Team:Kyoto/Parts

From 2010.igem.org

Contents

Parts

Original

List

Loading.....

Details

BBa_K358000: Lac promoter with GFP

The lac promoter will be repressed and not induce GFP in the presence of lacI. We measured the strength of fluorescence with low copy plasmid vector, pSB4K5.

BBa_K358001: Measurement Standard

Constitutive promoter BBa_J23101 with GFP on low plasmid pSB4K5.

BBa_K358004: lambda lysis cassette[SRRz/Rz1]

This part causes cell death. It contains Holin/Antiholin, Endolysin and Rz/Rz1 genes.

BBa_K358006: lambda lysis cassette with terminator

λ lysis cassette BBa_K358004 with double terminator BBa_B0015.

BBa_K358010: anti-killer gene with GFP

It codes SΔTMD1 as the anti-killer gene, which is derived from λ phage DNA and against the lambda lysis cassette BBa_K358005: the killer gene.

BBa_K358012: SΔTMD1

S gene, which is derived from lambda phage DNA, contains holin and antiholin. These proteins have three transmembrane domains. This SΔTMD1, however, lacks one of those domains and works as the anti-killergene against the lysis cassette, killer gene.

BBa_K358013: SΔTMD1 with terminator

SΔTMD1 with double terminator.

BBa_K358015: pLac+anti-killer gene

The anti-killer gene with GFP BBa_K358010 is expressed under the control of lac promoter.

BBa_K358016: pLac+anti-killer gene+pConst

pLac+anti-killergene+pConst.

BBa_K358017: low promoter+anti-killer gene

Low constitutive promoter [J23105] and anti-killer gene BBa_K358010.

BBa_K358018: Low promoter+anti-killergene+lacP

Constitutive promoter BBa_J23105 + anti-killergene BBa_358010 + lactose promoter BBa_R0011.

BBa_K358019: lysis cassette regulated by lacP

Lysis cassette[SRRz] is regulated by lactose promoter. Activating lactose promoter and expressing SRRz gene, it causes the cell lysis. So, lactose promoter must be repressed when transform this part.

To repress lactose promoter tightly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX, not TOP10. KRX has lacI in its genome and TOP10 hasn't (see genotype [1], [2]).

BBa_K358020: Lysisbox

This part consists two module. Constantly expressed killer gene BBa_K358004 by low promoter and regulatory expressed anti-killer gene with GFP by lac promoter.

BBa_K358021: Lysisbox -module2-

Anti-killergene is induced constitutively and killergene is regulated by lactose promoter.

BBa_K358022: lacP + SΔTMD1RRz

TMD1 is deleted from lysis cassette [SRRz].

BBa_K358023: Lysisbox ver.2

This part is the same to BBa_K358020[Lysisbox], except for its constitutive promoter[BBa_J23100]. So, this plasmid is able to induce the killer gene more than the plasmid contains BBa_K358020. This part also contains SΔTMD1, anti-killergene, regulated by lacP. When transform this part, you must induce the SΔTMD1 highly, do not repress lacP, so that the cell lysis will be prevented. This is a long part and a lactose operon was deleted sometimes unexpectedly in our experiments. We recomend you that it is better to set the cultural temperature at 30C and store this part as a plasmid, not a glycerole stock.

BBa_K358024: Lysisbox -module2- ver2

This part is the same to BBa_K358021[Lysisbox -module2-], except for its constitutive promoter[BBa_J23101]. So, this part also induces constitutively SΔTMD1 gene, the anti-killer gene, and lambda lysis cassette[SRRz], the killer gene, is regulated by lacP. Since the lysis cassette is toxic to E.coli, you must repress the lacP when you transform it. Because of this, Top 10 isn't suitable, we used KRX. This is a long part and a lactose operon was sometimes deleted unexpectedly in our experiments. So, we find that to set the cultural temperature at 30C and store this part as a plasmid, not a glycerol stock, is the prefareble.

^Top

BioBrick

Parts

NameDescriptionWell*1PlasmidResistanceInsert LengthVector Length
BBa_J23100Constitutive promoter family member1-18-CBBa_J61002Ampicillin352948
BBa_J23105Constitutive promoter family member1-18-MBBa_J61002Ampicillin352948
BBa_J23116Constitutive promoter family member1-20-MBBa_J61002Ampicillin352948
BBa_R0011Promoter (lacI regulated, lambda pL hybrid)1-6-GBBa_pSB1A2Ampicillin552079
BBa_B0015Double terminator (BBa_B0010-BBa_B0012)1-23-LBBa_pSB1AK3Ampicillin, Kanamycin1293189
BBa_E0840GFP generator1-12-OBBa_pSB1A2Ampicillin8782079
BBa_E0240GFP generator1-12-MBBa_pSB1A2Ampicillin8762079
BBa_I20260Measurement Kit Test of BBa_J231012-17-FBBa_pSB3K3Kanamycin9192750
BBa_J06702mCherry, bacterial with RBS and forward terminator2-8-EBBa_pSB1A2Ampicillin8692079
BBa_pSB3K3RFP Coding Device1-5-EBBa_pSB3K3Kanamycin10692750
BBa_pSB4K5Low copy BioBrick standard vector1-5-GBBa_pSB4K5Kanamycin10693419
BBa_pSB1C3High copy BioBrick assembly plasmidBBa_pSB1C3Chloramphenicol2072

Primers

NameDescriptionSequence
BBa_G00100Forward primer for sequencing/amplifying BioBrick parts (VF2)tgccacctgacgtctaagaa
BBa_G00101Reverse primer for sequencing/amplifying BioBrick parts (VR)attaccgcctttgagtgagc

^Top