"
Team:Panama/13 August 2010
From 2010.igem.org
(Difference between revisions)
Nikkibiotech (Talk | contribs) (→August 13) |
Nikkibiotech (Talk | contribs) (→August 13) |
||
| Line 5: | Line 5: | ||
'''Digestion Reaction''' | '''Digestion Reaction''' | ||
| - | Today we did the digest the plasmid that contain the promoter with the | + | Today we did the digest the plasmid that contain the promoter with the EcoR1 and Spe1 enzymes, and the plasmid with the RBS was digested with the Xha1 and Pst1 enzymes. |
[[Image:Cuadro_13_agosto.jpg|300px|thumb|left|alt text]] | [[Image:Cuadro_13_agosto.jpg|300px|thumb|left|alt text]] | ||
Latest revision as of 03:16, 28 October 2010
August 13
Digestion Reaction
Today we did the digest the plasmid that contain the promoter with the EcoR1 and Spe1 enzymes, and the plasmid with the RBS was digested with the Xha1 and Pst1 enzymes.
RESULTS
PCR Rhlab amplification
Now that we have our Rh1ab we are going to run a PCR of it using our first set of primers.
RhT-F1a 5' GCGATAGCTGTTTGCCTGTT 3'
RhT-R2a 5' TGGCAACCCTATCTGTTATGC 3'
First of all, we have to resuspend our primers since they come in a lyophilized manner. We need a stock solution of 100uM. Our working solution has a concentration of 10uM.
RESULTS
We tested three concentrations of primers to see which one worked better for us and we can see that all three concentrations worked! So from now on, just to be on the safe side, we're going to use the concentration of 1uM.
|
|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
