August 1-8

  In this period(waiting the gene synthesize period), we divided the iGEM works to three parts.

• Modeling

• In case of modeling we found hundreds of other antibody sequence for comparing. We found a sequence of antibodies and run a program to find a structure of each antibody. After that we compare the similarity (numbers and figures) with structure alignment program. And we are searching for the mathmetical data that can help us to estimate our system's reaction rate and speed.
  

• BioBrick Design

• In a meantime, bio brick team finished wiki design. they put contents on bio brick submittion page. We have 6 bio bricks so far and all has uproaded on our wiki page.
  

• Introduction video of the Presentation
  

• For presentation team they made a short video. This video will be present before our main presentation for hook. It contains our motivation and our efforts and so on.
  

August 9

Do list

1. structural alignment

   we almost finished structural alignment part. Therefore we need to finish structural alignment part and write it on wiki

2. modeling

   We need theoretical data on affinity of our elements through our pathway for modeling. So we need to search on those data.

3. main page update

   we decided to put contents that might be confusing when others just look at the menu.

4. finishing introduction video

   we are going to take a picture of us for the video

5. adding 'tools' menu

   we are making new menu, 'tools'. we will put programs or tools that we used so far.

August 11

do list

1. modifying main menu
2. taking picture for introduction video
3. main page content

   we already finished design we only need contents

4. affinity data search

   we only need to find FGFR1-STAT1 Kd data

5. putting contents on discoverY wiki page

August 18

We send an e-mail that contains how we want our gene synthesis to be done. And to day we got reply by Bioneer which is our sponsor and helper. There were discussion on how this synthesis can be done and questions are asked on this project. So we gathered our ideas and made a conclusion. Answers and discussions

1. Cloning on S.pombe and cloning in pSB1C3 for submission is necessary things.
2. pSB1C3 plasmid information : http://partsregistry.org/Part:pSB1C3:Design
3. Part that we will going to put our fusion FGFR in S.pombe http://old.genedb.org/genedb/Search?name=wsc1&organism=pombe&desc=yes&wildcard=yes&searchId=Search
4. They offer a method using linker when we are making a Fusion FGFR gene. And we agreed on this idea.
5. Our primer design :

<Back of Fusion FGFR> - Forward:23bp, Tm 59. 5' - GTTCTGGAAGCCCTGGAAGAGAG - 3' - Reverse:23bp, Tm 60 3' - TACCGCCTGAGTTTGCGGCGACT - 5' <Front of Fusion FGFR> - Forward : 21bp, Tm 58 5' - ATGGTCTTTTTAAATTCCTCT - 3' - Reverse : 23bp, Tm 59 3' - AGGAGTCGGTTTTGTTGTCGGGG – 5' <STAT1> - Forward : 24bp, Tm 59 5' - ATGTCTCAGTGGTACGAACTTCAG - 3' - Reverse : 24bp, Tm 58 3' - AACTAAAGACACAGACTTCACATT - 5'

1. We decided to use middle expression vector instead of high expression vector for STAT1 cloning. Because high expression of foreign protein can make bad influence to the cell
2. There were misunderstanding on GAS promoter. This has to activate only the GFP. (We send our pathway to them for better understanding.)

PS. we are going to meet tomorrow for gene extracting.