Team:Heidelberg/Project/miMeasure
From 2010.igem.org
(→Analysis of Randomized Binding Sites Against Synthetic miRNA) |
(→Analysis of Randomized Binding Sites Against Synthetic miRNA) |
||
Line 34: | Line 34: | ||
|-bgcolor=#009be1 | |-bgcolor=#009be1 | ||
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features''' | |+ align="top, left"|'''Table 1: Used Binding Sites and Their Features''' | ||
- | |sequence||binding site feature||Name | + | |sequence||binding site feature||Name |
|- | |- | ||
- | |ctcagtttactagtgccatttgttc||perfect binding site against miRsAg|| | + | |ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS |
|- | |- | ||
- | |ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| | + | |ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| |
|- | |- | ||
- | |ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides | + | |ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||M14 |
|- | |- | ||
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||M15 | |ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||M15 | ||
Line 46: | Line 46: | ||
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||M16 | |ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||M16 | ||
|- | |- | ||
- | |ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10|| | + | |ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||C10G |
|- | |- | ||
- | |ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10|| | + | |ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||C10A |
|- | |- | ||
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||M20 | |ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||M20 |
Revision as of 11:34, 27 October 2010
|
|
||||||||||||||||||||||||||||||||||||||||||