Team:Washington/Tools Used/Next-Gen Cloning

To create plasmids with more freeform inserts than possible with traditional BioBrick restriction cloning, we used a method described in [http://www.natureprotocols.com/2009/04/16/onestep_enzymatic_assembly_of.php Nature Protocols 2009] in which parts are extracted from standard biobricks with primers designed with an extra sequence on their 5' ends that is homologous to the part that will be next to it in the final plasmid. The primers must have a TM of at least 50C, otherwise These parts are then stiched together using "overlap extension" PCR, in which two adjacent parts that have been extracted in the aforementioned manner are put into a normal PCR reaction with two primers that match the added homology on the outside of the desired construct. This results in linear DNA that is the two parts stuck end-to-end with no seam of any sort and homologies to parts that will be adjacent in the final plasmid on its end. This process is repeated until the resultant pieces are roughly 500bp in length.

This method can also be used to add short sequences (i.e. promoters,RBSs, etc) in between parts if rather than design primers to be homologous to the part next-door, they're designed with the sequence to be inserted. This works as long as there is still an overlap between the adjacent with a Tm higher than 50C.

The ~500bp pieces of the final plasmid are then all put together in one reaction as described in Gibson's paper, this stitches them together and circularizes them. They can then be transformed.

This type of procedure relies heavily on introduced homologies on the ends of all the parts involved. Initially we used the standard bioBrick prefix and suffix as the homologous region with which to insert our construct into standard backbones, but this proved problematic because of the NotI site which lies between the E/X and S/P restriction sites in bioBrick backbones, as it is long, consists mostly of Gs and Cs, and is palindromic. This leads to possible mispriming, and an ambiguity in the final configuration of our plasmid (the insert could end up forward, backward, or circular. The backbone could also recircularize without taking up the insert at all) and in turn, a very low yield of our desired construct.

To remedy this, we designed a new prefix and suffix, based on the [http://dspace.mit.edu/handle/1721.1/46747 BglBrick standard] which allows for the elimination of the NotI sites. We developed the prefix gaattcctgctgcggagatct and the suffix ggatccaacagggttctcgag by aiming for roughly 50% GC content and a Tm around 68 as calculated by [http://www.finnzymes.com/tm_determination.html Finnzymes Tm calc]. We then modified Psb1A3 and Psb3K3 with these prefixes and suffixes, and had much greater success.

References:

Daniel Gibson, One-step enzymatic assembly of DNA molecules up to several hundred kilobases in size

[http://www.natureprotocols.com/2009/04/16/onestep_enzymatic_assembly_of.php Nature Protocols 2009]

Gibson, D.G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases

[http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Nature Methods 2009]