From 2010.igem.org

Revision as of 22:40, 25 October 2010

Agarose gels

50 x TAE running buffer 1 l Tris-base 242 g Glacial acetic acid 57.1 ml 0.5 M EDTA 100 ml

Note: To prepare 0.5 M EDTA, dissolve 73 g EDTA in small volume of 1M NaOH, then ad H2O to 500 ml and adjust pH t0 8.0.

Usually make 1 % agarose – 4 g agarose (note: agarose is very expensive) in 400 ml 1x TAE buffer.

Heat in microwave to dissolve agarose (do not boil oer). Store at 60 C for continuous use.

To 30 ml agarose solution (30-40 ml full mini-gel and 15 – 20 ml half mini-gel) ad 1 ul ethidum bromide solution (1 % stock solution stored at 4C, small aliquot covered in aluminum foil stored on bench).

Pour gel and check for bubbles – let solidify for approx. 20 min.

Add approx. 2 ul Stop-mix to 10 ul sample and load 8 ul 1-kb ladder (400 ng --- each single band corresponds to approx. 20 ng DNA) as marker.

Run gel in 1 x TAE buffer at 120 V for 20 min (if current goes over 100 mA, the buffer is old or you have a different buffer in you gel than in the reservoir).

Note: You can pour several gels at once and store them in 1 x TAE buffer plus a drop of ethidium bromide at 4C (for approx. 1 week). For example, you get two gels out of a full mini tray by using two combs and cutting the gel in two pieces.

Attention !!!: Ethidium bromide is carcinogen – wear gloves and dispose used gels in the corresponding waste.

Attention !!!: The UV-lamp of the photo documentation system is pretty strong – use the protective face shield if you don’t want ending up with a heavy sunburn.

Turn off monitor of photo documentation system after use.

Antibiotics

Stock-solutions (store at –20C)

Ampicillin 100 mg/ml Chloramphenicol 50 mg/ml (in ethanol) Tetracycline HCl 30 mg/ml Carbenicillin 100 mg/ml Kanamycin 30 mg/ml Spectinomycin 50 mg/ml

Add 1 ul of antibiotica stock solution to for each 1 ml of medium. As antibiotics quickly degrade, add them to the liquid medium just before doing a cultivation. Allow media (plate) to cool before adding antibiotics (touch bottle without feeling burned). Store plates containing antibiotics at 4C.

Bicinchoninic acid (BCA)protein assay

(Pierce instructions: http://www.piercenet.com/Technical/default.cfm?tmpl=/Lib/ViewDoc.cfm&num=0731)

Sensitivity: 5 – 200 ug/ml protein concentration in the sample (not in reaction mix !!!)

Prepare working reagent: Mix 50 parts reagent A and 1 part reagent B

Reaction: 50 ul sample plus 1 ml working reagent Mix and incubate 30 min at 60C, stop by placing on ice (3 reactions per sample !)

Standard protein: BSA (prepare standard concentrations 10, 20, 30, 40, 50, 60, 70, 80, 100 ug/l)

Calibration curve: 50 ul BSA standard solution (10-100 ug/l, samples each concentration) puls 1 ml working reagent Mix and incubate 30 min at 60C, stop by placing on ice

Biological buffer systems – pH ranges

pH range

1.1 – 3.3 glycine/HCl 1.1 – 4.9 Na-citrate/HCl 3.6 – 5.6 acetic acid/NaOH (acetate buffer) 4.9 – 8.0 KH2PO4/Na2HPO4 (Soerensen buffer) 5.0 – 6.6 Na-citrate/NaOH 5.8 – 8.0 KH2PO4/NaOH 5.8 – 8.0 Na2HPO4/NaH2PO4 (isotonic) 7.2 – 9.0 Tris/HCl 8.55 – 12.9 glycine/NaOH

Dephosphorylation –CIP treatment

• To avoid religation of a vector backbone it is necessary to treat the cut plasmid with calf intestinal alkaline phoshpatase (CIP) to remove 5’-phosphate groups. As only the vector backbone lacks the 5’-phosphate groups, the 5’-phosphate groups provided by the insert are sufficient for the ligase to carry out the ligation of the two DNA strands (the remaining two nicks are later repaired in E. coli).

• Note: Never treat both insert and vector backbone with CIP.

• CIP treatment becomes necessary, if you want to ligate an insert into a single restriction site. For example, an EcoRI digested insert into a likewise EcoRI digested plasmid. Although you could theoretically discriminate on an agarose gel between cut and non-cut vector and isolate the band corresponding to the cut vector from the gel, in most cases you get some cross-contamination from uncut plasmid (which can run in different supercoiled forms and apparent sizes) in your gel-extract. Since the transformation efficiency of uncut plasmid is much higher than your ligation products, you will get a huge background of plasmids without inserts.

• For CIP treatment:

 Add 1-2 ul CIP to the digestion mixture and incubate together with the restriction enzymes at 37C.

See NEB catalog and web-page: http://www.neb.com/neb/frame_cat.html http://www.neb.com/neb/frame_tech.html

DNA-Sequencing

ABI dye terminator cycle sequencing – preparation of sequencing reaction for DNA-Sequencing Facility Snyder Hall:

3-4 ul mini-prep plasmid DNA (1-2 ug DNA required) 4 ul sequencing primer (1 pmol/ul) (3.2 pmol required) ad. H2O to total volume of 12 ul

Note: Each sequencing reaction costs $20 !!

Ethanol precipitation of DNA

• for quick concentration of DNA (although salts may remain as impurities) • add 1/10 vol 3 M NaAc pH 4.8 to DNA solution and mix • then add 2.5 vol icecold ethanol and mix • freeze 20 min –20C or 10 min –80C or 30 sec liquid nitrogen • centrifuge (20 min at maximum speed (14,000 rpm) at 4C and carefully decant supernatant from precipitated DNA pellet (always place tubes with “lid-opener” facing to the center into the rotor --- by doing so, pellet will be on the opposite site of the tube and decanting of supernatant will not make the pellet come off the tube wall. • Wash pellet with 70% ethanol (RT) to dissolve salt impurities by adding the ethanol, mixing and centrifugation (20 min at maximum speed at 4C). • Decant supernatant carefully and dry pellet at 37C until you can’t smell any ethanol any longer and all liquid has disappeared (do not overdry, otherwise DNA will be difficult to dissolve again) • Dissolve DNA in 10 mM Tri/HCl buffer pH 8.5 (Qiagen EB buffer)

Extraction of DNA from agarose gels

A preparative agarose gel to separate DNA fragements (e.g. digestion products, PCR products) from other DNA fragments is often required. Load entire DNA containing solution (containing 20% Stop-mix) on a preparative of a gel (use preparative combs) and run gel. Carefully cut out the desired DNA band (do not contaminate with other DNA bands) using a clean scalpel and transfer into a 2 ml tube.

For extraction use one of the following Qiagen Kits:

Qiagen Qiaquick Gel Extraction Kit: (recommended for most applications)

Note: Fragments < 100 bps can not be isolated. Note: Use Qiagen EB buffer pH 8.5 for elution.

>>>> Refer to the Qiaquick Spin Handbook for instructions.

Qiagen Qiaex II Gel Extraction Kit (use for DNA-shuffling)

Note: Fragments <100 bps can be isolated – this kit must be used for the extraction of 50 bps during DNA-shuffling. Note: Use Qiagen EB buffer pH 8.5 for elution.

Additional information can be found in the “Qiagen DNA cleanup and gel extraction handbook” at http://www.qiagen.com/literature/cleanlit.asp#qiaexii)

Genomic bacterial DNA - Quick isolation protocol

1. Resuspend stationary phase cells (1-5 ml, depending on cell density) in 1. 5 ml freshly prepared lysozyme mix (30 mM Tris/HCl pH 8.0, 50 mM EDTA, 50 mM NaCl, 1 mg/ml lysozyme) 2. incubate 30 min 37C 3. add 200 ul 10 % SDS solution 4. incubate 30-60 min 37C until solution becomes clear 5. extract solution 2-3 times with 2 vol phenol (phenol is toxic, wear gloves and wear safety goggles, work in the hood and dispose solid (tubes, tips etc.) and liquid waste into the corresponding phenolic waste containers) 6. precipitate genomic DNA with isopropanol: a. add 1/10 vol 3 M NaAc pH 4.6 and 0.6 vol RT isopropanol to DNA solution b. precipitate genomic DNA by centrifuging 10 min at maximum speed (if genomic DNA concentration is high, DNA precipitate is visible as a white cotton ball and can be pulled out of the solution with a glas rod or tooth pick without centrifugation) c. wash genomic DNA with 70% ethanol and air dry pellet (see ethanol precipitation) d. be particularly careful to avoid over-drying – once genomic DNA gets to dry, it is almost impossible to get the DNA back in solution e. dissolve genomic DNA in 200 ul 10 mM Tris/HCl buffer pH 8.5 (Qiagen EB buffer) by incubating for 2 hrs at 37C f. Note: handle genomic DNA solution with care – to avoid shearing of DNA: do not vortex and cut tip of blue pipettor tips in order to get a wider opening.

Note: Works best for gram-negative bacteria with lysozyme degradable cell walls.

Glycerol cultures

Add to 2 ml of a mid-log or 1 ml of a fresh stationary phase culture 1 ml sterile glycerol solution ( 65 % (v/v) glycerol, 0.1 M MgSO4, 25 mM Tris/HCl pH 8.0). Mix and store at –80C. To inoculate from a glycerol culture – scrape some ice from the top of the culture – never allow the culture to thaw (freezing and thawing destroys cells).

Ligase Free Cloning

1. Plasmid preparation: a. Cut the plasmid/vector with appropriate enzymes (for cloning into pUCBB-GFP, digest it with BglII and NotI) b. Gel purify the vector fragment c. Measure the vector concentration by nano-drop (you need 100ng vector for 1 cloning reaction)

2. Insert preparation: a. Each primer should have the following: • 15-20 bp overlap with the gene of interest • 15-20 bp overlap with the linearized plasmid including restriction site • Primers for CSD lab biobrick vectors should add the following to the gene specific sequence: - pucBB-LF-BglII-F 5’-AGAAGGAGGAGATCT---Start - pucBB-LF-NotI-R 5’-GATGCTCGAGGCGGCCGC---End (reverse complement) i.e., …TAAGCGGCCGCCTCGAGCATC-3’ is added to the end of the gene sequence b. PCR (2 or 4 x 50µl) for the insert using Vent following the usual protocol c. Gel purify the insert d. Measure the insert concentration by nano-drop (you need 100ng insert for 1 cloning reaction).

2. Transformation of competent E. coli a. If necessary, use speed-vac to concentrate your vector/insert, so that you can have 100ng vector + 100ng DNA in about 5-25 µl total volume b. 1 tube of chemically competent E.coli + 100ng vector + 100ng insert c. Incubate on ice, 20 minutes d. Heat shock 35-40s e. Add 800µl SOC, incubate at 37°C for 1 hour with shaking (recovery) f. Spin down the cells: 4000rpm, 5 minutes g. Remove approximately 900µl SOC, so the volume of the cell pellet + remaining SOC is less than 120µl h. Resuspend the cells in the remaining SOC, plate the cells on an appropriate antibi-otic plate i. Invert the plate & incubate at 37°C overnight

Example: primer design for ligase-free cloning into pUCBB (gene HnCA)

AGAAGGAGGAGATCTATGAACACCCGTAACACACGAAGCAAGCAACGCGCACCGTTTGGTGTTAGCTCATCAGTCAAACCTCGGC TTGACTTGATTGAGCAAGCACCAAACCCTGCCTATGACCGCCATCCTGCTTGCATAACGTTGCCTGAGCG TACCTGCCGGCACCCGTTAACTGACCTTGAAGCCAACGAACAACTGGGTCGTTGCGAGGATAGCGTCAAG AACCGTTTTGATCGCGTTATCCCTTTCTTGCAAGTTGTTGCTGGCATTCCTCTTGGTCTGGATTATGTTA CCCGTGTTCAAGAATTAGCCCAGTCGTCGCTTGGACATACGCTGCCCGAAGAATTACTCAAAGATAATTG GATCAGTGGGCACAATTTAAAAGGCATTTTTGGCTACGCGACTGCTAAAGCACTAACAGCAGCCACGGAA CAATTCAGTCGTAAAATAATGTCTGAGAAGGACGATTCCGCATCGGCCATTGGCTTCTTCCTGGATTGCG GGTTCCACGCAGTGGACATAAGCCCTTGTGCCGATGGTCGTCTCAAAGGGTTACTGCCTTACATATTGCG TTTGCCCCTTACGGCATTCACCTATCGTAAAGCCTACGCAGGCTCGATGTTCGATATTGAAGATGATCTG GCACAGTGGGAGAAAAATGAACTCCGCCGTTATCGTGAAGGTGTTCCAAATACAGCGGATCAGCCAACAC GATACCTGAAAATTGCTGTGTATCATTTCAGCACCTCTGACCCGACACACTCTGGCTGCGCGGCACACGG CAGTAATGATCGTGCAGCACTGGAAGCGGCTTTAACCCAGCTGATGAAATTCAGAGAAGCGGTTGAAAAT GCCCATTGCTGCGGCGCAAGTATCGATATTTTACTGATTGGCGTTGATACGGATACGGATGCCATTCGCG TTCATATTCCGGATAGCAAAGGTTTTTTGAATCCGTATCGTTATGTTGACAACACAGTAACTTATGCGCA AACACTACATCTGGCGCCGGATGAGGCTCGTGTGATTATTCACGAAGCAATTCTCAACGCAAACCGCAGC GATGGTTGGGCTAAAGGAAATGGAGTAGCCAGCGAGGGGATGCGTCGTTTTATTGGTCAGCTTTTGATCA ACAACCTCTCGCAAATCGATTACGTAGTAAATCGTCATGGTGGTCGCTATCCACCCAATGATATTGGTCA TGCTGAGCGATATATCAGTGTTGGTGATGGTTTTGATGAAGTTCAAATCCGGAATTTAGCCTACTACGCG CATTTGGATACGGTTGAAGAAAATGCGATTGATGTGGATGTGGGAATCAAAATTTTCACCAAACTTAATT TGAGTCGAGGTTTACCGATTCCGATTGCCATCCACTATCGCTATGACCCCAATGTTCCAGGCTCCAGAGA AAGAACCGTGGTCAAAGCAAGACGGATATACAACGCCATTAAAGAGCGGTTCTCATCCTTGGATGAGCAG AATCTATTGCAGTTTCGTTTGAGCGTTCAGGCGCAGGATATCGGAAGCCCGATTGAAGAGGTTGCATCCG CATGAGCGGCCGCCTCGAGCATC

Primers BB-HnCA-F: AGAAGGAGGAGATCTATGAACACCCGTAACACACGAAGC

BB-HnCA-R: GATGCTCGAGGCGGCCGCTCATGCGGATGCAACCTCTTCAATCG

Ligase-free cloning into pET21b (NdeI/XhoI)

POS2-pET-F: CTTTAAGAAGGAGATATACATATGGTCCGGACTCGACCCACC

POS2-pET-R: GTGGTGGTGGTGGTGGTGCTCGAGGCTGTCTAGTCTCGACACATGG

(TAA)CTCGAGCACCACCACCACCACCAC This reverse primer will add a his tag, unless there’s a stop codon in the gene sequence.

Ligation

(with NEB-ligase) Typical reaction volume either 10 or 20 ul:

For example: 20 – 50 ng cut vector (also called backbone) preparation 50 – 200 ng cut insert preparation 1 ul 10 x ligase buffer (note: Gibco buffer is 5 x fold) 0.5 ul ligase ad. H2O to 10 ul total volume

Incubate 1 h at RT (or overnight at 4 C, although there will rarely better results than at RT) and transform complete mixture.

Note: Thaw ligation buffer completely – no precipitate visible – and mix thoroughly before using. Ligase buffer must be aliquoted in 10-20 ul portions and these frozen aliquots are then used for ligation. Repeatedly thawing and freezing of ligation buffer kills the ATP in the buffer.

Pipette ligase carefully – no excess drops on the tip to ensure accurate volume. Never vortex reactions containing DNA modifying enzymes – always mix by aspirating with the pipettor.

Sticky-end ligation: Use a 1:2-3 ratio of vector:insert Blunt-end ligation: Use a 1:1 ratio of vector:insert

Always check DNA-concentrations of vector on insert on the same gel prior to ligation. (You can compare the intensity of your DNA bands with that of the bands of the 1-kb ladder: if you load 8 ul kb-ladder (400 ng) then each band corresponds to approx. 20 ng.)

Too high vector and insert concentrations do not result in good ligation efficiencies – it is better to try different concentrations of vector and insert.

Be sure that both vector and insert preparation are pure – e.g. by purifying with the Promega Wizzard Kit or Qiagen gel extraction kit.

Additional tips and protocols are found on NEB’s web-page: http://www.neb.com/neb/frame_cat.html http://www.neb.com/neb/frame_tech.html

1-kb ladder

(Gibco –life technologies: http://www.lifetech.com/content.cfm?pageid=1741&CFID=825626&CFTOKEN=62707800#mw)

Preparation of ready-to-use ladder:

25 ul 1 kb ladder (1 ug/ul) 325 ul 1 x TAE buffer 130 ul Stop-mix (agarose gel loading buffer)

( 1 ul ladder = 50 ng DNA)

Note: 100 bp ladder (also from Gibco) is prepared accordingly.

Loading buffer for agarose gels (Stop-mix)

100 ml

4 M Urea 24.02 g 10 mM EDTA 372 mg 50 % glycerol 50 ml 0.1 % bromphenol blue 0.1 g ad. H2O

Note: For separation of fragments < 100 bp use Stop-Mix without dye.

Media

LB (low-salt Luria Bertani) (standard E. coli medium)

tryptone		10 g/l

yeast extract 5 g/l NaCl 5 g/l (low-salt medium)

Pouring plates

Let the media cool until you can touch the bottle (flask) without feeling burned. Don’t cool too much or the agar will solidify. Add antibiotic. Pour plates so that bottom of the plate is covered. Flame media briefly to get rid of bubbles, but not too long otherwise antibiotic gets killed and plastic melts. Let cool before refrigerating to avoid condensation inside the plate. Store plates upside down so that no liquid drops on the media – write any information on the bottom of the plate so that losing the top of the plate will not mess up your experiment.

Microscopy

Preparations were viewed using a Nikon Eclipse E800 photomicroscope equipped with brightfield, DIC, phase and fluorescence optics including a 120 W X-Cite epi-fluorescence illuminator with UV (excitation filter 330-380, barrier 420 nm), blue (excitation filter 470-490 nm, barrier 520-580 nm) and green (excitation filter 510- 560 nm, barrier 570- 620 nm) filter sets. The samples were viewed using either a 4X, 0.13 n.a. plan fluor; 10X, 0.30 plan fluor; 20X, 0.50 n.a. plan fluor; 40X, 0.75 n.a. plan fluor; 60X, 1.40 n.a. plan apo; or100X, 1.3 n.a. plan apo objectives.16-bit digital images were collected using a Roper CoolSnap HQ monochrome camera and captured to a Pentium IV 2.6 GHz personal computer using Image Pro Plus AMS version 6.3 software (Media Cybernetics, Silver Springs, MD 20910).X, Y and Z-motor movements, filters and shutters were managed using a Ludl MAC 3000 controller (Ludl Electronic Products Ltd., Hawthorne, NY 10532) interfaced to the ImagePro software.The instrument is housed and maintained by the University of Minnesota - College of Biological Sciences, Imaging Center, http://www.cbs.umn.edu/ic/.

PCR reaction

Typical reaction mixture (100ul) :

10 x PCR buffer (w/o added MgCl2) 10 ul 25 mM MgCl2 a) 8 ul (final concentration 2 mM) dNTP Mix (2.5 mM each dNTP) 8 ul (final concentration 200uM of each dNTP) Primer 1 (100 pmol/ul) 1 ul (100 pmol) Primer 2 (100 pmol/ul) 1 ul (100 pmol) Template DNA b) 1-10 ul (10 –200 ng) Taq 0.5 ul (2.5 U)

a) sometimes different MgCl2 concentration (1 – 5 mM) can increase PCR yield, I recommend, however, to optimize other parameters first, e.g. annealing temperature, as suboptimal MgCl2 concentrations increase the error-rate of Taq polymerase. b) Don´t use too little template, as early errors introduced by the Taq polymerase quickly amplify to significant error-rates.

Cycle conditions:

95 C 2 min (initial denaturation step) 1x

95 C 1 min (denaturation) 55 C 1 min (annealing) 25 x 72 C 1 min per 1.5 kb template (extension)

72 C 7 min (final extension step) 1 min

Depending on the PCR reaction, denaturation and annealing temperature and times are different. Denaturation times can be shorter in case of low-melting temperature, but maybe longer for PCR with genomic DNA templates. The annealing temperature depends on the melting temperature of the primer (note: calculate melting temperature only from the annealing part of the primer, not extensions that provide e.g. restriction enzyme recognition sequences). Usually, a annealing temperature 5C below the calculated melting temperature works well.

Note: Use 200 ul thin-wall tubes, place the tubes into the corresponding smaller spaces of the heating block of the Eppendorf Mastercycler.

PCR reaction can also be carried out in smaller volumes (e.g. 50 ul), this can sometimes be beneficial for the reaction performance.

Refer to the instruction manual of the Eppendorf Mastercycler for setting up a gradient, cycle extension or modified ramp times.

The Promega Taq Polymerase (Buffer A) is used for standard PCR reactions.

For difficult PCR reactions, addition of 2 – 20 % (v/v) DMSO (molecular biology grade) to the reaction mixture can help to obtain better PCR yields (try 2, 5 and 10% first). If this does not help, performing the PCR reactions with the Q-solution of the Qiagen PCR Kit might help (or using all components of the kit – although addition of Q-solution to a standard reaction works just as well).

dNTP-Mix: 2.5 mM each nucleotide

10 ul dATP (100 mM stock solution) 10 ul dCTP (100 mM stock solution) 10 ul dGTP (100 mM stock solution) 10 ul dTTP (100 mM stock solution) 360 ul H2O

aliquot 100 ul portions and store at –20C

For use: thaw carefully and keep on ice, freeze immediately after use.

Oligonucleotides

Always a 100 pmol/ul stock solution is prepared by dissolving the freeze dried pellet in H2O. Oligo-concentrations are found on the manufacture reference data sheet for each oligo.

Remember: dNTP’s and Taq polymerase are very expensive – use them with consideration.

A comprehensive list of tips and hints for PCR are found in the Qiagen handbook “Critical factors for successful PCR” available at http://www.qiagen.com/literature/brochures/pcr/index.html.

Primer design:

- 15 bps minimum length of annealing primer part – Primer needs to be 5-8 bps longer if annealing part is very AT rich in order to increase melting temperature - try to design primer with a 50% GC content - primer should contain at least one G or C at its 3’prime end to ensure optimal annealing where the polymerase starts DNA-extension.

Plasmid preparation

Purified plasmid preparations are prepared from overnight cultures of E. coli cells harboring the plasmid of interest (do not forget to add the appropriate antibiotic) using Qiagen Kits.

Small-scale plasmid preparations (up to 20 ug of high-copy plasmid DNA) are done with the Qiaprep Miniprep Kit from 1-5 ml overnight cultures. • This scale is sufficient for most applications.

>>>> Refer to the Qiaprep Miniprep Handbook for instructions.

Medium-scale plasmid preparations (up to 100 ug of high-copy plasmid DNA) are done with the Qiaprep Miniprep Kit from 50 ml overnight cultures. • Note, that the obtained plasmid DNA may contain more salt impurities than the Minipreparation and my need additional purification with the Promega Wizard Kit for efficient digestion with some enzymes.

>>>> Refer to the Qiagen Plasmid Purification Handbook for instructions.

Qiagen handbook plasmid purification and other information can be downloaded at: http://www.qiagen.com/literature/plklit.asp

Purification of PCR products and DNA

DNA (plasmids, digestion reaction mixtures, PCR reactions etc.) can be purified and concentrated with the:

Promega Wizard PCR and DNA prep purification Kit:

Note: Use 3 ccc luer lock syringes to apply resin and wash buffer to the columns.

Important: Use 10 mM Tris/HCl buffer pH 7.5 for elution (do not use the Qiagen EB buffer which has a higher pH of 8.5)

Note: PCR products need to be purified with this kit prior to DNase digestion.

>>>> Refer to the manual for instructions. Additional information can be found at: http://www.promega.com/tbs/tb118/tb118.html

Restriction enzyme digestion

Most of the enzymes used in the lab are purchased from NEB. The NEB-catalog and the NEB homepage provide you with reaction buffer charts and lots of other information on restriction enzymes, that will give you some ideas as to why your digestion might not work--- see http://www.neb.com/neb/frame_tech.html and http://www.neb.com/neb/frame_cat.html.

Single enzyme digestion:

For example:

10 ul plasmid DNA (mini-prep, typically 500 ng/ul plasmid DNA) 3 ul 10 x reaction buffer (check for enzyme specific buffer) 1 ul restriction enzyme (10-20 Units/ul) ad. H2O to 30 ul

incubate for 1-2 hrs at 37C (!!!! some enzymes require different reaction temperatures, e.g. SmaI 25C etc.) and check result on agarose gel.

Double enzyme digestion:

For example:

10 ul plasmid DNA (mini-prep, typically 500 ng/ul plasmid DNA) 3 ul 10 x reaction buffer * 1 ul restriction enzyme I (10-20 Units/ul) 1 ul restriction enzyme II (10-20 Units/ul) ad. H2O to 30 ul

incubate for 1-2 hrs at 37C (!!!! some enzymes require different reaction temperatures, e.g. SmaI 25C etc.) and check result on agarose gel.

• Chose a 10 x reaction buffer in which both enzymes work – simultaneous digestions may not be possible for all enzyme combinations (Then you have to purify reactions (e.g. using Promega Wizzard) before submitting to a second digestion)

• Tip: Some enzymes do not cut well if less than 10 bps extend beyond their recognition sequence. This can happen when simultaneously digesting with a second enzyme (especially, if this enzyme is more active) cutting near that recognitions sequence (for example in a multiple cloning site). You can look up the cleavage reactivity of enzymes close to the end of DNA-fragments in the NEB-catalog or at (http://www.neb.com/neb/frame_tech.html).

o To increase your digestion efficiency you should first add the less efficient enzyme to the digestion mixture and incubate for 1 hr and check a small aliquot of the digestion mixture on a agarose gel. If the plasmid is efficiently cut, add the less critical enzyme to the mixture and incubate for another hr. ---- By doing so (if cutting a plasmid), you can at least be sure that the less efficient enzyme has efficiently cut (you won’t be able to see whether or not the second enzyme did cut).

When designing oligo nucleotides for cloning experiments keep in mind that many enzymes need their recognition sequence at least 4 bps from the DNA-end for efficient cutting (see appendix of NEB catalog or http://www.neb.com/neb/frame_tech.html)

Site-directed mutagenesis- modified QuickChange protocol

Refer to Strategene’s QuickChange manual for a description of the general procedure and, especially, for the design of mutagenic primer: Go to http://www.stratagene.com/manuals/index.asp and select manual # 200518.

Note: Try to introduce a new restriction site into the mutagenic primer by silent mutagenesis for quick identification of positive clones carrying the desired mutation.

General primer design:

The mutation must be located in the center of the two, to each other complementary, mutagenic primer. On each site of the mutation are at least 15 bps required, as the Pfu polymerase has an internal 3’-proof reading activity and thus, would if less than 15 bps remove the mutation site inside the primers.

QuickChange Amplification reaction:

10 x Pfu PCR buffer* 10 ul dNTP mix 2 ul DMSO 10 ul Plasmid DNA 0.5 – 2 ul mini-prep plasmid >>>> make 4 reactions with Mut. primer 1 (5pmol/ul) 2.5 ul 0.5, 1, 1.5 and 2 ul Mut. primer 2 (5pmol/ul) 2.5 ul plasmid DNA. H2O 69 – 70.5 ul Pfu polym. (Stratagene) 2 ul (2.5 ul)

Cycle conditions: 95 C 4 min 1x

95 C 1 min 50 C 1.5 min 20x 68 C 2 min for each kb of plasmid size

95 C 1 min 50 C 1.5 min 1x 68 C 3 min for each kb of plasmid size

Check 10 ul of PCR reaction on agarose gel – you should see a strong band corresponding to the size of your template plasmid. Select the PCR reaction with the strongest band for further work.

DpnI-digestion: Add 2 ul of DpnI directly to PCR reaction mixture and incubate 3 hrs at 37 C in order to degrade the methylated template plasmid DNA (note: Plasmid DNA must have been purified from a methylation positive E. coli strain such as JM109) – the amplified plasmid containing the mutations is not methylated.

Transformation: Use 20 ul of reaction mixture for transformation of competent E. coli cells.

SDS gel electrophoresis

• Refer to Mini-Protean III Cell Instruction Manual for assembly of electrophoresis cell and running SDS-PAGE using the Laemmli Buffer System (preferably 12% gel).

• Stock solutions for running gel buffer, stacking gel buffer, 30% acrylamide/bis, TEMED solution are kept at 4C, 10% APS and 10% SDS solutions are kept at –20C.

• SDS-Sample Loading buffer:

10 ml glycerol 5 ml mercaptoethanol 3 g SDS 2.5 ml 0.05 % bromphenol solution (filtered) 12.5 ml stacking gel buffer

(store in aliquots at –20C)

Sample preparation:

For example, 10 ul protein sample + 90 ul sample buffer denature 5 min at 95C and centrifuge load 5-20ul on gel

For protein expression rate analysis of complete cells, • centrifuge 1 ml E. coli culture and wash cells with 50 mM Tris/HCl buffer pH 7.5 • dissolve cells in 200 ul sample buffer and denature 10 min 95C • centrifuge cells and load 5-20 ul cleared supernatant onto gel • if high DNA concentrations make sample to viscose, dissolve cells of 1 ml culture in 100 ul 50 mM Tris/HCl buffer pH 7.5 and disrupt cells by repeatedly thawing and freezing, centrifuge and add 2 ul (1:10 diluted DNAse in5 0 mM Tris/HCl buffer pH 7.5) to cleared supernatant and incubate 20 min 37C to degrade DNA, add 200 ul sample buffer and proceed as described above.

Staining: Use ready to use Coomassie Stain according to instructions – destain in water.

Dry gels according to BioRad’s instructions using the gel drying frame and drying solution.

Sterile solution and plasticware:

Important: Use sterilized solutions (autoclaved or sterilfiltered) (H2O, 3 M NaAc pH 4.8, Tris-buffer,LB etc.) and plasticware (tips, tubes etc.) for all molecular biology work --- the presence of DNA degrading enzymes is deadly for every experiment.

Storage of DNA containing solutions

Never store DNA in water as water will inevitable lead to degradation of the DNA. Use 10 mM Tris-HCl pH 7.5 – 8.5 for DNA storage. Tris-EDTA buffer (TE) can be used, but EDTA is not necessary and might inhibit some DNA modifying enzymes.

Transformation of E. coli – TSS method

TSS solution:

100 ml PEG 4000 15 g DMSO 5 ml (add after autoclaving) 1 M MgCl2-solution 5 ml LB add to 95 ml

Adjust pH to 6.5 prior to autoclaving.

After addition of DMSO aliquot TSS solution in 10 – 15 ml portions and store at –20C (TSS can get contaminated very quick).

Preparation of competent E. coli cells:

• Cultivate overnight E. coli culture* (*LB, add appropriate antibiotics if competent cells containing a plasmid for co-transformation are required) to inoculate main culture* 1:100 with overnight culture. Note: 50 ml culture will give 10 aliquots of competent cells Use larger culture volumes (e.g. 100 ml) to prepare more aliquots.

• Grow main culture at 37C and 260 rpm to ensure rapid growth to OD 0.4 – 0.6 (typically 2 – 3 hrs, fast growing cells to OD 0.4 reach highest transformation efficiencies) • Centrifuge cells for 10 min at 4000 rpm (4C) • Carefully resuspend cell pellet in cold (4C) TSS solution (2 ml TSS for each 50 ml culture volume). • Incubate resuspended cells for 5 min on ice and aliquot 200 ul competent cells in 15 ml sterile tubes. o Note: Handle cells carefully and keep them always on ice as they get very fragile during the TSS treatment. • Shock-freeze aliquoted cells in liquid nitrogen and store cells at –80C.

Transformation of TSS competent cells:

• Quickly thaw frozen competent cells at RT and place on ice. • Add 1 ul – 20 ul DNA solution (0.5 ul plasmid prep, 10 or 20 ul ligation mixture) to a 200 ul aliquote competent cells and mix carefully. • Incubate 20 min on ice. • Heat shock cells for 35 s in a water bath at 45C – Immediately add 800 ul LB (without antibiotics) and place on ice. • Incubate transformation mixture for 1 h at 37C to allow recovery. • Plate 10 ul (plasmid transformation) of mixture on LB plate. In case of ligation mixture, briefly spin down cells and decant most of the supernatant. Carefully resuspend cells in remaining liquid and plate on 4-6 plates.

Test-transformation:

• For checking transformation efficiency of competent cells:

Transform 10 ng of plasmid DNA (1 ul of pUC19 reference plasmid prepared by diluting 1:50 500 ug/ml pUC19 from Pharmacia) and plate 50 ul of 1 ml transformation mixture on LB plate:

Obtained colony number x 2 x 104 = transformation efficiency/ug DNA

• Transformation efficiency for E. coli cells should be > 106 to ensure good cloning results.