Team:Heidelberg/Project/miMeasure
From 2010.igem.org
(→Analysis of Randomized Binding Sites Against Synthetic miRNA) |
(→Analysis of Randomized Binding Sites Against Synthetic miRNA) |
||
Line 50: | Line 50: | ||
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||M18 | |ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||M18 | ||
|- | |- | ||
- | |ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide | + | |ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||M20 |
|- | |- | ||
- | |ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide | + | |ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||M22 |
|- | |- | ||
|-||miMeasure without any binding site||NC (negative control) | |-||miMeasure without any binding site||NC (negative control) |
Revision as of 11:32, 27 October 2010
|
|
||||||||||||||||||||||||||||||||||||||||||