August 1-8

  During the period of waiting(for the gene synthesis), we divided the iGEM works into three parts.

• Modeling

• For the modeling part, we found hundreds of other antibody sequences to compare. We then ran a program to find a structure of each antibody. After, we investigated the similarity (numbers and figures) by using structural alignment program. We are now searching for the mathmetical data that can help us to estimate our system's reaction rate and speed.
  

• BioBrick Design

• In the meantime, bio brick team finished the wiki design. they put contents on bio brick submittion page. We have 6 bio bricks so far, and all has been uproaded on our wiki page.
  

• Introduction video of the Presentation
  

• The presentation team made a short video. This clip will be rolled before our main presentation for hook. It contains our motivation and our efforts.
  

August 9

Do list

1. structural alignment

   We almost completed structural alignments. We will post them on the wiki once they are finished.

2. modeling

   We need theoretical data on affinity of our elements through the pathway for modeling. So, we need to dig in.

3. main page update

   We decided to put contents on the menu to relieve confusion.

4. finishing introduction video

   We are going to take a picture of us for the video

5. adding 'tools' page

   We are making new page, named 'tools'. We will record programs or tools that we used so far.

August 11

do list

1. modifying main menu
2. taking picture for introduction video
3. main page content

   We already finished the design we only need contents

4. affinity data search

   We only need to find FGFR1-STAT1 Kd data

5. putting contents on discoverY wiki page

August 18

We sent an e-mail that contains how we want our gene synthesis to be done. Today, we got the reply from Bioneer, our sponsor. We had a discussion on how this synthesis can be done, and some questions reagarding this project were raised. So, we gathered our ideas and made a conclusion. Answers and discussions

1. Cloning on S.pombe and cloning in pSB1C3 for submission are necessary.
2. pSB1C3 plasmid information: http://partsregistry.org/Part:pSB1C3:Design
3. Part that we will put our fusion FGFR in is S.pombe > http://old.genedb.org/genedb/Search?name=wsc1&organism=pombe&desc=yes&wildcard=yes&searchId=Search
4. They suggested that we use a linker to make a Fusion FGFR gene. And we agreed on this idea.
5. We decided to use middle expression vector instead of high expression vector for STAT1 cloning. Because high expression of foreign protein can make bad influence to the cell
6. There were misunderstanding on GAS promoter. It must be activated only by the GFP (We sent our pathway to them for better understanding).
7. Our primer design :

<Back of Fusion FGFR> - Forward:23bp, Tm 59. 5' - GTTCTGGAAGCCCTGGAAGAGAG - 3' - Reverse:23bp, Tm 60 3' - TACCGCCTGAGTTTGCGGCGACT - 5'
<Front of Fusion FGFR> - Forward : 21bp, Tm 58 5' - ATGGTCTTTTTAAATTCCTCT - 3' - Reverse : 23bp, Tm 59 3' - AGGAGTCGGTTTTGTTGTCGGGG – 5'
<STAT1> - Forward : 24bp, Tm 59 5' - ATGTCTCAGTGGTACGAACTTCAG - 3' - Reverse : 24bp, Tm 58 3' - AACTAAAGACACAGACTTCACATT - 5'

PS. we are going to meet tomorrow for gene extracting.

August 19

We went to KIB for gene extraction. Today, as a preparation, we made an LB broth. And we set our experiment table.

1. preparing LB broth powder
2. adding 500mL of DW on LB broth powder using mass cylinder
3. stirring with magnetic bar
4. do autoclave
5. cooling down LB culture medium
6. store it in cylinder (100mL * 2)
7. adding ampicillin(1000x) on one of cylinder : 100uL / 100mL
8. putting FGFR contain E.coli in ampicillin added cylinder. And adding STAT in other cylinder
9. store these two cylinder in 37℃ and 200 rpm condition

Tomorrow we will extract DNA from today's result. And we decided to make a individual experimental note and keep record of our individual works.

August 20

we went to KIB for cell lysis & DNA extraction.

1. putting 45mL of STAT1 solution in cornical tube. Also, putting 45mL of FGFR solution in other cornical tube.
2. adding 6mL of SolutionI, then vortexing
3. adding 6mL of SolutionII, then shaking and rolling
4. adding 6mL of SolutionIII, then shaking and rolling
5. putting each STAT1, FGFR solution in first column (10 min)
6. putting 4mL of equilibrium buffer(QBT) in second buffer
7. putting solution that passed by first column in second column
8. adding 20mL of washing buffer in second column
9. adding 5mL of elution buffer in second column
10. adding 5mL of isopropane in second column (5 min)
11. pushing the piston for DNA condensation
12. adding TE buffer for elution
13. checking DNA concentration using machine

After DNA extraction, we went to CMS builing for gel electrophoresis.

1. preparing 1.2% of agarose gel, 0.5x TAE buffer
2. mixing 1.5uL of STAT1, FGFR sample and 1uL of loading buffer
3. loading STAT1, FGFR, DNA marker (100V, (-)→(+))

We prefared STAT1, FGFR DNA sample, then we will give these sample to bioneer next week.