"
Team:Imperial College London/Software Tool
From 2010.igem.org
(Difference between revisions)
| Line 19: | Line 19: | ||
det[4] = "Detecting this coagulation factor could be a way of determining if patients should be given warfarin or a low molecular weight heparin (LMWH) if they are displaying atrial fibrilation following a stroke. Factor X is the first member of the thrombin pathway which essentially leads to blood clotting."; | det[4] = "Detecting this coagulation factor could be a way of determining if patients should be given warfarin or a low molecular weight heparin (LMWH) if they are displaying atrial fibrilation following a stroke. Factor X is the first member of the thrombin pathway which essentially leads to blood clotting."; | ||
det[5] = "The complement system is part of the innate immune response to an acute infection. Detecting C3 convertase could give medical professionals a rapid method of seeing if a patient is fighting an acute infection."; | det[5] = "The complement system is part of the innate immune response to an acute infection. Detecting C3 convertase could give medical professionals a rapid method of seeing if a patient is fighting an acute infection."; | ||
| + | det[6] = "This protease is produced by the ''leishmania'' parasites which cause leishmaniasis, an NTD. Diagnosis currently takes at least 20 minutes and requires microscopy. Our kit would allow rapid detection with very simple apparatus. "; | ||
var prefix = "GAATTCGCGGCCGCTTCTAG"; | var prefix = "GAATTCGCGGCCGCTTCTAG"; | ||
var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGT"; | var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGT"; | ||
| Line 31: | Line 32: | ||
cleavage[4] = "ATCGACGGACGT"; | cleavage[4] = "ATCGACGGACGT"; | ||
cleavage[5] = "TTATTATCTCGTTCTGAAGAAGAC"; | cleavage[5] = "TTATTATCTCGTTCTGAAGAAGAC"; | ||
| + | cleavage[6] = "CTGATTGCGTATCTGAAAAAAGCGACC"; | ||
var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | ||
var terminator = "TAATAA"; | var terminator = "TAATAA"; | ||
| Line 77: | Line 79: | ||
<option value="4">Factor Xa</option> | <option value="4">Factor Xa</option> | ||
<option value="5">C3 Convertase</option> | <option value="5">C3 Convertase</option> | ||
| + | <option value="6">Leishmanolysin</option> | ||
</select> | </select> | ||
</html> | </html> | ||
Revision as of 14:46, 20 October 2010
| Software Tool |
| We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct. |
| Select Protease | Description | |
|
This was our primary target. Read our wiki to find out more! | ||
|
Awaiting sequence generation...
| ||
|
Yellow - Biobrick Prefix/Suffix Orange - Promoter Red - Ribosome Binding Site Violet - Scar Purple - Cell Wall Binding Domain Dark Blue - Adjustable Linker Light Blue - Protease Cleavage Site Dark Green - Autoinducing Peptide Light Green - Terminator | ||
