Tuesday July 6, 2010

Happy Birthday Paul!!

Himika:

• Today I reran the transformation that I did yesterday July 5th where I constructed E0040 and pSB1AC3 and plate it on chloramphenicol.
• I also miniprepped the overnight cultures from last night. I13504 and I13507. The only cultures that grew were I13504 and I miniprepped 6 colonies from 1 plate.

• I also constructed E1010 with B0015.

• Procedure:
  • Insert
  • E1010 (pSB2k3) cut with EcoI/SpeI 5uL DNA
  • Buffer I was used 3.5uL
  • 0.5 uL of EcoRI and 0.5 uL of SpeI
  • 25.5 uL of water

• • Vector
  • B0015 (pSB1AK3) cut with EcoI/XbaI 5uL DNA
  • Buffer I was used 3.5uL
  • 0.5 uL of EcoRI and 0.5 uL of XbaI
  • 25.5 uL of water

• The vector was phosphatased with 5uL water, 4uL Buffer and 1uL phosphatase. The solution was left in 37 degree Celcius for 30 minutes and heat killed for 10 minutes in 65 degree Celcius.

• 5ul of the vector and the insert in a tube and add 10 ul of quick ligase buffer and 1 ul of quick ligase. The solution was left in room temperature for 10 minutes and transformed.

• I also did research on the ibpA/ ibpB pathways in order to present on to Dr. Schryvers on Friday.
• I also overnight cultured I13507 and plated the contstruct.

Raida: Today I worked on the Construction of R0040 (TetR promoter) in front of GFP construct (I13504) to test the reporter. This construction is working as our positive control of verifying that our GFP reporter works.

'Restriction Enzyme Digest of Insert (R0040)"

• 17.2 uL DNA
• 3.5 uL React 1 Buffer
• 0.5 uL EcoI, 0.5 uL SpeI
• 13.5 uL of Water

Restriction Enzyme Digest of Vector (I13504) Trial F

• 4.4 uL DNA
• 3.5 uL React 2 Buffer
• 0.5 uL EcoI, 0.5 uL XbaI
• 26.1 uL of Water

Restriction Enzyme Digest of Vector (I13504) Trial C

• 4.0 uL DNA
• 3.5 uL React 2 Buffer
• 0.5 uL EcoI, 0.5 uL XbaI
• 26.5 uL of Water

Restriction Enzyme Digest of Vector (I13504) Trial D

• 1.6 uL DNA
• 3.5 uL React 2 Buffer
• 0.5 uL EcoI, 0.5 uL XbaI
• 28.9 uL of Water

At the end of the heat killing process, I added

• 5 uL Antartic Phosphotase Buffer
• 5 uL of Water and
• 1 uL Antartic Phosphotase

It was placed in the water bath at 37°C for half an hour and then I ligated the insert and the vector using

• 5 uL of Insert and 5 uL of Vector
• 1 uL Quick Ligase
• 10 uL 2x Quick Ligase Buffer

The construct is left in the fridge overnight and transformation will be done tomorrow.

• Today I also worked on the Ethics component of our Project. In particular I looked at the "feasibility" of ynthetic Biology to be manipulated for Bioterrorism Purpose.

Jeremy: Today I ordered the primers for biobricking periplasmic RFP, plasmid switched last years I0500 into pSB1AK3 and overnights of construct I0500+B0034.

• Primers:
  • Forward Primer-GAATTCGCGGCCGCTTCTAGATGCAAAACGCC
  • Reverse Primer- GCTACTAGTATCACGACGTTGTAAAACGAC

• Plasmid Switch:
• Restriction Enzyme Digest of Insert C1 (I0500)
  • 7.5 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 23.0 uL of Water

• Restriction Enzyme Digest of Insert C2 (I0500)
  • 11.3 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 19.2 uL of Water

• Restriction Enzyme Digest of Insert C1 D (I0500)
  • 13.6 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 16.9 uL of Water

• Restriction Enzyme Digest of Insert C2 D (I0500)
  • 2.9 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 27.6 uL of Water

• Restriction Enzyme Digest of Vector (pSB1AK3)
  • 2.1 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 28.4 uL of Water

• Overnight
  • Same for each colony
    • -5mL LB Broth
    • -5uL Kanamycin Antibiotic
    • -inoculate with pipette tip

Non-wetlab tasks worked on today include researching wiki templates and designing t-shirt logo

Chris: Today, I drafted the potential budget for this year's project. The total expenses this year are projected to amount to $64 500 with that money being used towards paying students, travelling and lodging at MIT, paying for laboratory materials, and buying T-shirts as well as a mascot suit. Our current financial status is sufficient to cover approximately 80% of this with $54 600 in total funds. These have been provided by BioAlberta, Alberta Innovates Technology Funds, O'Brien Student Centre, and Alberta Heritage Foundation for Medical Research.

As well, in the morning, Dev and I used the Sigma Aldrich GenElute Plasmid Preparation kit and modified instructions to isolate the plasmids of the constructions of I0500 - B0034 and E0040-B0015 as well as the parts of I0500, I13507, and E1010. The procedure used was as follows:

1. Pellet the cells from the overnight cultures using a centrifuge for 20 minutes at a speed of 4000 rpm at 4°C. 2. Discard the supernatant, while being careful not to remove any of the pellet 3. Resuspend the pellet in 200 μL of Resuspension Solution (with RNase A added) 4. Transfer the solution from a Falcon tube to a properly labelled 1.5 μL microcentrifuge tube. 5. Add 200 μL of the Lysis solution and invert gently to mix. Allow the mixture to clear for 4.5 minutes. 6. Add 350 μL of Neutralization Solution and invert the tube 4-6 times to mix. 7. Pellet the microcentrifuge tubes at 14 000 rpm using a microcentrifuge for 15 minutes. The solution will be known as the lysate. 8. Add 500 μL of the Column Preparation Solution to a binding column inside a collection tube. Centrifuge this tube for 1 minute at 14 000 rpm and discard the resulting liquid under the binding tube. 9. Transfer the lysate from the microcentrifuge tube into the binding column while being careful not to transfer any solid. The microcentrifuge tube may now be discarded. 10. Centrifuge the collection tubes at 14 000 rpm for 1 minute and discard the liquid that flowed through the binding column. 11. Add 750 μL of Wash Solution with concentrated ethanol added to the column and centrifuge at 14 000 rpm for 1 minute. Discard the liquid that flowed through into the collection tube. 12. Repeat this procedure a second time with Wash Solution. 13. Spin the tube for 1 minute at 14 000 rpm to dry the column. 14. Transfer the column into a properly labelled 1.5 μL microcentrifuge tube. 15. Add 50 μL of double-distilled water to the column and spin for 1 minute at 14 000 rpm. 16. Use a spectrophotometer to measure the concentration and purity of the plasmids.

In the afternoon, I contacted a General Manager from New England Biolabs about possible sponsorship and received a positive response. They will send some enzymes to us in the coming week.