Team:SDU-Denmark/notebook
From 2010.igem.org
(Difference between revisions)
(→Modelling) |
(→Week 29) |
||
Line 136: | Line 136: | ||
--[[User:Toand|Toand]] 08:46, 4 July 2010 (UTC) | --[[User:Toand|Toand]] 08:46, 4 July 2010 (UTC) | ||
<br><br> | <br><br> | ||
+ | |||
+ | = Week 27 = | ||
+ | <br> | ||
+ | ''''' July 7th ''''' | ||
+ | <br> | ||
+ | ''In the Lab:'' | ||
+ | <br> | ||
+ | Experiments: <br> | ||
+ | We are apparently having problems with our PCR since no PCR has worked for the last two days. This has resulted in three failed PCR experiments: <br> | ||
+ | -pSB1A2 <br> | ||
+ | -pSB1A3 <br> | ||
+ | -Genomic purification <br><br> | ||
+ | We had some succes with minipreps, and now have plasmids pSB1A2 and pSB1A3 ready for assemblies. <br><br> | ||
+ | We made six batches of competent cells, and made two transformations: <br> | ||
+ | -pBad L-arabinose inducible promoter <br> | ||
+ | -cambridge beta-carotene biosynthesis operon <br> | ||
+ | 9 colonies of each were plated ON along with a positive and negative control. More transformations will follow tomorrow. <br><br> | ||
+ | ''''' July 8th ''''' | ||
+ | <br> | ||
+ | ''Experiments:'' Today we were troubleshooting the PCR process, which miraculously worked today. We only used TAQ polymerase for the reactions today and no PFU. This helped us narrow the reason for the last few days failure down to either human error or bad PFU enzyme. The good news is that PCR is finally working, which means that we will be able to run some colony PCR tomorrow.<br><br> | ||
+ | We also transformed quite a few cells today. We did transformations for four different biobricks, BBa_J13002 (a TetR repressed generator), BBa_K274210 (Beta carotene enzymes), BBa_B0012 (double terminator) and BBa_K098995 (heat sensitive promoter). We will see tomorrow morning if the transformations were a success. <br><br> | ||
+ | Last but not least we made an overnight culture of the biobrick backbone pSB3k3, which we'll use for miniprep tomorrow. <br><br> | ||
+ | == Flagella == | ||
+ | <br> | ||
+ | ''''' July 5th ''''' <br> | ||
+ | Today we have designed mutation primers, to remove a Pst1 site inside our operon. We have planned a silent mutation, so if we get it right it shouldn't affect our final protein. | ||
+ | <br> | ||
+ | ''Biobrick design:'' | ||
+ | <br> | ||
+ | FlhDC mutationsprimers:<br> | ||
+ | Passer til komplimentærstrengen:<br> | ||
+ | 5' - GGCAGCTTTGCCCGCAGCTTATGTC - 3' (Melting point basic: 63°C)<br> | ||
+ | <br> | ||
+ | Passer til coding strand: <br> | ||
+ | 5' - GACATAAGCTGCGGGCAAAGCTGCC - 3' (Melting point basic: 63°C) <br> | ||
+ | <br> | ||
+ | --CKurtzhals 20:04, 5 July 2010 (UTC) | ||
+ | |||
+ | <br> | ||
+ | ''''' July 8th ''''' | ||
+ | <br> | ||
+ | The FlhD,C group ran into some problems today regarding the primers for the silent mutation we want to introduce in our brick (for removing an illegal Pst1 site). The forward and reverse primers melting point is much too low in comparison to the mutation primers' melting point. We also hope to resolve that issue over the next few days. <br><br> | ||
+ | ''''' July 9th ''''' | ||
+ | <br> | ||
+ | ''Overview of the projekt progress and process:'' <br> | ||
+ | 1) We have had problems with out PCR's, none of them work! We have spent the last week trouble-shooting to find the problem and are down to the last few possible causes. It seems now, that the most likely cause is the annealing temperature of the primers, it is too low and the differences between the FW- and the RV-primers are too grate. We hope to solve the mystery soon. When the primer problem is solved we can finally extract the FlhDC operon from the bacteria. <br> | ||
+ | 2) The FlhDC operon entails an internal PST1 site, so we need to induce a silent mutation. For this we need the primers mentioned yesterday. We have fixed the primer annealing temperature problem and have ordered the primers. We hope to get them medio next week.<br><br> | ||
+ | These two steps are the most urgent that we work on now. Later on we have to do as follows:<br><br> | ||
+ | 3) We need to insert the FlhDC operon into the psb3k3 plasmid.<br><br> | ||
+ | 4) The psb3k3-FlhDC plasmid has to be transformed into cells.<br><br> | ||
+ | 5) Detect if cells are hyperflagellated.<br><br> | ||
+ | ''Progress report:'' Pernille, Sheila and I have worked as a group for the first time today. We have done Miniprep to extract the plasmids we want to insert our biobricks in and Chromosomal DNA PCR to test our primers and the perfect annealing temperature(documented in ''labnotes'') <br><br> | ||
+ | ''Working Hypothesis:'' No Change <br><br> | ||
+ | ''BioBrick Design:'' No Change <br><br> | ||
+ | |||
+ | --[[User:Louch07|Louch07]] 16:00, 9 July 2010 (UTC) | ||
+ | |||
+ | |||
+ | == Phototaxis == | ||
+ | <br> | ||
+ | ''''' July 5th ''''' | ||
+ | <br> | ||
+ | ''Progress report:'' | ||
+ | <br> | ||
+ | Today we've designed primers and worked out how we plan to characterize our light sensor. The experiment has to determine how much our protein stimulates the kinase activity of CheA, and in turn the phosphorylation of CheY. <br> We plan to measure directly on CheY. <br> | ||
+ | <br> | ||
+ | ''Exsperiment:'' <br> | ||
+ | - first we create a suspension of cells in water, keeping them in the dark until the experiment. <br><br> | ||
+ | - Then we take small microcapillary tubes, and use them to draw a specific amounts of fluid and bacteria from the suspension, as to ensure equal amounts of protein in our gels, more on which later. <br><br> | ||
+ | - We will then ad radio labeled ATP to our cells. (This step might be done earlier) <br><br> | ||
+ | - We now shine a colored light into our tube, varying wavelength and intensity in separate experiments.<br><br> | ||
+ | - After an equal length of time for each tube, we lyse the cells, and run the proteins through a gell. <br><br> | ||
+ | - We might need to tag our CheY with antibodies to show them, but in theory the only proteins that should increase in phosphorylation states would be CheY and CheA, and therefore the remaining bands should stay unchanged. <br> | ||
+ | <br> | ||
+ | We hope to show how the kinase activity of CheA on CheY is stimulated by our blue light, which wavelengths are optimal, and whether varying intensity of light has an effect on activity. <br> | ||
+ | <br> | ||
+ | ''BioBrick Design:'' We designed and ordered the following primers: <br> | ||
+ | // Melting points calculated with Oligocalc [1]<br> | ||
+ | <br> | ||
+ | NpSRII-HtrII-EcTsr primers:<br> | ||
+ | Upstream primer:<br> | ||
+ | 5' - GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGTGGGACTTACG - 3' (Melting point basic: 71°C) <br> | ||
+ | <br> | ||
+ | Downstream primer:<br> | ||
+ | 5' - GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATTAAAATGTTTCCCAGTTCTCCTCG - 3' (Melting point basic: 71°C)<br> | ||
+ | <br> | ||
+ | ninaB primers (Retinal enzym):<br> | ||
+ | Upstream primer:<br> | ||
+ | 5' - GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGCAGCCGGTGTCTTCAA - 3' (Melting point basic: 73°C)<br> | ||
+ | <br> | ||
+ | Downstream primer:<br> | ||
+ | 5' - GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTACTAAATGGCATTGGGTGCAA - 3' (Melting point basic: 71°C) <br> | ||
+ | <br> | ||
+ | References: <br> | ||
+ | OligoCalc: http://www.basic.northwestern.edu/biotools/oligocalc.html | ||
+ | <br><br> | ||
+ | ''''' July 6th ''''' | ||
+ | <br> | ||
+ | ''Morning Meeting:'' | ||
+ | <br> | ||
+ | A morning meeting was held with our supervisors and instructors, to determine the overall structure of our lab activities. We came to consensus on dividing into three lab groups and a modelling group. The three lab groups will be working on: <br><br> | ||
+ | -The ninaB brick <br><br> | ||
+ | -The FlhDC operon <br><br> | ||
+ | -The Photosensor <br><br> | ||
+ | Each group will be responsible for further development of their bricks, construction and planning of experiments to characterize them. The modelling group will be responsible for advising groups on what characteristics to model. <br><br> | ||
+ | We've planned for the crash course team to attempt transformation of our bacteria with the cambridge part. These transformed strains will be used by the retinal group. <br><br> | ||
+ | We further reached consensus on office hours, cake issues and calendar issues. <br><br> | ||
+ | ''In the lab:'' | ||
+ | <br> | ||
+ | Participants in the lab-crash-course v. 2.0 have conducted to experiments. Both failed, but we have learned lessons for further lab-work. <br><br> | ||
+ | - Purification of Genomic DNA: We failed to collect a sufficient biomass. Use overnight cultures from now on. <br><br> | ||
+ | - Quick and dirty microwave-oven + primer PCR amplification of FlhDC operon: We might not have nuked the bacteria enough, or we might fave failed to design our pcr process properly. (did we remember primers?!) <br><br> | ||
+ | Phototaxis (Retinal and Fusion protein.) <br><br> | ||
+ | Progress report: From now on the phototaxis group will consist of Maria, LC, Tommy and Chritsian. We will prioritize work on the Drosophila retinal enzyme gene, until we get physical DNA for the synthetic protein. <br><br> | ||
+ | If we fail to establish contact with Spudich lab within 14 days, our work will shift to synthesizing the protein ourselves, using physical DNA from halobacteria and e. coli, together with the sequence and the recipe for success, found in their article. <br><br> | ||
+ | --CKurtzhals 19:42, 6 July 2010 (UTC) | ||
+ | <br><br> | ||
+ | ''''' July 7th ''''' | ||
+ | <br> | ||
+ | ''Progress Report:'' <br> | ||
+ | We have not yet established contact with Spudich Lab, who are in possesion of strains with the physical DNA we need. Our cDNA from the Drosophila registry hasn't been ordered either. <br><br> | ||
+ | We might have to make the fusion protein ourselves. We are therefore looking into protocols for growing halobacteria. The ones we are interested, N. Pharaonis are apparently not able to grow well in standard agar, as they require large salt concentrations, and don't run on glucose since their glycolysis is non-functional. <br><br> | ||
+ | no real work has been done with regards to the retinal brick. <br<<br> | ||
+ | Working Hypothesis no changes here. <br><br> | ||
+ | --CKurtzhals | ||
+ | <br><br> | ||
+ | ''''' July 8th ''''' | ||
+ | <br> | ||
+ | We sent an email to the Spudich lab today, asking if we could get the SRII,HtrII,Tsr fusion,chimera-protein from them. Now we are just waiting (and hoping) for a positive answer, so that we will be able to proceed with this part of the project. <br><br> | ||
+ | ''''' July 9th ''''' | ||
+ | <br> | ||
+ | ''progress report:'' We have run colony-PCR on the cambridge BBa_K274210 brick we have attempted to transform into our cells. We have also run colony pcr on a RBS, a RFP reporter and a heat inducible promoter. All but the K274210 colonies showed bands at correct lengths, and the RFP colonies had turned bright red. | ||
+ | <br>Jakob has ordered primers and cDNA from drosophila melanogaster. | ||
+ | <br>Lars Christian and Maria will be working over the weekend, to make overnight cultures, and freeze cells, so we will be ready to make a new batch of competent cells next week. We need both coli TOP10 and M1655. | ||
+ | <br><br>Troubleshooting on Cambridge brick: | ||
+ | <Br>We suspect our elongation time of being to short. This might explain the smear at the bottom of each well. | ||
+ | <Br>-The length of the part in this plasmid is 4856Bp. | ||
+ | <br>-The reaction rate for this enzyme is stated as 35-100nt/sec at 72°C and 40% of that at 55°C | ||
+ | <br>-we ran the elongation for 5 minutes at 55°C giving us 4200-12.000 nt/elongation. | ||
+ | <br><br>Another problem could be the length of our part. Apparently we are opperating on the limit of what the polymerase can do, most companies stating that it will work for 3-4kb and can be pressed to 5kb if conditions are optimal. Many also suggest increasing [MgCl2] at low yields. We might also attempt that. Yet another possibility is that our colonies didn't contain any plasmids with our part. | ||
+ | <br><br>We will be attempting new colony pcr in the coming week, with elongation set to at least 6 minutes at 55°C. Perhaps we will attempt it with two different polymerases, increasing [MgCl2] in the Taq mix. | ||
+ | <Br><br>We have considered other ways of getting physical dna for our fusion protein. Two options come to mind if we can't get it from spudich lab. | ||
+ | <br>- getting it synthesized | ||
+ | <br>- Maybe getting the strain with the natromonas proteins from the 2007 melbourne team. | ||
+ | <br><br>''working hypothosis'': No changes | ||
+ | <br><br>--[[User:CKurtzhals|CKurtzhals]] 21:23, 9 July 2010 (UTC) | ||
+ | |||
+ | |||
+ | == Modelling: == | ||
+ | <br> | ||
+ | ''''' July 5th ''''' | ||
+ | <br> | ||
+ | ''Progress report:'' Today we have been discussing Stokes and Navier-Stokes equations in relation to the system we would like to model. After witch we tried to identify a differential equation describing the system. The following physics books have been used: <br><br> | ||
+ | The theory of polymer dynamics, M. DOI, S. F. Edwards, oxford science publications, 4. edition 1992. <br><br> | ||
+ | Physics of continuous matter, B. Lautrup, IOP publishing, 2005. <br><br> | ||
+ | ''Working hypothesises:'' a row of rigid screws with one end attached to a surface with the ability to bend in an angel θi and generate a force Fi. The forces generated by a screw may influence the angel of other screws and the effect the entire system witch in term affects the first screw. When the physics of the system is determined we hope to model variations of θi with the force Fi. <br> | ||
+ | --Toand 19:06, 5 July 2010 (UTC) | ||
+ | <br> | ||
+ | ''''' July 8th ''''' | ||
+ | <br> | ||
+ | ''Progress report:'' We have almost finished with the equation jumbling. We have been able to create some equations which we feel will describe the system accurately. Next we will try to implement these on a computer. When we fee sure about the system the equations and a sketch of the system will be put in the progress report.<br><br> | ||
+ | ''Working hypothesises:'' No changes <br><br> | ||
+ | ''''' July 9th ''''' | ||
+ | <br><br> | ||
+ | ''Progress report:'' We have started implementing our model. We are discussing which forces are actually effecting the system. Besides the forces produced by the flagellas, we are discussing whether the flagellas have a favored position that it would be pushed towards, when not effected by outer forces. We are also discussing whether thermal forces should be included.<br><br> | ||
+ | ''Working Hypothesis:'' No Change. <br><br> | ||
= Week 29 = | = Week 29 = |
Revision as of 12:01, 22 October 2010