for Miniprep

Ligated Miraculin/Brazzein to a StrepII tag

*Ligation Reactions*
	Miraculin xbaI/pstI w/ B15 speI/pstI	Miraculin ecoRI/speI w/ B15 ecoRI/xbaI	Brazzein xbaI/pstI w/ B15 speI/pstI	Brazzein ecoRI/speI w/ B15 ecoRI/xbaI	Control B15 speI/pstI	Control B15 ecoRI/xbaI
DNA Insert	3	4	4	2	0	0
T4 DNA ligase buffer (10x)	2	2	2	2	2	2
diH₂O	11	10	10	12	14	14
T4 DNA ligase	1	1	1	1	1	1
DNA Backbone	3	3	3	3	3	3

We then transformed the ligated plasmids into Turbo e. coli and plated the bacteria on Amp plates. Plates were left in the 37°C incubator overnight.

07-09-2010 [ top ]

Ligation of Brazzein & Miraculin (w/ YFP tags) into DUET vector

Digestion

*Digestion Reactions*
	Brazzein & YFP C EcoRI/SpeI	Brazzein & YFP N EcoRI/SpeI	Miraculin & YFP C EcoRI/SpeI	Miraculin & YFP N EcoRI/SpeI	V24 NotI/SpeI	NosT & Stop EcoRI/XbaI
DNA	2	2	2	3	5	2
FD Buffer (10x)	2	2	2	2	2	2
diH₂O	14	14	14	13	11	14
Enzyme	1	1	1	1	1	1
Enzyme	1	1	1	1	1	1

We are adding the NosT & stop to the C-terminus of the Miraculin and Brazzein constructs. This whole construct will then be ligated into the V24 DUET vector.

Gel

   Gel Lanes:
    1. 1kb plus ladder
    3. Miraculin & YFP N-terminus ecoRI/SpeI
    5. Miraculin & YFP C-terminus ecoRI/SpeI 
    7. Brazzein & YFP N-terminus ecoRI/SpeI 
    9. Brazzein & YFP C-terminus ecoRI/SpeI 
   11. V24 NotI/SpeI
   13. NosT & Stop EcoRI/XbaI

07-12-2010 [ top ]

We removed our cultures of e. coli containing Miraculin/Brazzein C/N YFP and NosT & Stop and e. coli containing Miraculin/Brazzein and StrepII tag from the 37°C shaker.

Glycerol stocks were made (666 μL glycerol and 333 μL cells)

Miniprep

   ODs
    Miraculin C YFP and NosT & Stop 1: 414.4 ng/μL
    Miraculin C YFP and NosT & Stop 2: 304.0 ng/μL
    Miraculin N YFP and NosT & Stop 1: 428.6 ng/μL
    Miraculin N YFP and NosT & Stop 2: 421.0 ng/μL
    Brazzein C YFP and NosT & Stop 1: 572.8 ng/μL
    Brazzein C YFP and NosT & Stop 2: 580.3 ng/μL
    Brazzein N YFP and NosT & Stop 1: 348.9 ng/μL
    Brazzein N YFP and NosT & Stop 2: 639.6 ng/μL

    Miraculin N StrepII 1: 888.6 ng/μL
    Miraculin N StrepII 2: 614.4 ng/μL
    Miraculin C StrepII 1: 677.1 ng/μL
    Miraculin C StrepII 2: 222.1 ng/μL
    Brazzein N StrepII 1: 352.6 ng/μL
    Brazzein N StrepII 2: 331.6 ng/μL
    Brazzein C StrepII 1: 209.3 ng/μL
    Brazzein C StrepII 2: 346.4 ng/μL

Digestion

*Digestion Reactions*
	Miraculin C YFP NST	Miraculin N YFP NST	Brazzein N YFP NST	Brazzein C YFP NST
diH₂O	14	14	13.5	14.3
Green FD buffer (10x)	2	2	2	2
DNA	2	2	2.5	1.7
NotI	1	1	1	1
SpeI	1	1	1	1

Gel

   Gel Lanes:
    1. 1 kb plus ladder
    3. Miraculin N YFP NST (NotI/SpeI)
    5. Miraculin C YFP NST (NotI/SpeI)
    7. Brazzein N YFP NST (NotI/SpeI)
    9. Brazzein C YFP NST (NotI/SpeI)
    11. 1 kb plus ladder

Gel purify per Qiagen protocol

   ODs
    Brazzein C YFP NST (NotI/SpeI): 6.3 ng/μL
    Brazzein N YFP NST (NotI/SpeI): 8.5 ng/μL
    Miraculin C YFP NST (NotI/SpeI): 3.6 ng/μL
    Miraculin N YFP NST (NotI/SpeI): 12.8 ng/μL

07-13-2010 [ top ]

Ligation in V24

Ligation of of Mira/Brazz+YFP+NOSt+STOP Construct into the V24 pETDUET vector for expression of proteins in IPTG inducible bacteria.

*Ligation Reactions*
	Mira N + V24	Mira C + V24	Brazz N + V24	Brazz C + V24	Control
diH₂O	7	1	6	4	12
T4 DNA ligase buffer (10x)	2	3	2	2	2
DNA Insert	5	20	6	8	0
DNA Backbone	5	5	5	5	5
T4 DNA ligase	1	1	1	1	1

5μL of Ligation reactio

07-14-2010 [ top ]

Miniprep of STOP + V0120 part

   Nanodrop O/D's:
   STOP V0120 1-1: 134.4 ng/μL
   STOP V0120 1-2: 98.7 ng/μL
   STOP V0120 2-1: 55.2 ng/μL
   STOP V0120 2-2: 121.8 ng/μL

DTL of StrepII+Mira/Brazz with STOP codon

To insert a STOP codon to the end of our Mira/Brazz StrepII constructs, we used the STOP+V0120 BioBrick as our vector (EcoR1/Xba1 digest) and our Miraculin/Brazzein construct as our insert (EcoR1/Spe1 digest)
Construct DNA used was from Miniprep 1 (Box 4)
~1μg of DNA was digested in each reaction

*Digestion Reactions*
	Mira Strep N	Mira Strep C	Brazz Strep N	Brazz Strep C	STOP+V0120 BioBrick
diH₂O	15	14.5	13.5	11.5	6
Green FD buffer (10x)	2	2	2	2	2
DNA	1	1.5	2.5	4.5	10
EcoR1	1	1	1	1	1
Xba1	-	-	-	-	1
Spe1	1	1	1	1	-

Digestion of Mira/Brazz+Strep and STOP codon BioBrick

Circled bands were cut and gel purified

   Miraculin + StrepII = 730 bp
   Brazzein + StrepII = 230 bp
   STOP + V0120 = 3200 bp

1kb Plus Ladder
Miraculin C Strep E/S
Miraculin N Strep E/S
Brazzein C Strep E/S
Brazzein N Strep E/S
STOP + V0120 E/X
1kb Plus Ladder

   Gel Purification Specs
   Mira N StrepII E/S: 3.0 ng/μL
   Mira C StrepII E/S: 2.8 ng/μL
   Brazz N StrepII E/S: 3.4 ng/μL
   Brazz C StrepII E/S: 1.3 ng/μL
   STOP+V0120 BB E/X: 7.1 ng/μL

Ligation of Mira/Brazz+Strep and STOP codon BioBrick

*Ligation Reactions*
	Mira StrepII N + STOP w/ v0120 BB	Mira StrepII C + STOP w/ v0120 BB	Brazz StrepII N + STOP w/ v0120 BB	Brazz StrepII C + STOP w/ v0120 BB	Control STOP w/ v0120 BB
diH₂O	4.5	4.5	9	5	12
T4 DNA ligase buffer (10x)	2	3	2	2	2
DNA Insert	7.5	7.5	2	6	0
DNA Backbone	5	5	6	6	5
T4 DNA ligase	1	1	1	1	1

Transformation

Transformed 5 μL ligation mix with 15 μL TURBO e. coli cells
Plated on LB + Amp plates and left in 37°C incubator overnight

07-15-2010 [ top ]

Miraculin/Brazzein YFP N/C and NosT + Stop in V24 DUET vector

Made glycerol stocks (666 μL glycerol and 333 μL cells)

   ODs
    Miraculin C1: 168.8 ng/μL
    Miraculin C2: 67.2 ng/μL
    Miraculin N1: 183.0 ng/μL
    Miraculin N2: 173.5 ng/μL
    Brazzein N1: 54.8 ng/μL
    Brazzein N2: 79.0 ng/μL
    Brazzein C1: 161.4 ng/μL
    Brazzein C2: 125.0 ng/μL

*Confirmation Digestion Reactions*
	Mira N1	Mira N2	Mira C1	Mira C2	Brazz N1	Brazz N2	Brazz C1	Brazz C2
diH₂O	13.5	13.5	13.5	11	11	11	13.5	13
Green FD buffer (10x)	2	2	2	2	2	2	2	2
DNA	2.5	2.5	2.5	5	5	5	2.5	3
PstI	1	1	1	1	1	1	1	1
Xba1	1	1	1	1	1	1	1	1

Confirmation Digest of Mira/Brazz + YFP + NOSt + STOP in V24 Expression Vector

Ladder
Mira N1
Mira N2
Mira C1
Mira C2
Brazz N1
Brazz N2
Brazz C1
Brazz C2
Ladder

The N & C designation corresponds to the terminus upon which the YFP was fused.

   Expected Lengths
    Miraculin + YFP + NOSt + STOP = 700 + 1500 + 250 = 2450 bp
    Brazzein + YFP + NOSt + STOP = 300 + 1500 + 250 = 2050 bp
    V24 = 5200 bp

Team:Harvard/flavor/notebook

From 2010.igem.org

notebook calendar [ top ]

06-14-2010 [ top ]

BioBrick Transformation

06-15-2010 [ top ]

Primer Designs for Agrobacterium Vector

BioBrick Transformation

Codon Usage in Arabidopsis

Valencene Extraction

06-16-2010 [ top ]

MiniPrep

Digestion with Enzymes

Gel

06-17-2010 [ top ]

PCR Purification of pORE Vector Parts

Restriction Digest and Agarose Gel

06-18-2010 [ top ]

06-21-2010 [ top ]

06-22-2010 [ top ]

06-23-2010 [ top ]

06-24-2010 [ top ]

06-25-2010 [ top ]

Troubleshooting

Valencene

06-28-2010 [ top ]

Miniprep of Miraculin and Brazzein Constructs

DTL (Digestion, Ligation, Transformation) of The Big Three (pENTCUP2, NOSt, NOSt + STOP)

06-29-2010 [ top ]

Results of ligation and transformation of The Big Three (pENTCUP2, NosT, NosT + stop) with B15 backbone into E.coli

DLT of the Sweethearts - Miraculin and Brazzein (and B21)

06-30-2010 [ top ]

Miraculin, Brazzein

The Big Three

07-01-2010 [ top ]

Valencia orange surgery (part two)

07-02-2010 [ top ]

NosT + stop and v0120

Valencene

07-05-2010 [ top ]

07-06-2010 [ top ]

Tagging Miraculin and Brazzein with YFP and StrepII tags

Gel

Ligation

Transformation

07-07-2010 [ top ]

Sequencing

Cultures

Primers for Wintergreen pathway parts

07-08-2010 [ top ]

Ligated Miraculin/Brazzein to a StrepII tag

07-09-2010 [ top ]

Ligation of Brazzein & Miraculin (w/ YFP tags) into DUET vector

07-12-2010 [ top ]

Miniprep

Digestion

Gel

07-13-2010 [ top ]

Ligation in V24

07-14-2010 [ top ]

Miniprep of STOP + V0120 part

DTL of StrepII+Mira/Brazz with STOP codon

07-15-2010 [ top ]

Miraculin/Brazzein YFP N/C and NosT + Stop in V24 DUET vector

07-16-2010 [ top ]

07-19-2010 [ top ]

07-20-2010 [ top ]

07-21-2010 [ top ]

07-22-2010 [ top ]

07-23-2010 [ top ]

07-26-2010 [ top ]

07-27-2010 [ top ]

07-28-2010 [ top ]

07-29-2010 [ top ]

07-30-2010 [ top ]

08-02-2010 [ top ]

08-03-2010 [ top ]

08-04-2010 [ top ]

08-05-2010 [ top ]

08-06-2010 [ top ]