Overview

We simulated the termination and antitermination properties of our signal-terminator constructs with the Kinefold web server and used some standard estimations for diffusive terms. Our main goal was to prove that our constructs work and that termination is stopped efficiently, that is, that the signal molecule binds and antiterminations occurs before the RNA polymerase falls off.
The Kinefold webserver provides a web interface for stochastic folding simulations of nucleic acids and offers the choice of renaturation or co-transcriptional folding. The folding paths are simulated at the level of helix formation and dissociation as these stochastic formation and the removal of individual helices are known to be the limiting steps of RNA folding kinetics.
For our purposes, co-transcriptional folding was the appropriate choice: Folding proceeds while the sequence is being synthesized from its 5' to 3' ends at a speed of 3 ms per newly added base (for RNA polymerase T7 phage). Thus, the transcript starts to fold before the whole sequence is fully available.
Kinefold offers the possibility to include additional bases (X) which do not pair to model hybridization dynamics between two sequences. In order to simulate how the binding of the signal molecule prevents termination we linked the signal via a linker sequence consisting of 'X' bases to the sequence of the terminator.
For each signal-terminator pair we did batch simulations with various random seeds in order to guarantee accuracy.
We also varied signal length form two base pairs to full signal length which provides insight in how long the signal needs to be in order to bind to the terminator and how long this process takes at least.

Diffusion

The question whether antitermination occurs is not only guided by the folding process of the signal-terminator pair, but also by how long the signal takes to diffuse to the terminator sequence.

Read more

To account for the diffusion time, we estimated the hit rate τ (following 6.), which is the time until the signal meets the terminator sequence for the first time:

where D is the diffusion constant, a the radius of gyration of the signal molecule and r the radius of the cell.
For E. coli r is 1 μm. The radius of gyration a can be estimated using the worm-like-chain model by

where n is the length of the signal which is 0,3 nm/monomer, l is the persistency length which is following (5.) 2nm for single-stranded RNA. Thus, for a signal of length 32 nt, a = 6,4 nm.

The diffusion constant D was obtained by

where k_B is the Boltzmann constant and T is the absolute temperature.
Using the a we calculated above, we get D = 3,4318 m²/s.

Thus, for a cell containing 100 signal molecules, the signal needs 0,1518 s until it first hits the terminator sequence.

Close

As the folding time is significantly larger than the diffusion and thus much less relevant for modeling our signal-terminator constructs, we didn't employ more elaborate techniques to model diffusion.

Switch

His-terminator

Terminator sequence:
5' UCGGCUUCAACGUGCUCCACGAAAGCCCCCGGAAGAUGCAUCUUCCGGGGGCUUUUUUUUU 3'
Signal sequence:
5' CCGGGGGCUUUCGUGGAGCACGUUGAAGCCGA 3'

Both terminator and signal sequence comprise two parts:

• His-terminator and a part which partially binds to the His-terminator respectively (marked green),
• random signaling part and antisense to the random signaling part respectively (marked red).

We modeled the signal-terminator interaction for 2, 4-32 nt signal length and proved that the signal sequence binds to the terminator sequence and impedes the terminator folding, thus the polymerase doesn't fall off and the output signal is produced.

The minimal free-energy structure of the folded terminator including the random signaling part is shown in the figure "His-terminator" below:

His-terminator

Our full signal sequence of length 32 nt completly binds to the terminator and antitermination is successful:

His-terminator plus signal

On the other hand the picture for a signal length of only 2 nt shows that such a small signal length is not sufficient for antitermination. But already a signal of length 16 nt binds to the terminator so that it cannot fold completely anymore.

signal length 2 nt

signal length 16 nt

As we observed a dependence of the folding time and minimal energy respectively from the linker length we used linkers of length 12, 16, 20, 24, 30, 34, 40, 50, 60, 120 'X' bases. For the minimal energy there is only a very small linker length dependence as one can see in the figure below. The figure also shows that the minimal free-energy structure for the signal sequence bound to the terminator sequence is much more stable, around 35 kcal/mol, than the minimal free-energy structure for the terminator sequence alone.

Linker length dependence: minimal energy

However, for the folding time linker length dependence is significant as one can see in the figure below.

Linker length dependence: folding time

But, as, for us, the fact whether the terminator is folding or not is crucial and the videos below show that for appropriate signal length the terminator is not folding. Concerning this fact, for all linker lengths we tested there was only a dependence on the signal length but the results were independent from the linker length. Hence, the linker length dependence can be neglected.

RNA folding path videos

For this video the signal is only 2 nt long. One can see that the terminator is folding and that the signal cannot bind to the terminator sequence due to its short length.

Media:TU_Munich_iGEM2010_sstraub_2.mov

The video for 16 nt signal length shows that the terminator is already hindered from folding completely.

Media:TU_Munich_iGEM2010_sstraub_16.mov

This video is done for full signal length of 32 nt. One can see that the terminator does not fold at all as the signal immediately binds to the terminator sequence as it is synthesized.

Media:TU_Munich_iGEM2010_sstraub_32.mov

Optimization of the signal sequence

We also tried to optimize our signal sequence to find the minimal sequence length which still enables antitermination. For this optimization kept the random signaling part constant and varied the part which partially binds to the His-terminator and vice versa to see which length is sufficient for antitermination for each case. Then we combined the results to find a optimal signal.

When varying the part which partially binds to the His-terminator we found that having only the 2 nt of this part together with the random signaling part suffices for antitermination as the picture and the corresponding video below show.

Signal consists of the random signaling part (20 nt) and only 2 nt of the part which partially binds to the His-terminator.

For the full 12 nt of the part which partially binds to the His-terminator, the random signaling part has to have at least 2 nt in order to prevent termination as one can see in the picture below.

Signal consists of the part which partially binds to the His-terminator (12 nt) and only 2 nt of the random signaling part.

We then combined these two results and found that a signal with overall 8 nt, 4 nt for the random signaling part and 4 nt for the part which partially bind to the His-terminator, 5' UUUCGUGG 3', suffice to enable antitermination as the picture and the corresponding video below display.

Signal consists of 4 nt for the part which partially binds to the His-terminator and 4 nt of the random signaling part.

Trp-terminator

Terminator sequence:
5' ACGCGACAUAUCAGCUUAGAAUACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUU 3'
Signal sequence:
5' GGCGGGCUGGGUAUUCUAAGCUGAUAUGUCGCGU 3'

Both terminator and signal sequence comprise three parts:

• Trp-terminator and a part which partially binds to the Trp-terminator respectively (marked green),
• a natural sequence part upstream of the Trp-terminator binding to the terminator in anti-termination state and a part which binds to the upstream sequence of the terminator respectively (marked yellow),
• random signaling part and antisense to the random signaling part respectively (marked red).

We did similar simulations as we did for the His-terminator for the Trp-terminator and it turned out to be less stable than the His-terminator. The folded terminator is not the minimal free-energy structure for the given the RNA sequence, it's only the third minimal one at kcal/mol compared with the His-terminator which has a minimal free-energy structure at kcal/mol. The folded terminator including the random signaling part is shown in the figure "Trp-terminator" below:

Trp-terminator

Our full signal sequence of length 34 nt completly binds to the terminator and antitermination is successful:

Trp-terminator plus signal

Optimization of the signal sequence

As for the His-terminator, we tried to optimize our signal sequence to find the minimal sequence length which still enables antitermination.

We finnaly found that a signal with overall 10 nt, 2 nt for the random signaling part, all 4 nt for the part which binds to the upstream sequence of the terminator and 2 nt for the part which partially bind to the His-terminator, 5' CUGGGUAUUC 3', suffice to enable anti-termination as the picture and the corresponding video below display.

Minimal signal length that still enables anti-termination

T7-terminator

Terminator sequence:
5' CUCUGCCGCACGUAU AGCAUAACCCCUUGGGGCCUCUAAACGGGUCUUGAGGGGUUUUUUG 3'
Signal sequence:
5' AAGGGGUUAUGCUAUACGUGCGGCAGAG 3'

Both terminator and signal sequence comprise two parts:

• T7-terminator and a part which partially binds to the T7-terminator respectively (marked green),
• random signaling part and antisense to the random signaling part respectively (marked red).

Results

Network

Modeling

Results

Outlook