Tuesday July 6, 2010

Happy Birthday Paul!!

Himika:

• Today I reran the transformation that I did yesterday July 5th where I constructed E0040 and pSB1AC3 and plate it on chloramphenicol.
• I also miniprepped the overnight cultures from last night. I13504 and I13507. The only cultures that grew were I13504 and I miniprepped 6 colonies from 1 plate.

• I also constructed E1010 with B0015.

• Procedure:
  • Insert
  • E1010 (pSB2k3) cut with EcoI/SpeI 5uL DNA
  • Buffer I was used 3.5uL
  • 0.5 uL of EcoRI and 0.5 uL of SpeI
  • 25.5 uL of water

• • Vector
  • B0015 (pSB1AK3) cut with EcoI/XbaI 5uL DNA
  • Buffer I was used 3.5uL
  • 0.5 uL of EcoRI and 0.5 uL of XbaI
  • 25.5 uL of water

• The vector was phosphatased with 5uL water, 4uL Buffer and 1uL phosphatase. The solution was left in 37 degree Celcius for 30 minutes and heat killed for 10 minutes in 65 degree Celcius.

• 5ul of the vector and the insert in a tube and add 10 ul of quick ligase buffer and 1 ul of quick ligase. The solution was left in room temperature for 10 minutes and transformed.

• I also did research on the ibpA/ ibpB pathways in order to present on to Dr. Schryvers on Friday.
• I also overnight cultured I13507 and plated the contstruct.

Raida: Today I worked on the Construction of R0040 (TetR promoter) in front of GFP construct (I13504) to test the reporter. This construction is working as our positive control of verifying that our GFP reporter works.

'Restriction Enzyme Digest of Insert (R0040)"

• 17.2 uL DNA
• 3.5 uL React 1 Buffer
• 0.5 uL EcoI, 0.5 uL SpeI
• 13.5 uL of Water

Restriction Enzyme Digest of Vector (I13504) Trial F

• 4.4 uL DNA
• 3.5 uL React 2 Buffer
• 0.5 uL EcoI, 0.5 uL XbaI
• 26.1 uL of Water

Restriction Enzyme Digest of Vector (I13504) Trial C

• 4.0 uL DNA
• 3.5 uL React 2 Buffer
• 0.5 uL EcoI, 0.5 uL XbaI
• 26.5 uL of Water

Restriction Enzyme Digest of Vector (I13504) Trial D

• 1.6 uL DNA
• 3.5 uL React 2 Buffer
• 0.5 uL EcoI, 0.5 uL XbaI
• 28.9 uL of Water

At the end of the heat killing process, I added

• 5 uL Antartic Phosphotase Buffer
• 5 uL of Water and
• 1 uL Antartic Phosphotase

It was placed in the water bath at 37°C for half an hour and then I ligated the insert and the vector using

• 5 uL of Insert and 5 uL of Vector
• 1 uL Quick Ligase
• 10 uL 2x Quick Ligase Buffer

The construct is left in the fridge overnight and transformation will be done tomorrow.

• Today I also worked on the Ethics component of our Project. In particular I looked at the "feasibility" of ynthetic Biology to be manipulated for Bioterrorism Purpose.

Jeremy: Today I ordered the primers for biobricking periplasmic RFP, plasmid switched last years I0500 into pSB1AK3 and overnights of construct I0500+B0034.

• Primers:
  • Forward Primer-GAATTCGCGGCCGCTTCTAGATGCAAAACGCC
  • Reverse Primer- GCTACTAGTATCACGACGTTGTAAAACGAC

• Plasmid Switch:
• Restriction Enzyme Digest of Insert C1 (I0500)
  • 7.5 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 23.0 uL of Water

• Restriction Enzyme Digest of Insert C2 (I0500)
  • 11.3 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 19.2 uL of Water

• Restriction Enzyme Digest of Insert C1 D (I0500)
  • 13.6 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 16.9 uL of Water

• Restriction Enzyme Digest of Insert C2 D (I0500)
  • 2.9 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 27.6 uL of Water

• Restriction Enzyme Digest of Vector (pSB1AK3)
  • 2.1 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 28.4 uL of Water

• Overnight
  • Same for each colony
    • -5mL LB Broth
    • -5uL Kanamycin Antibiotic
    • -inoculate with pipette tip

Non-wetlab tasks worked on today include researching wiki templates and designing t-shirt logo