Team:Harvard/flavor/notebook

From 2010.igem.org

(Difference between revisions)
(06-15-2010 [ top ])
Line 73: Line 73:
===Codon Usage in Arabidopsis===
===Codon Usage in Arabidopsis===
Using http://gcua.schoedl.de/ <br><br>
Using http://gcua.schoedl.de/ <br><br>
-
'''Wintergreen Pathway:''' <br>
 
-
BioBrick Part #: BBa_J45700 <br>
 
-
Original Organism: ''Pseudomonas aeruginosa'' <br>
 
-
[[Image:Wintergreen Pathway (full) Compare_Page_1.jpg|150px|BBa_J45700]]
 
-
[[Image:Wintergreen Pathway (full) Compare_Page_2.jpg|150px|BBa_J45700]]
 
-
[[Image:Wintergreen Pathway (full) Compare_Page_3.jpg|150px|BBa_J45700]]
 
-
[[Image:Wintergreen Pathway (full) Compare_Page_4.jpg|150px|BBa_J45700]]
 
-
 
-
'''Banana Pathway:''' <br>
 
-
BioBrick Part #: BBa_J45014 <br>
 
-
Original Organism: ''Saccharomyces cerevisiae'' <br>
 
-
[[Image:codon_table_BBa_J45014.jpg|150px|BBa_J45014]]
 
-
[[Image:codon_table_BBa_J45014_pg_2.jpg|150px|BBa_J45014]]
 
-
[[Image:Codon_table_BBa_J45014_pg_3.jpg|150px|BBa_J45014]]
 
-
 
-
BioBrick Part #: BBa_J45250 <br>
 
-
[[Image:codon_table_BBa_J45250_pg1.jpg|150px|BBa_J45250]]
 
-
[[Image:codon_table_BBa_J45250_pg2.jpg|150px|BBa_J45250]]
 
-
[[Image:codon_table_BBa_J45250_pg3.jpg|150px|BBa_J45250]]
 
-
[[Image:codon_table_BBa_J45250_pg4.jpg|150px|BBa_J45250]]
 
-
 
-
'''Valencene Pathway:'''
 
-
 
-
[[Image:Citrus_sinesis_valencene_synthase_Page_1.jpg|150px|Valencene]]
 
-
[[Image:Citrus_sinesis_valencene_synthase_Page_2.jpg|150px|Valencene]]
 
-
[[Image:Citrus_sinesis_valencene_synthase_Page_3.jpg|150px|Valencene]]
 
===Valencene Extraction===
===Valencene Extraction===
Used RNeasy Plant Mini Kit to extract RNA from the <u>flavedo</u> of an Organic Valencia Orange.
Used RNeasy Plant Mini Kit to extract RNA from the <u>flavedo</u> of an Organic Valencia Orange.
-
[[Image:Flavedo.png|500px|Flavedo]]
+
[[Image:Flavedo.png|200px|Flavedo]]
==<html><a class="labnotebook" name="06-16-2010">06-16-2010</a></html> [ [[#top|top]] ]==
==<html><a class="labnotebook" name="06-16-2010">06-16-2010</a></html> [ [[#top|top]] ]==

Revision as of 00:23, 25 October 2010



notebook calendar [ top ]

Week 1 06-14-2010 06-15-2010 06-16-2010 06-17-2010 06-18-2010
Week 2 06-21-2010 06-22-2010 06-23-2010 06-24-2010 06-25-2010
Week 3 06-28-2010 06-29-2010 06-30-2010 07-01-2010 07-02-2010
Week 4 07-05-2010 07-06-2010 07-07-2010 07-08-2010 07-09-2010
Week 5 07-12-2010 07-13-2010 07-14-2010 07-15-2010 07-16-2010
Week 6 07-19-2010 07-20-2010 07-21-2010 07-22-2010 07-23-2010
Week 7 07-26-2010 07-27-2010 07-28-2010 07-29-2010 07-30-2010
Week 8 08-02-2010 08-03-2010 08-04-2010 08-05-2010 08-06-2010
Week 9 08-09-2010 08-10-2010 08-11-2010 08-12-2010 08-13-2010

06-14-2010 [ top ]

  • Miraculin and brazzein constructs due to arrive on Wednesday from Mr. Gene

BioBrick Transformation

BioBrick parts from the 2010 iGEM kit were transformed and grown in highly competent TURBO bacteria.

  • Wintergreen Scent Pathway:

BBa_J45700 - entire pathway, Ampicillin
BBa_J45004 - BSMT1 only, Ampicillin
(Not in 2010 BB Kit: BBa_J45017 - PchB, PchA)

  • Banana Scent Pathway:

BBa_J45250 - ATF3 + Promoter, Ampicillin?
BBa_J45014 - ATF3 only, Ampicillin
(Not in BB 2010 Kit: BBa_J45400 - BAT2 and THI3)

06-15-2010 [ top ]

Primer Designs for Agrobacterium Vector

  • Primers were designed to amplify from the Expression Series pORE Agrobacterium plasmid (e3) 1)the pENTcup2 promoter, 2) the tNOS stop sequence, 3) the tNOS stop sequence + additional stop codon and 4) the pHLP promoter.

Note: the NOSterm_BB_R primer works for both tNOS and tNOS+STOP codon sequences.

   pENTcup2_BB_F
   CCTTTCTAGAGGGATCTTCTGCAAGCATCT
   pENTcup2_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTTCCGGTGGGTTTTGAGGT
   STOP_NOSterm_BB_F
   CCTTTCTAGATGAGATCGTTCAAACATTTGG
   NOSterm_BB_F
   CCTTTCTAGAGATCGTTCAAACATTTGGCA
   NOSterm_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTGATCTAGTAACATAGATGACA
   pHPL_BB_F
   CCTTTCTAGAAACGTGGATACTTGGCAGTG
   pHPL_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTCTTTTGAGCTTAGAGGTTTTT

BioBrick Transformation

  • Colonies were observed after overnight culture growth, but in low quantities.
    • J45700 and J45004 (both Wintergreen Pathway) showed minimal number of colonies on both 10μL and 100μL cultures.
    • J45250 and J45014 (both Banana Pathway) showed no colonies on either the 10μL or 100μL cultures.

Codon Usage in Arabidopsis

Using http://gcua.schoedl.de/


Valencene Extraction

Used RNeasy Plant Mini Kit to extract RNA from the flavedo of an Organic Valencia Orange.

Flavedo

06-16-2010 [ top ]

06-17-2010 [ top ]

06-18-2010 [ top ]

06-21-2010 [ top ]

06-22-2010 [ top ]

06-23-2010 [ top ]

06-24-2010 [ top ]

06-25-2010 [ top ]

06-28-2010 [ top ]

06-29-2010 [ top ]

06-30-2010 [ top ]

07-01-2010 [ top ]

07-02-2010 [ top ]

07-05-2010 [ top ]

07-06-2010 [ top ]

07-07-2010 [ top ]

07-08-2010 [ top ]

07-09-2010 [ top ]

07-12-2010 [ top ]

07-13-2010 [ top ]

07-14-2010 [ top ]

07-15-2010 [ top ]

07-16-2010 [ top ]

07-19-2010 [ top ]

07-20-2010 [ top ]

07-21-2010 [ top ]

07-22-2010 [ top ]

07-23-2010 [ top ]

07-26-2010 [ top ]

07-27-2010 [ top ]

07-28-2010 [ top ]

07-29-2010 [ top ]

07-30-2010 [ top ]

08-02-2010 [ top ]

08-03-2010 [ top ]

08-04-2010 [ top ]

08-05-2010 [ top ]

08-06-2010 [ top ]

08-09-2010 [ top ]

08-10-2010 [ top ]

08-11-2010 [ top ]

08-12-2010 [ top ]

08-13-2010 [ top ]