ViroBytes

Introduction

ViroBytes is a modified BioBytes procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies (Grimm et al., 2008). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.

AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These primers contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER^TM digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.

ViroByte Assembly Scheme

Important facts

Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.

BsaI recognition and cutting sequence:

  5'...GGTCTCN/NNNN...3'
  3'...CCAGAGNNNNN/...5'

hence the overhang created at each fragment ending: 5'-NNNN

Homology regions employed in our Virobyte approach were selected as follows:

between Anchor and Fragment1 ("Start overhang"):

  5'...ATGG...3'
  3'...TACC...5'

between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):

  5'...GGAG...3'
  3'...CCTC...5'

between Fragment2 and Fragment3 (bp 688-716 ,AAV1):

  5'...GACA...3'
  3'...CTGT...5'

between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):

  5'...AACC...3'
  3'...TTGG...5'

between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):

  5'...CAGC...3'
  3'...GTCG...5'

between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):

  5'...AACT...3'
  3'...TTGA...5'

between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):

  5'...GTGG...3'
  3'...CACC...5'

between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):

  5'...TCAC...3'
  3'...AGTG...5'

ViroByte design

• Anchor:

5'-Biotin-tctctctctctctctaagctt gtctgagtgactagcattcg ttaattaac+5nt(cap specific)

- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)

- italicized is HindIII recognition sequence

- bold is amplification sequence

- bold italicized is PacI recognition sequence

• Anchor complement:

5'-gttaattaa cgaatgctagtcactcagac aagctt

- reverse complimentary strand to Anchors

• Fragment X forward primers:

5'-gctacggtctcaNNNN+~20-25nt Cap specific

- bold is BsaI recognition sequence

- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)

• Fragment X reverse primers:

5'-gctacggtctcgNNNN

Protocols

Anchor preparation

References

Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.