"
Team:Kyoto/Parts
From 2010.igem.org
(Difference between revisions)
(→BioBrick) |
|||
| Line 5: | Line 5: | ||
==BioBrick== | ==BioBrick== | ||
| + | ===Parts=== | ||
{| class="parts sortable" | {| class="parts sortable" | ||
!Name||Description||Well<sup>*1</sup>||Plasmid||Resistance||Insert Length||Vector Length | !Name||Description||Well<sup>*1</sup>||Plasmid||Resistance||Insert Length||Vector Length | ||
| Line 17: | Line 18: | ||
|- | |- | ||
|<partinfo>B0015</partinfo>||Double terminator (<partinfo>B0010</partinfo>-<partinfo>B0012</partinfo>)||1-23-L||<partinfo>pSB1AK3</partinfo>||Ampicillin, Kanamycin||129||3189 | |<partinfo>B0015</partinfo>||Double terminator (<partinfo>B0010</partinfo>-<partinfo>B0012</partinfo>)||1-23-L||<partinfo>pSB1AK3</partinfo>||Ampicillin, Kanamycin||129||3189 | ||
| - | |||
| - | |||
| - | |||
| - | |||
|- | |- | ||
|<partinfo>E0840</partinfo>||GFP generator||1-12-O||<partinfo>pSB1A2</partinfo>||Ampicillin||878||2079 | |<partinfo>E0840</partinfo>||GFP generator||1-12-O||<partinfo>pSB1A2</partinfo>||Ampicillin||878||2079 | ||
| Line 31: | Line 28: | ||
|- | |- | ||
|<partinfo>pSB3K3</partinfo>||RFP Coding Device||1-5-E||<partinfo>pSB3K3</partinfo>||Kanamycin||1069||2750 | |<partinfo>pSB3K3</partinfo>||RFP Coding Device||1-5-E||<partinfo>pSB3K3</partinfo>||Kanamycin||1069||2750 | ||
| + | |- | ||
| + | |<partinfo>pSB4K5</partinfo>||Low copy BioBrick standard vector||1-5-G||<partinfo>pSB4K5</partinfo>||Kanamycin||1069||3419 | ||
| + | |- | ||
| + | |<partinfo>pSB1C3</partinfo>||High copy BioBrick assembly plasmid||||<partinfo>pSB1C3</partinfo>||Chloramphenicol||||2072 | ||
| + | |- | ||
|} | |} | ||
| - | |||
* *1 "1-18-C" means well 18C in [http://partsregistry.org/Help:Spring_2010_DNA_distribution Spring 2010 DNA Distribution Kit] Plate 1. | * *1 "1-18-C" means well 18C in [http://partsregistry.org/Help:Spring_2010_DNA_distribution Spring 2010 DNA Distribution Kit] Plate 1. | ||
| + | |||
| + | ===Primers=== | ||
| + | {| class="parts sortable" | ||
| + | !Name||Description||Sequence | ||
| + | |- | ||
| + | |<partinfo>G00100</partinfo>||Forward primer for sequencing/amplifying BioBrick parts (VF2)||tgccacctgacgtctaagaa | ||
| + | |- | ||
| + | |<partinfo>G00101</partinfo>||Reverse primer for sequencing/amplifying BioBrick parts (VR)||attaccgcctttgagtgagc | ||
| + | |} | ||
| + | |||
---- | ---- | ||
Revision as of 16:53, 9 October 2010
LastModified: 2010-10-9
Contents |
Original
<groupparts>iGEM010 Kyoto</groupparts>
BioBrick
Parts
| Name | Description | Well*1 | Plasmid | Resistance | Insert Length | Vector Length |
|---|---|---|---|---|---|---|
| <partinfo>J23100</partinfo> | Constitutive promoter family member | 1-18-C | <partinfo>J61002</partinfo> | Ampicillin | 35 | 2948 |
| <partinfo>J23105</partinfo> | Constitutive promoter family member | 1-18-M | <partinfo>J61002</partinfo> | Ampicillin | 35 | 2948 |
| <partinfo>J23116</partinfo> | Constitutive promoter family member | 1-20-M | <partinfo>J61002</partinfo> | Ampicillin | 35 | 2948 |
| <partinfo>R0011</partinfo> | Promoter (lacI regulated, lambda pL hybrid) | 1-6-G | <partinfo>pSB1A2</partinfo> | Ampicillin | 55 | 2079 |
| <partinfo>B0015</partinfo> | Double terminator (<partinfo>B0010</partinfo>-<partinfo>B0012</partinfo>) | 1-23-L | <partinfo>pSB1AK3</partinfo> | Ampicillin, Kanamycin | 129 | 3189 |
| <partinfo>E0840</partinfo> | GFP generator | 1-12-O | <partinfo>pSB1A2</partinfo> | Ampicillin | 878 | 2079 |
| <partinfo>E0240</partinfo> | GFP generator | 1-12-M | <partinfo>pSB1A2</partinfo> | Ampicillin | 876 | 2079 |
| <partinfo>I20260</partinfo> | Measurement Kit Test of <partinfo>J23101</partinfo> | 2-17-F | <partinfo>pSB3K3</partinfo> | Kanamycin | 919 | 2750 |
| <partinfo>J06702</partinfo> | mCherry, bacterial with RBS and forward terminator | 2-8-E | <partinfo>pSB1A2</partinfo> | Ampicillin | 869 | 2079 |
| <partinfo>pSB3K3</partinfo> | RFP Coding Device | 1-5-E | <partinfo>pSB3K3</partinfo> | Kanamycin | 1069 | 2750 |
| <partinfo>pSB4K5</partinfo> | Low copy BioBrick standard vector | 1-5-G | <partinfo>pSB4K5</partinfo> | Kanamycin | 1069 | 3419 |
| <partinfo>pSB1C3</partinfo> | High copy BioBrick assembly plasmid | <partinfo>pSB1C3</partinfo> | Chloramphenicol | 2072 |
- *1 "1-18-C" means well 18C in [http://partsregistry.org/Help:Spring_2010_DNA_distribution Spring 2010 DNA Distribution Kit] Plate 1.
Primers
| Name | Description | Sequence |
|---|---|---|
| <partinfo>G00100</partinfo> | Forward primer for sequencing/amplifying BioBrick parts (VF2) | tgccacctgacgtctaagaa |
| <partinfo>G00101</partinfo> | Reverse primer for sequencing/amplifying BioBrick parts (VR) | attaccgcctttgagtgagc |
