Team:Washington/Tools Used/Next-Gen Cloning
From 2010.igem.org
Revision as of 06:41, 16 October 2010
Gibson Cloning
To create plasmids with more freeform inserts than possible with traditional BioBrick restriction/ligation cloning, we used a method described in [http://www.natureprotocols.com/2009/04/16/onestep_enzymatic_assembly_of.php Nature Protocols 2009] in which parts are extracted from standard biobricks with primers that have added homologies on their 5' ends that overlap the parts that they will be next to. These parts are then stitched together using "overlap extension" PCR to create large enough fragments (roughly 500bp) that they can be assembled in a one step reaction as described by Gibson. This procedure allows the construction of plasmids that have no seams between parts and allows for arbitrary numbers of parts to be combined quickly and efficiently.
Utility
The cloning process is often the most time-intensive task for iGEM teams. Methods to streamline the creation and tweaking of gene circuits can increase productivity and lead to more functional .
Gibson assembly is particularly useful for the following tasks
- Extracting Biobrick parts from multiple source plasmids and assembling them arbitrarily on one plasmid in one cloning step
- Modifying short sequences of promoters, ribosome binding sites, and gene coding sequences - from point mutations to replacing moderately large tracts (20-60 bp) of DNA
- Adding ssrA degradation tags to genes
- Creating fusion proteins
- Flipping transcription direction of operons
Part Extraction
The first step is to design primers to extract the parts out of standard biobricks. The primers should be designed as usual (i.e. design for whatever Tm is desired over the ends of the part to be extracted. We aimed for around 60C). Then an extra sequence is added to the 5' end of the primers that is homologous to whatever part will be next to it in the final construct. These "overlaps" must have a Tm above 50C for efficient plasmid assembly. In some cases, new parts (i.e. promoters, ribosomal binding sites, and ssrA degradation tags) can be introduced in these overlaps, provided they are short enough.
Overlap-Extension
After two adjacent parts have been extracted in the aforementioned manner, they are put into a normal PCR reaction with two primers that match the added homology on the outside of the desired construct. This results in linear DNA that is the result of the two parts stuck end-to-end with no seam of any sort and homologies to parts that will be adjacent in the final plasmid on its end. This process is repeated until the resultant pieces are roughly 500bp in length.
This method can also be used to add short sequences (i.e. promoters,RBSs, etc) in between parts if rather than design primers to be homologous to the part next-door, they're designed with the sequence to be inserted. This works as long as there is still an overlap between the adjacent parts with a Tm higher than 50C.
Gibson Assembly Reaction
The ~500bp pieces of the final plasmid are then all fused together in one reaction with T5 exonuclease, heat-stable Taq ligase, Phusion polymerase, and free nucleotides with buffer. The exonuclease chews back the 5' ends of the strands, leaving "sticky ends." Due to the introduced homologies, the complementary single-stranded DNA anneal to each other in the desired order. The polymerase repairs any extra nucleotides chewed back by the exonuclease, and - finally - the ligase repairs nicks in the DNA. This process results in a circular plasmid that can be transformed efficiently.
Issues and Solutions
This type of procedure relies heavily on introduced homologies on the ends of all the parts involved. Initially we used the standard bioBrick prefix and suffix as the homologous region with which to insert our construct into standard backbones, but this proved problematic because of the NotI site which lies between the E/X and S/P restriction sites in bioBrick backbones, as it is long, consists mostly of Gs and Cs, and is palindromic. This leads to possible mispriming, and an ambiguity in the final configuration of our plasmid (the insert could end up forward, backward, or circular. The backbone could also recircularize without taking up the insert at all) and in turn, a very low yield of our desired construct.
To remedy this, we designed a new prefix and suffix, based on the [http://dspace.mit.edu/handle/1721.1/46747 BglBrick standard] which allows for the elimination of the NotI sites. We developed the prefix gaattcctgctgcggagatct and the suffix ggatccaacagggttctcgag by aiming for roughly 50% GC content and a Tm around 68 as calculated by [http://www.finnzymes.com/tm_determination.html Finnzymes Tm calc]. We then modified Psb1A3 and Psb3K3 with these prefixes and suffixes, and had much greater success with our cloning.
We have found that with inserts of less than 500 bp, one often gets many colonies containing insertless plasmid that has been circularized by DNA ligase. In order to determine if this is an issue in a given gibson reaction, for shorter inserts, we often conducted two reactions at once, one including the vector and the insert, and one containing only the vector, with the difference in volume made up with water. The reaction mixes were transformed into E. coli, and each tranformant mixture was plated on LB agarose plates with selective media. The number of colonies on the control plate ( the plate with transformants of the reaction without any insert) corresponds roughly to the number of colonies on the the cloning plate ( the plate with transformants of the vector/insert reaction). If the ratio of colonies on the cloning plate to colonies on the control is 1:1, it would mean that the vast majority of the colonies on the cloning plate are due to insertless, circularized vector. We were able to obtain correct plasmids when the cloning colony:control colony ratio was as low as 2:1, but this required double restriction digest screening of a large number of colonies ( around 24) in order to obtain vector with insert.
References
Daniel Gibson, One-step enzymatic assembly of DNA molecules up to several hundred kilobases in size
[http://www.natureprotocols.com/2009/04/16/onestep_enzymatic_assembly_of.php Nature Protocols 2009]
Gibson, D.G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases
[http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Nature Methods 2009]