Team:Harvard/flavor/notebook

From 2010.igem.org

(Difference between revisions)
(06-16-2010 [ top ])
Line 81: Line 81:
==<html><a class="labnotebook" name="06-16-2010">06-16-2010</a></html> [ [[#top|top]] ]==
==<html><a class="labnotebook" name="06-16-2010">06-16-2010</a></html> [ [[#top|top]] ]==
 +
===MiniPrep===
 +
* MiniPrep of Wintergreen parts from Registry (J45004 and J45700) following Qiagen MiniPrep protocol.  MiniPrep three samples of each part.
 +
** DNA concentrations:
 +
          J45004-1: 59.1 ng/μL
 +
          J45004-2: 72.9 ng/μL
 +
          J45004-3: 88.1 ng/μL
 +
 
 +
          J45700-1: 146.7 ng/μL
 +
          J45700-2: 187.4 ng/μL
 +
          J45700-3: 175.5 ng/μL
 +
===Digestion with Enzymes===
 +
*  For J45004, we added: 9μL DNA, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast). 
 +
*  For J45700, we added 5μL DNA, 4μL H2O, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast). 
 +
*  We let mixtures sit for 30 minutes due to the use of xbaI restriction enzyme (slow).  After the 30 minutes, we added 2.5μL dye to each mix. 
 +
 +
===Gel===
 +
*  We loaded 12.5μL of 1kb ladder to well 1 of the gel (numbered left to right).  We then loaded 12.5μL of J45004-1, J45004-2, and J45004-3 to wells 2,3, and 4, respectively.  We loaded J45700-1, J45700-2, J4500-3 in wells 5, 6, and 7, respectively (see images below for well locations).
 +
*  Ran on 1% agarose gel.
 +
 +
[[Image:J45004_J45700gel1.jpg|150px|BBa_J45700]]
 +
[[Image:J45004_J45700gel2.jpg|150px|BBa_J45700]]
==<html><a class="labnotebook" name="06-17-2010">06-17-2010</a></html> [ [[#top|top]] ]==
==<html><a class="labnotebook" name="06-17-2010">06-17-2010</a></html> [ [[#top|top]] ]==

Revision as of 00:27, 25 October 2010



notebook calendar [ top ]

Week 1 06-14-2010 06-15-2010 06-16-2010 06-17-2010 06-18-2010
Week 2 06-21-2010 06-22-2010 06-23-2010 06-24-2010 06-25-2010
Week 3 06-28-2010 06-29-2010 06-30-2010 07-01-2010 07-02-2010
Week 4 07-05-2010 07-06-2010 07-07-2010 07-08-2010 07-09-2010
Week 5 07-12-2010 07-13-2010 07-14-2010 07-15-2010 07-16-2010
Week 6 07-19-2010 07-20-2010 07-21-2010 07-22-2010 07-23-2010
Week 7 07-26-2010 07-27-2010 07-28-2010 07-29-2010 07-30-2010
Week 8 08-02-2010 08-03-2010 08-04-2010 08-05-2010 08-06-2010
Week 9 08-09-2010 08-10-2010 08-11-2010 08-12-2010 08-13-2010

06-14-2010 [ top ]

  • Miraculin and brazzein constructs due to arrive on Wednesday from Mr. Gene

BioBrick Transformation

BioBrick parts from the 2010 iGEM kit were transformed and grown in highly competent TURBO bacteria.

  • Wintergreen Scent Pathway:

BBa_J45700 - entire pathway, Ampicillin
BBa_J45004 - BSMT1 only, Ampicillin
(Not in 2010 BB Kit: BBa_J45017 - PchB, PchA)

  • Banana Scent Pathway:

BBa_J45250 - ATF3 + Promoter, Ampicillin?
BBa_J45014 - ATF3 only, Ampicillin
(Not in BB 2010 Kit: BBa_J45400 - BAT2 and THI3)

06-15-2010 [ top ]

Primer Designs for Agrobacterium Vector

  • Primers were designed to amplify from the Expression Series pORE Agrobacterium plasmid (e3) 1)the pENTcup2 promoter, 2) the tNOS stop sequence, 3) the tNOS stop sequence + additional stop codon and 4) the pHLP promoter.

Note: the NOSterm_BB_R primer works for both tNOS and tNOS+STOP codon sequences.

   pENTcup2_BB_F
   CCTTTCTAGAGGGATCTTCTGCAAGCATCT
   pENTcup2_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTTCCGGTGGGTTTTGAGGT
   STOP_NOSterm_BB_F
   CCTTTCTAGATGAGATCGTTCAAACATTTGG
   NOSterm_BB_F
   CCTTTCTAGAGATCGTTCAAACATTTGGCA
   NOSterm_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTGATCTAGTAACATAGATGACA
   pHPL_BB_F
   CCTTTCTAGAAACGTGGATACTTGGCAGTG
   pHPL_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTCTTTTGAGCTTAGAGGTTTTT

BioBrick Transformation

  • Colonies were observed after overnight culture growth, but in low quantities.
    • J45700 and J45004 (both Wintergreen Pathway) showed minimal number of colonies on both 10μL and 100μL cultures.
    • J45250 and J45014 (both Banana Pathway) showed no colonies on either the 10μL or 100μL cultures.

Codon Usage in Arabidopsis

Using http://gcua.schoedl.de/


Valencene Extraction

Used RNeasy Plant Mini Kit to extract RNA from the flavedo of an Organic Valencia Orange.

Flavedo

06-16-2010 [ top ]

MiniPrep

  • MiniPrep of Wintergreen parts from Registry (J45004 and J45700) following Qiagen MiniPrep protocol. MiniPrep three samples of each part.
    • DNA concentrations:
         J45004-1: 59.1 ng/μL
         J45004-2: 72.9 ng/μL
         J45004-3: 88.1 ng/μL
 
         J45700-1: 146.7 ng/μL
         J45700-2: 187.4 ng/μL
         J45700-3: 175.5 ng/μL

Digestion with Enzymes

  • For J45004, we added: 9μL DNA, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast).
  • For J45700, we added 5μL DNA, 4μL H2O, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast).
  • We let mixtures sit for 30 minutes due to the use of xbaI restriction enzyme (slow). After the 30 minutes, we added 2.5μL dye to each mix.

Gel

  • We loaded 12.5μL of 1kb ladder to well 1 of the gel (numbered left to right). We then loaded 12.5μL of J45004-1, J45004-2, and J45004-3 to wells 2,3, and 4, respectively. We loaded J45700-1, J45700-2, J4500-3 in wells 5, 6, and 7, respectively (see images below for well locations).
  • Ran on 1% agarose gel.

BBa_J45700 BBa_J45700

06-17-2010 [ top ]

06-18-2010 [ top ]

06-21-2010 [ top ]

06-22-2010 [ top ]

06-23-2010 [ top ]

06-24-2010 [ top ]

06-25-2010 [ top ]

06-28-2010 [ top ]

06-29-2010 [ top ]

06-30-2010 [ top ]

07-01-2010 [ top ]

07-02-2010 [ top ]

07-05-2010 [ top ]

07-06-2010 [ top ]

07-07-2010 [ top ]

07-08-2010 [ top ]

07-09-2010 [ top ]

07-12-2010 [ top ]

07-13-2010 [ top ]

07-14-2010 [ top ]

07-15-2010 [ top ]

07-16-2010 [ top ]

07-19-2010 [ top ]

07-20-2010 [ top ]

07-21-2010 [ top ]

07-22-2010 [ top ]

07-23-2010 [ top ]

07-26-2010 [ top ]

07-27-2010 [ top ]

07-28-2010 [ top ]

07-29-2010 [ top ]

07-30-2010 [ top ]

08-02-2010 [ top ]

08-03-2010 [ top ]

08-04-2010 [ top ]

08-05-2010 [ top ]

08-06-2010 [ top ]

08-09-2010 [ top ]

08-10-2010 [ top ]

08-11-2010 [ top ]

08-12-2010 [ top ]

08-13-2010 [ top ]