Team:Warsaw/Stage1/PromMeas
From 2010.igem.org
(Difference between revisions)
(Replacing page with '<html> <script type="text/javascript"> ActiveTab='Stage1'; </script> </html> {{TemplateTop}} {{UpperTabs}} {{LowerTabsTeam}} <html> <h2>Promoter measurement</h2> </htm...') |
|||
Line 11: | Line 11: | ||
<h2>Promoter measurement</h2> | <h2>Promoter measurement</h2> | ||
+ | <h3>Experimental setup</h3> | ||
+ | <div class="note">Measured parts</div> | ||
+ | <p>We have measured <a href="http://partsregistry.org/Part:BBa_J23100">J23100</a> and <a href="http://partsregistry.org/Part:BBa_I719005">I719005 encoding pT7</a>.</p><br> | ||
+ | |||
+ | <div class="note">Measurement constructs</div> | ||
+ | <p>We have used <a href="http://partsregistry.org/Part:BBa_B0034">B0034</a> as our reference RBS and <a href="http://partsregistry.org/Part:BBa_E0040">E0040</a> GFP as a reporter. | ||
+ | |||
+ | <div class="note">Methodology</div> | ||
+ | <p>All measurements were conducted in cell-free system which allowed us simple and precise determination of GFP encoding mRNA. The amount of mRNA was determined using quantitative reverse transcriptase realtime PCR (qRT-PCR). We have done absolute quantification using cDNA standard curve to convert delta-Ct units to RNA concentration.</p> | ||
+ | |||
+ | <p> We have used following protocol:</p> | ||
+ | <ol> | ||
+ | <li>All reagents and substrates were RNase free. Experiments were conducted in RNase-free environment.</li> | ||
+ | <li>0.5 ug of DNA encoding tested construct was added to 50 ul of cell-free expression master mix containing 350 units of human placental RNase inhibitor.</li> | ||
+ | <li>Samples were incubated at 37<sup>o</sup>C with shaking at 800 RPM</li> | ||
+ | <li>Every 15 minutes 5ul of reaction mixture was collected. Reaction was stopped by freezing at -20. Samples were kept frozen until reverse transcription.</li> | ||
+ | <li>Subsamples were collected till reaction have reached steady state (typically 120 minutes).</li> | ||
+ | <li>After obtaining all RNA samples DNAse treatment was performed as follows: 5 ul of sample was supplemented with 1ul of 10x DNAse buffer, 3 ul of RNase-free water and 1ul of RNase-free DNase I from Fermentas</li> | ||
+ | <li>Samples were incubated at 37<sup>o</sup>C for 30 minutes. After that time 1ul of EDTA was added to each sample.</li> | ||
+ | <li>DNase was inactivated by heating in 65<sup>o</sup>C for 10 minutes.</li> | ||
+ | <li>DNase treated RNA samples were divided in two. One half was used as a substrate for reverse transcription. The other halves were mixed together and used in -RT control reaction.</li> | ||
+ | <li>Reverse transcription was performed using Maxima First Strand cDNA synthesis kit form Fermentas using manufacturer's instructions. Gene specific primer GFPqPCRr (TCGAAAGGGCAGATTGTG) was used.</li> | ||
+ | <li>cDNA was diluted 50x and 1ul was used for qRT-PCR reaction. SYBR/ROX qPCR HotStart 2x Master Mix for Fermentas was used to perform the reaction with the following primers: GFPqPCRf (GATGACGGGAACTACAAGAC) and GFPqPCRr (TCGAAAGGGCAGATTGTG). ABI 7500 qPCR system was used. PCR program: 95 <sup>o</sup>C for 10 minutes followed with 40 cycles of 95 <sup>o</sup>C for 15s, 55 <sup>o</sup>C for 30 s, 72 <sup>o</sup>C for 40s. Reaction specificity was confirmed using melting curve analysis.</li> | ||
+ | </ol> | ||
+ | |||
+ | |||
+ | <h3>Results</h3> | ||
+ | <p></p> | ||
+ | |||
+ | |||
</html> | </html> | ||
{{TemplateBottom}} | {{TemplateBottom}} |
Revision as of 22:34, 16 October 2010
Promoter measurement
Experimental setup
Measured parts
We have measured J23100 and I719005 encoding pT7.
Measurement constructs
We have used B0034 as our reference RBS and E0040 GFP as a reporter.
Methodology
All measurements were conducted in cell-free system which allowed us simple and precise determination of GFP encoding mRNA. The amount of mRNA was determined using quantitative reverse transcriptase realtime PCR (qRT-PCR). We have done absolute quantification using cDNA standard curve to convert delta-Ct units to RNA concentration.
We have used following protocol:
- All reagents and substrates were RNase free. Experiments were conducted in RNase-free environment.
- 0.5 ug of DNA encoding tested construct was added to 50 ul of cell-free expression master mix containing 350 units of human placental RNase inhibitor.
- Samples were incubated at 37oC with shaking at 800 RPM
- Every 15 minutes 5ul of reaction mixture was collected. Reaction was stopped by freezing at -20. Samples were kept frozen until reverse transcription.
- Subsamples were collected till reaction have reached steady state (typically 120 minutes).
- After obtaining all RNA samples DNAse treatment was performed as follows: 5 ul of sample was supplemented with 1ul of 10x DNAse buffer, 3 ul of RNase-free water and 1ul of RNase-free DNase I from Fermentas
- Samples were incubated at 37oC for 30 minutes. After that time 1ul of EDTA was added to each sample.
- DNase was inactivated by heating in 65oC for 10 minutes.
- DNase treated RNA samples were divided in two. One half was used as a substrate for reverse transcription. The other halves were mixed together and used in -RT control reaction.
- Reverse transcription was performed using Maxima First Strand cDNA synthesis kit form Fermentas using manufacturer's instructions. Gene specific primer GFPqPCRr (TCGAAAGGGCAGATTGTG) was used.
- cDNA was diluted 50x and 1ul was used for qRT-PCR reaction. SYBR/ROX qPCR HotStart 2x Master Mix for Fermentas was used to perform the reaction with the following primers: GFPqPCRf (GATGACGGGAACTACAAGAC) and GFPqPCRr (TCGAAAGGGCAGATTGTG). ABI 7500 qPCR system was used. PCR program: 95 oC for 10 minutes followed with 40 cycles of 95 oC for 15s, 55 oC for 30 s, 72 oC for 40s. Reaction specificity was confirmed using melting curve analysis.
Results