Team:Harvard/flavor/notebook

notebook calendar [ top ]

Week 1	06-14-2010	06-15-2010	06-16-2010	06-17-2010	06-18-2010
Week 2	06-21-2010	06-22-2010	06-23-2010	06-24-2010	06-25-2010
Week 3	06-28-2010	06-29-2010	06-30-2010	07-01-2010	07-02-2010
Week 4	07-05-2010	07-06-2010	07-07-2010	07-08-2010	07-09-2010
Week 5	07-12-2010	07-13-2010	07-14-2010	07-15-2010	07-16-2010
Week 6	07-19-2010	07-20-2010	07-21-2010	07-22-2010	07-23-2010
Week 7	07-26-2010	07-27-2010	07-28-2010	07-29-2010	07-30-2010
Week 8	08-02-2010	08-03-2010	08-04-2010	08-05-2010	08-06-2010
Week 9	08-09-2010	08-10-2010	08-11-2010	08-12-2010	08-13-2010

06-14-2010 [ top ]

• Miraculin and brazzein constructs due to arrive on Wednesday from Mr. Gene

BioBrick Transformation

BioBrick parts from the 2010 iGEM kit were transformed and grown in highly competent TURBO bacteria.

• Wintergreen Scent Pathway:
  

BBa_J45700 - entire pathway, Ampicillin
BBa_J45004 - BSMT1 only, Ampicillin
(Not in 2010 BB Kit: BBa_J45017 - PchB, PchA)

• Banana Scent Pathway:
  

BBa_J45250 - ATF3 + Promoter, Ampicillin?
BBa_J45014 - ATF3 only, Ampicillin
(Not in BB 2010 Kit: BBa_J45400 - BAT2 and THI3)

06-15-2010 [ top ]

Primer Designs for Agrobacterium Vector

• Primers were designed to amplify from the Expression Series pORE Agrobacterium plasmid (e3) 1)the pENTcup2 promoter, 2) the tNOS stop sequence, 3) the tNOS stop sequence + additional stop codon and 4) the pHLP promoter.
  

Note: the NOSterm_BB_R primer works for both tNOS and tNOS+STOP codon sequences.

   pENTcup2_BB_F
   CCTTTCTAGAGGGATCTTCTGCAAGCATCT

   pENTcup2_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTTCCGGTGGGTTTTGAGGT

   STOP_NOSterm_BB_F
   CCTTTCTAGATGAGATCGTTCAAACATTTGG

   NOSterm_BB_F
   CCTTTCTAGAGATCGTTCAAACATTTGGCA

   NOSterm_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTGATCTAGTAACATAGATGACA

   pHPL_BB_F
   CCTTTCTAGAAACGTGGATACTTGGCAGTG

   pHPL_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTCTTTTGAGCTTAGAGGTTTTT

BioBrick Transformation

• Colonies were observed after overnight culture growth, but in low quantities.
  • J45700 and J45004 (both Wintergreen Pathway) showed minimal number of colonies on both 10μL and 100μL cultures.
  • J45250 and J45014 (both Banana Pathway) showed no colonies on either the 10μL or 100μL cultures.

Codon Usage in Arabidopsis

Using http://gcua.schoedl.de/

Wintergreen Pathway:
BioBrick Part #: BBa_J45700
Original Organism: Pseudomonas aeruginosa

BBa_J45700 BBa_J45700 BBa_J45700 BBa_J45700

Banana Pathway:
BioBrick Part #: BBa_J45014
Original Organism: Saccharomyces cerevisiae
BBa_J45014 BBa_J45014 BBa_J45014

BioBrick Part #: BBa_J45250
BBa_J45250 BBa_J45250 BBa_J45250 BBa_J45250

Valencene Pathway:

Valencene Valencene

Valencene Extraction

Used RNeasy Plant Mini Kit to extract RNA from the flavedo of an Organic Valencia Orange.

06-16-2010 [ top ]

06-17-2010 [ top ]

06-18-2010 [ top ]

06-21-2010 [ top ]

06-22-2010 [ top ]

06-23-2010 [ top ]

06-24-2010 [ top ]

06-25-2010 [ top ]

06-28-2010 [ top ]

06-29-2010 [ top ]

06-30-2010 [ top ]

07-01-2010 [ top ]

07-02-2010 [ top ]

07-05-2010 [ top ]

07-06-2010 [ top ]

07-07-2010 [ top ]

07-08-2010 [ top ]

07-09-2010 [ top ]

07-12-2010 [ top ]

07-13-2010 [ top ]

07-14-2010 [ top ]

07-15-2010 [ top ]

07-16-2010 [ top ]

07-19-2010 [ top ]

07-20-2010 [ top ]

07-21-2010 [ top ]

07-22-2010 [ top ]

07-23-2010 [ top ]

07-26-2010 [ top ]

07-27-2010 [ top ]

07-28-2010 [ top ]

07-29-2010 [ top ]

07-30-2010 [ top ]

08-02-2010 [ top ]

08-03-2010 [ top ]

08-04-2010 [ top ]

08-05-2010 [ top ]

08-06-2010 [ top ]

08-09-2010 [ top ]

08-10-2010 [ top ]

08-11-2010 [ top ]

08-12-2010 [ top ]

08-13-2010 [ top ]