Team:Washington/Tools Used/Next-Gen Cloning

From 2010.igem.org

(Difference between revisions)
Line 25: Line 25:
</html>
</html>
<!---------------------------------------PAGE CONTENT GOES BELOW THIS---------------------------------------->
<!---------------------------------------PAGE CONTENT GOES BELOW THIS---------------------------------------->
-
 
+
=Next Generation Cloning=
To create plasmids with more freeform inserts than possible with traditional BioBrick restriction cloning, we used a method described in  
To create plasmids with more freeform inserts than possible with traditional BioBrick restriction cloning, we used a method described in  
-
[http://www.natureprotocols.com/2009/04/16/onestep_enzymatic_assembly_of.php Nature Protocols 2009] in which parts are extracted from standard biobricks with primers designed with an extra sequence on their 5' ends that is homologous to the part that will be next to it in the final plasmid. The primers must have a TM of at least 50C, otherwise These parts are then stiched together using "overlap extension" PCR, in which two adjacent parts that have been extracted in the aforementioned manner are put into a normal PCR reaction with two primers that match the added homology on the outside of the desired construct. This results in linear DNA that is the two parts stuck end-to-end with no seam of any sort and homologies to parts that will be adjacent in the final plasmid on its end. This process is repeated until the resultant pieces are roughly 500bp in length.  
+
[http://www.natureprotocols.com/2009/04/16/onestep_enzymatic_assembly_of.php Nature Protocols 2009] in which parts are extracted from standard biobricks with primers that have added homologies on their 5' ends that overlap the parts that they will be next to. These parts are then stitched together using "overlap extension" PCR to create large enough fragments (roughly 500bp) that they can be assembled in a one step reaction as described by Gibson. This procedure allows the construction of plasmids that have no seams between parts and allows for arbitrary numbers of parts to be combined quickly and efficiently
 +
 
 +
==Extraction==
 +
The first step is to design primers to extract the parts out of standard biobricks. The primers should be designed as usual (i.e. design for whatever Tm is desired over the ends of the part to be extracted. We aimed for around 60C). Then an extra sequence is added to the 5' end of the primers that is homologous to whatever part will be next to it in the final construct. These "overlaps" must have a Tm of above 50C.
 +
 
 +
==Overlap-Extension==
 +
After two adjacent parts have been extracted in the aforementioned manner, they are put into a normal PCR reaction with two primers that match the added homology on the outside of the desired construct. This results in linear DNA that is the result of the two parts stuck end-to-end with no seam of any sort and homologies to parts that will be adjacent in the final plasmid on its end. This process is repeated until the resultant pieces are roughly 500bp in length.
 +
 
 +
This method can also be used to add short sequences (i.e. promoters,RBSs, etc) in between parts if rather than design primers to be homologous to the part next-door, they're designed with the sequence to be inserted. This works as long as there is still an overlap between the adjacent parts with a Tm higher than 50C.
-
This method can also be used to add short sequences (i.e. promoters,RBSs, etc) in between parts if rather than design primers to be homologous to the part next-door, they're designed with the sequence to be inserted. This works as long as there is still an overlap between the adjacent with a Tm higher than 50C.
+
==Gibson Reaction==
-
The ~500bp pieces of the final plasmid are then all put together in one reaction as described in Gibson's paper, this stitches them together and circularizes them. They can then be transformed.
+
The ~500bp pieces of the final plasmid are then all put together in one reaction with T5 exonuclease, ligase, polymerase, and free nucleotides. The exonuclease chews back the 5' ends of the strands, leaving "sticky ends," and due to the introduced homologies, the pieces stick together in the desired order, the pieces prime the polymerase to reinsert the extra strand that was eaten by the exonuclease, and the ligase repairs the scars. This process results in a circular plasmid that can be transformed.
 +
==Issues and Solutions==
This type of procedure relies heavily on introduced homologies on the ends of all the parts involved. Initially we used the standard bioBrick prefix and suffix as the homologous region with which to insert our construct into standard backbones, but this proved problematic because of the NotI site which lies between the E/X and S/P restriction sites in bioBrick backbones, as it is long, consists mostly of Gs and Cs, and is palindromic. This leads to possible mispriming, and an ambiguity in the final configuration of our plasmid (the insert could end up forward, backward, or circular. The backbone could also recircularize without taking up the insert at all) and in turn, a very low yield of our desired construct.  
This type of procedure relies heavily on introduced homologies on the ends of all the parts involved. Initially we used the standard bioBrick prefix and suffix as the homologous region with which to insert our construct into standard backbones, but this proved problematic because of the NotI site which lies between the E/X and S/P restriction sites in bioBrick backbones, as it is long, consists mostly of Gs and Cs, and is palindromic. This leads to possible mispriming, and an ambiguity in the final configuration of our plasmid (the insert could end up forward, backward, or circular. The backbone could also recircularize without taking up the insert at all) and in turn, a very low yield of our desired construct.  
To remedy this, we designed a new prefix and suffix, based on the [http://dspace.mit.edu/handle/1721.1/46747 BglBrick standard] which allows for the elimination of the NotI sites. We developed the prefix gaattcctgctgcggagatct and the suffix ggatccaacagggttctcgag by aiming for roughly 50% GC content and a Tm around 68 as calculated by [http://www.finnzymes.com/tm_determination.html Finnzymes Tm calc]. We then modified Psb1A3 and Psb3K3 with these prefixes and suffixes, and had much greater success.
To remedy this, we designed a new prefix and suffix, based on the [http://dspace.mit.edu/handle/1721.1/46747 BglBrick standard] which allows for the elimination of the NotI sites. We developed the prefix gaattcctgctgcggagatct and the suffix ggatccaacagggttctcgag by aiming for roughly 50% GC content and a Tm around 68 as calculated by [http://www.finnzymes.com/tm_determination.html Finnzymes Tm calc]. We then modified Psb1A3 and Psb3K3 with these prefixes and suffixes, and had much greater success.
-
References:
+
==References==
Daniel Gibson, One-step enzymatic assembly of DNA molecules up to several hundred kilobases in size
Daniel Gibson, One-step enzymatic assembly of DNA molecules up to several hundred kilobases in size

Revision as of 20:18, 5 October 2010

Next Generation Cloning

To create plasmids with more freeform inserts than possible with traditional BioBrick restriction cloning, we used a method described in [http://www.natureprotocols.com/2009/04/16/onestep_enzymatic_assembly_of.php Nature Protocols 2009] in which parts are extracted from standard biobricks with primers that have added homologies on their 5' ends that overlap the parts that they will be next to. These parts are then stitched together using "overlap extension" PCR to create large enough fragments (roughly 500bp) that they can be assembled in a one step reaction as described by Gibson. This procedure allows the construction of plasmids that have no seams between parts and allows for arbitrary numbers of parts to be combined quickly and efficiently

Extraction

The first step is to design primers to extract the parts out of standard biobricks. The primers should be designed as usual (i.e. design for whatever Tm is desired over the ends of the part to be extracted. We aimed for around 60C). Then an extra sequence is added to the 5' end of the primers that is homologous to whatever part will be next to it in the final construct. These "overlaps" must have a Tm of above 50C.

Overlap-Extension

After two adjacent parts have been extracted in the aforementioned manner, they are put into a normal PCR reaction with two primers that match the added homology on the outside of the desired construct. This results in linear DNA that is the result of the two parts stuck end-to-end with no seam of any sort and homologies to parts that will be adjacent in the final plasmid on its end. This process is repeated until the resultant pieces are roughly 500bp in length.

This method can also be used to add short sequences (i.e. promoters,RBSs, etc) in between parts if rather than design primers to be homologous to the part next-door, they're designed with the sequence to be inserted. This works as long as there is still an overlap between the adjacent parts with a Tm higher than 50C.

Gibson Reaction

The ~500bp pieces of the final plasmid are then all put together in one reaction with T5 exonuclease, ligase, polymerase, and free nucleotides. The exonuclease chews back the 5' ends of the strands, leaving "sticky ends," and due to the introduced homologies, the pieces stick together in the desired order, the pieces prime the polymerase to reinsert the extra strand that was eaten by the exonuclease, and the ligase repairs the scars. This process results in a circular plasmid that can be transformed.

Issues and Solutions

This type of procedure relies heavily on introduced homologies on the ends of all the parts involved. Initially we used the standard bioBrick prefix and suffix as the homologous region with which to insert our construct into standard backbones, but this proved problematic because of the NotI site which lies between the E/X and S/P restriction sites in bioBrick backbones, as it is long, consists mostly of Gs and Cs, and is palindromic. This leads to possible mispriming, and an ambiguity in the final configuration of our plasmid (the insert could end up forward, backward, or circular. The backbone could also recircularize without taking up the insert at all) and in turn, a very low yield of our desired construct.

To remedy this, we designed a new prefix and suffix, based on the [http://dspace.mit.edu/handle/1721.1/46747 BglBrick standard] which allows for the elimination of the NotI sites. We developed the prefix gaattcctgctgcggagatct and the suffix ggatccaacagggttctcgag by aiming for roughly 50% GC content and a Tm around 68 as calculated by [http://www.finnzymes.com/tm_determination.html Finnzymes Tm calc]. We then modified Psb1A3 and Psb3K3 with these prefixes and suffixes, and had much greater success.

References

Daniel Gibson, One-step enzymatic assembly of DNA molecules up to several hundred kilobases in size

[http://www.natureprotocols.com/2009/04/16/onestep_enzymatic_assembly_of.php Nature Protocols 2009]

Gibson, D.G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases

[http://www.nature.com/nmeth/journal/v6/n5/full/nmeth.1318.html Nature Methods 2009]


← Software Tools       New BioBrick Vectors →

Retrieved from "http://2010.igem.org/Team:Washington/Tools_Used/Next-Gen_Cloning"