Week 26
Flagella
- Studied inhibition and activation FlhD/C operon.
- Found out that PskA is an important inhibitor, which also is part of ribosome synthesis.
Phototaxis
- Ordered proteorhodopsin biobrick [http://partsregistry.org/Part:BBa_I711040 I711040]
- Did research on the light-sensitive proteorhodopsin ionpump.
Week 27
Flagella
- Read up on the flagella regulon using following articles;
[http://ncbi.nlm.nih.gov/pmc/articles/PMC179437/pdf/1795602.pdf]
Cell Cycle Regulation of Flagellar Genes
Birgit M. Prüß and Philip Matsumura
Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, Illinois 60612-7344
[http://ncbi.nlm.nih.gov/pubmed/7961507]
The FlhD/FlhC Complex, a Transcriptional Activator of the Escherichia coli Flagellar Class II Operons
Xiaoying Liu and Philip Matsumura
Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, Illinois 60612-7344
- Decided to follow the popular "trial-and-error" method and test what effects it will have to put the FlhDC operon after a constitutive promoter.
- Ordered FlhD/C primers
Phototaxis
- Decided to go back to the original idea for controlling phototaxis via a SRII/HtrII/EcTsr fusion-chimeric protein described in the following article;
[http://pubs.acs.org/doi/abs/10.1021/bi034399q]
Photostimulation of a Sensory Rhodopsin II/HtrII/Tsr Fusion Chimera Activates CheA-Autophosphorylation and CheY-Phosphotransfer in Vitro†
Vishwa D. Trivedi and, John L. Spudich
Biochemistry 2003 42 (47), 13887-13892
which is shown to work in K-12 E. coli in this article;
[http://jb.asm.org/cgi/content/full/183/21/6365]
An Archaeal Photosignal-Transducing Module Mediates Phototaxis in Escherichia coli
Jung, Kwang-Hwan, Spudich, Elena N., Trivedi, Vishwa D., Spudich, John L.
J. Bacteriol. 2001 183: 6365-6371
- Contacted the original researchers on the mentioned papers for protein sequences and plasmids
Retinal Production
- Decided to atempt to make our backteria synthesise retinal endogenously.
- Designed a new biobrick around the ninaB gene from D. melanogaster, that has been shown to produce a beta-carotene 15,15'-monooxygenase [http://www.jbc.org/content/275/16/11915.long][http://www.ncbi.nlm.nih.gov/pmc/articles/PMC14720/?tool=pubmed].
- Isolated the gene sequence, and suggested biobricks for the coding region (K343001)
- Proposed four biobricks
BBa_K343000 – FlhDCmut coding sequence
BBa_K343001 - Sandboxed coding sequence from ninaB gene.
BBa_K343002 - Sandboxed coding sequence from ninaB gene on one of the weaker Anderson promoters, with rbs and dual terminator.
BBa_K343003 - Sandboxed coding sequence for the SopII-HtrII-Tsr fusion protein.
References:
1. Filling the gap in vitamin A research. Molecular identification of an enzyme cleaving beta-carotene to retinal.,von Lintig J, Vogt K., J Biol Chem. 2000 Apr 21;275(16):11915-20.
2. Analysis of the blind Drosophila mutant ninaB identifies the gene encoding the key enzyme for vitamin A formation in vivo, Johannes von Lintig,* Armin Dreher, Cornelia Kiefer, Mathias F. Wernet, and Klaus Vogt, Proc Natl Acad Sci U S A. 2001 January 30; 98(3): 1130–1135.
3. "An Archaeal Photosignal-Transducing Module Mediates Phototaxis in Escherichia coli", Jung K-H, Spudich EN, Trivedi VD and Spudich JL ; Journal of Bacteriology, Nov. 2001, p. 6365–6371.
Modelling
July 1st
Progress report:
The last couple of days we have been reading articles about modelling the flagella movement and their influence on the water flow. Because we need to understand the physics of the system before we are able to model it. Today we have been looking at the equations describing the system from the article to get an idea of how the physics is applied. The following articles have been used in this progress;
[http://docs.google.com/viewer?a=v&pid=wave&srcid=8e-fLRxU2&chrome=true]
Synchronization in a carpet of hydrodynamically coupled rotors with random intrinsic frequency N. Uchida 1 and R. Golestanian 2, ELP(Europhysics Letters) volume 89, number 5.
[http://docs.google.com/viewer?a=v&pid=wave&srcid=sz1nqWu52&chrome=true]
The physics of flagellar motion of E. coli during chemotaxis M. Siva Kumar and P. Philominathan Biophysical Reviews Volume 2, Number 1 / February, 2010.
Working hypothesise:
Understanding the physics of flagella systems, their movement in a fluid and their effects on the fluids, is important for setting up models describing the system we would like to produce. We haven’t yet found a model describing our system fully and this is therefore our next assignment.
--Toand 15:29, 2 July 2010 (UTC)
July 2nd
Progress report:
Today we continued looking at the equations from the article, then had a meeting with Associate professor Julian C. Shillcock, PhD (SDU) who help us plan a model for the system. Our further work will consist of connecting the physics to the system and device equations that describe it. The article uses was:
[http://docs.google.com/viewer?a=v&pid=wave&srcid=8e-fLRxU2&chrome=true]
Synchronization in a carpet of hydrodynamically coupled rotors with random intrinsic frequency N. Uchida 1 and R. Golestanian 2, ELP(Europhysics Letters) volume 89, number 5.
Working hypothesise:
A set of rigid screws with one end attached to a surface with the ability to bend in an angel θi and generate a force Fi. The forces generated by a screw may influence the angel of other screws and the effect the entire system witch in term affects the first screw. When the physics of the system is determined we hope to model variations of θi with the force Fi.
--Toand 08:46, 4 July 2010 (UTC)
Week 28
July 7th
In the Lab:
- Extracted FlhDC master operon from E. coli strain MG1655
- Showed pressence of pst1 site in FlhC
- Introduced silent mutation into FlhC
Experiments:
We are apparently having problems with our PCR since no PCR has worked for the last two days. This has resulted in three failed PCR experiments:
-pSB1A2
-pSB1A3
-Genomic purification
We had some succes with minipreps, and now have plasmids pSB1A2 and pSB1A3 ready for assemblies.
We made six batches of competent cells, and made two transformations:
-pBad L-arabinose inducible promoter
-cambridge beta-carotene biosynthesis operon
9 colonies of each were plated ON along with a positive and negative control. More transformations will follow tomorrow.
July 8th
Experiments: Today we were troubleshooting the PCR process, which miraculously worked today. We only used TAQ polymerase for the reactions today and no PFU. This helped us narrow the reason for the last few days failure down to either human error or bad PFU enzyme. The good news is that PCR is finally working, which means that we will be able to run some colony PCR tomorrow.
We also transformed quite a few cells today. We did transformations for four different biobricks, BBa_J13002 (a TetR repressed generator), BBa_K274210 (Beta carotene enzymes), BBa_B0012 (double terminator) and BBa_K098995 (heat sensitive promoter). We will see tomorrow morning if the transformations were a success.
Last but not least we made an overnight culture of the biobrick backbone pSB3k3, which we'll use for miniprep tomorrow.
Flagella
July 5th
Today we have designed mutation primers, to remove a Pst1 site inside our operon. We have planned a silent mutation, so if we get it right it shouldn't affect our final protein.
Biobrick design:
FlhDC mutationsprimers:
Passer til komplimentærstrengen:
5' - GGCAGCTTTGCCCGCAGCTTATGTC - 3' (Melting point basic: 63°C)
Passer til coding strand:
5' - GACATAAGCTGCGGGCAAAGCTGCC - 3' (Melting point basic: 63°C)
--CKurtzhals 20:04, 5 July 2010 (UTC)
July 8th
The FlhD,C group ran into some problems today regarding the primers for the silent mutation we want to introduce in our brick (for removing an illegal Pst1 site). The forward and reverse primers melting point is much too low in comparison to the mutation primers' melting point. We also hope to resolve that issue over the next few days.
July 9th
Overview of the projekt progress and process:
1) We have had problems with out PCR's, none of them work! We have spent the last week trouble-shooting to find the problem and are down to the last few possible causes. It seems now, that the most likely cause is the annealing temperature of the primers, it is too low and the differences between the FW- and the RV-primers are too grate. We hope to solve the mystery soon. When the primer problem is solved we can finally extract the FlhDC operon from the bacteria.
2) The FlhDC operon entails an internal PST1 site, so we need to induce a silent mutation. For this we need the primers mentioned yesterday. We have fixed the primer annealing temperature problem and have ordered the primers. We hope to get them medio next week.
These two steps are the most urgent that we work on now. Later on we have to do as follows:
3) We need to insert the FlhDC operon into the psb3k3 plasmid.
4) The psb3k3-FlhDC plasmid has to be transformed into cells.
5) Detect if cells are hyperflagellated.
Progress report: Pernille, Sheila and I have worked as a group for the first time today. We have done Miniprep to extract the plasmids we want to insert our biobricks in and Chromosomal DNA PCR to test our primers and the perfect annealing temperature(documented in labnotes)
Working Hypothesis: No Change
BioBrick Design: No Change
--Louch07 16:00, 9 July 2010 (UTC)
Phototaxis
July 5th
Lab progress:
- Transformed the [http://partsregistry.org/Part:BBa_K274210 Cambridge part] in to Top10 cells
- Transformed an [http://partsregistry.org/Part:BBa_I0500 inducible promoter] in to Top10 cells
- Transformed [http://partsregistry.org/Part:BBa_E0040 GFP] in to MG1655 cells
Progress report:
Today we've designed primers and worked out how we plan to characterize our light sensor. The experiment has to determine how much our protein stimulates the kinase activity of CheA, and in turn the phosphorylation of CheY.
We plan to measure directly on CheY.
Exsperiment:
- first we create a suspension of cells in water, keeping them in the dark until the experiment.
- Then we take small microcapillary tubes, and use them to draw a specific amounts of fluid and bacteria from the suspension, as to ensure equal amounts of protein in our gels, more on which later.
- We will then ad radio labeled ATP to our cells. (This step might be done earlier)
- We now shine a colored light into our tube, varying wavelength and intensity in separate experiments.
- After an equal length of time for each tube, we lyse the cells, and run the proteins through a gell.
- We might need to tag our CheY with antibodies to show them, but in theory the only proteins that should increase in phosphorylation states would be CheY and CheA, and therefore the remaining bands should stay unchanged.
We hope to show how the kinase activity of CheA on CheY is stimulated by our blue light, which wavelengths are optimal, and whether varying intensity of light has an effect on activity.
BioBrick Design: We designed and ordered the following primers:
// Melting points calculated with Oligocalc [1]
NpSRII-HtrII-EcTsr primers:
Upstream primer:
5' - GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGTGGGACTTACG - 3' (Melting point basic: 71°C)
Downstream primer:
5' - GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATTAAAATGTTTCCCAGTTCTCCTCG - 3' (Melting point basic: 71°C)
ninaB primers (Retinal enzym):
Upstream primer:
5' - GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGCAGCCGGTGTCTTCAA - 3' (Melting point basic: 73°C)
Downstream primer:
5' - GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTACTAAATGGCATTGGGTGCAA - 3' (Melting point basic: 71°C)
References:
OligoCalc: http://www.basic.northwestern.edu/biotools/oligocalc.html
July 6th
Morning Meeting:
A morning meeting was held with our supervisors and instructors, to determine the overall structure of our lab activities. We came to consensus on dividing into three lab groups and a modelling group. The three lab groups will be working on:
-The ninaB brick
-The FlhDC operon
-The Photosensor
Each group will be responsible for further development of their bricks, construction and planning of experiments to characterize them. The modelling group will be responsible for advising groups on what characteristics to model.
We've planned for the crash course team to attempt transformation of our bacteria with the cambridge part. These transformed strains will be used by the retinal group.
We further reached consensus on office hours, cake issues and calendar issues.
In the lab:
Participants in the lab-crash-course v. 2.0 have conducted to experiments. Both failed, but we have learned lessons for further lab-work.
- Purification of Genomic DNA: We failed to collect a sufficient biomass. Use overnight cultures from now on.
- Quick and dirty microwave-oven + primer PCR amplification of FlhDC operon: We might not have nuked the bacteria enough, or we might fave failed to design our pcr process properly. (did we remember primers?!)
Phototaxis (Retinal and Fusion protein.)
Progress report: From now on the phototaxis group will consist of Maria, LC, Tommy and Chritsian. We will prioritize work on the Drosophila retinal enzyme gene, until we get physical DNA for the synthetic protein.
If we fail to establish contact with Spudich lab within 14 days, our work will shift to synthesizing the protein ourselves, using physical DNA from halobacteria and e. coli, together with the sequence and the recipe for success, found in their article.
--CKurtzhals 19:42, 6 July 2010 (UTC)
July 7th
Progress Report:
We have not yet established contact with Spudich Lab, who are in possesion of strains with the physical DNA we need. Our cDNA from the Drosophila registry hasn't been ordered either.
We might have to make the fusion protein ourselves. We are therefore looking into protocols for growing halobacteria. The ones we are interested, N. Pharaonis are apparently not able to grow well in standard agar, as they require large salt concentrations, and don't run on glucose since their glycolysis is non-functional.
no real work has been done with regards to the retinal brick. <br<
Working Hypothesis no changes here.
--CKurtzhals
July 8th
We sent an email to the Spudich lab today, asking if we could get the SRII,HtrII,Tsr fusion,chimera-protein from them. Now we are just waiting (and hoping) for a positive answer, so that we will be able to proceed with this part of the project.
July 9th
progress report: We have run colony-PCR on the cambridge BBa_K274210 brick we have attempted to transform into our cells. We have also run colony pcr on a RBS, a RFP reporter and a heat inducible promoter. All but the K274210 colonies showed bands at correct lengths, and the RFP colonies had turned bright red.
Jakob has ordered primers and cDNA from drosophila melanogaster.
Lars Christian and Maria will be working over the weekend, to make overnight cultures, and freeze cells, so we will be ready to make a new batch of competent cells next week. We need both coli TOP10 and M1655.
Troubleshooting on Cambridge brick:
We suspect our elongation time of being to short. This might explain the smear at the bottom of each well.
-The length of the part in this plasmid is 4856Bp.
-The reaction rate for this enzyme is stated as 35-100nt/sec at 72°C and 40% of that at 55°C
-we ran the elongation for 5 minutes at 55°C giving us 4200-12.000 nt/elongation.
Another problem could be the length of our part. Apparently we are opperating on the limit of what the polymerase can do, most companies stating that it will work for 3-4kb and can be pressed to 5kb if conditions are optimal. Many also suggest increasing [MgCl2] at low yields. We might also attempt that. Yet another possibility is that our colonies didn't contain any plasmids with our part.
We will be attempting new colony pcr in the coming week, with elongation set to at least 6 minutes at 55°C. Perhaps we will attempt it with two different polymerases, increasing [MgCl2] in the Taq mix.
We have considered other ways of getting physical dna for our fusion protein. Two options come to mind if we can't get it from spudich lab.
- getting it synthesized
- Maybe getting the strain with the natromonas proteins from the 2007 melbourne team.
working hypothosis: No changes
--CKurtzhals 21:23, 9 July 2010 (UTC)
Modelling:
July 5th
Progress report: Today we have been discussing Stokes and Navier-Stokes equations in relation to the system we would like to model. After witch we tried to identify a differential equation describing the system. The following physics books have been used:
The theory of polymer dynamics, M. DOI, S. F. Edwards, oxford science publications, 4. edition 1992.
Physics of continuous matter, B. Lautrup, IOP publishing, 2005.
Working hypothesises: a row of rigid screws with one end attached to a surface with the ability to bend in an angel θi and generate a force Fi. The forces generated by a screw may influence the angel of other screws and the effect the entire system witch in term affects the first screw. When the physics of the system is determined we hope to model variations of θi with the force Fi.
--Toand 19:06, 5 July 2010 (UTC)
July 8th
Progress report: We have almost finished with the equation jumbling. We have been able to create some equations which we feel will describe the system accurately. Next we will try to implement these on a computer. When we fee sure about the system the equations and a sketch of the system will be put in the progress report.
Working hypothesises: No changes
July 9th
Progress report: We have started implementing our model. We are discussing which forces are actually effecting the system. Besides the forces produced by the flagellas, we are discussing whether the flagellas have a favored position that it would be pushed towards, when not effected by outer forces. We are also discussing whether thermal forces should be included.
Working Hypothesis: No Change.
Week 29
Flagella
Retinal
- pSB3C5-J04450 and pSB3T5-J04450 were transformed into E.coli TOP10 cells
- pSB1A2-R0011 was transformed into E.coli TOP10 cells
Week 30
- Ligated J13002 into pSB3T5
Week 35
Photosensor
- NpSopII-NpHtrII-StTar coding sequence was isolated from pKJ606
Week 36
Flagella
- flhD/Cmut was made using new mutaion primers
- flhD/Cmut was ligated into pSB1C3 and plasmid was transformed into E.coli TOP10 cells.
Photosensor
- NpSopII-NpHtrII-StTar coding sequence (K343003) was ligated into pSB1C3 and plasmid was transformed into E.coli Top10 cells.
- NpSopII-NpHtrII-StTar coding sequence (K343003) was assembled with the double terminator (B0015) in pSB1AK3-B0015 and plasmid was transformed into E.coli TOP10 cells
Week 37
Flagella
- FlhD/Cmut coding sequence (K343000) was assembled with the double terminator (B0015) in pSB1AK3-B0015 and plasmid was transformed into E.coli TOP10 cells.
Photosensor
- NpSopII-NpHtrII-StTar coding sequence (K343003) + double terminator (B0015) was assambled with promoter + RBS (J13002)in pSB3T5-J13002 and plasmid was transformed into E.coli TOP10 cells.
Week 38
Retinal
- NinaB coding sequence (K343001) was assembled with Promoter + RBS (J13002) and ligated into pSB1C3. Plasmid was ligated into E.coli TOP10 cells
Photosensor
- Results from sequencing of NpSopII-NpHtrII-StTar coding sequence (K343003) in pSB1C3 and NpSopII-NpHtrII-StTar coding sequence (K343003) + Promoter + RBS (J13002) in pSB1AK3 was OK
Week 39
Retinal
- NinaB coding sequence + Promoter + RBS (K343005) was assembled with the double terminator (B0015) in pSB1AK3-B0015 and plasmid was transformed into E.coli TOP10 cells.
- pSB1C3-K343005 and pSB1A2-K274210 (CrtEBIY under constitutive promoter) was transformed into E.coli TOP10 and MG1655 cells
week 40
Retinal
- NinaB coding sequence + Promoter + RBS (K343005) was assembled with the double terminator (B0015) in pSB1AK3-B0015 and transformed into E.coli TOP10 and MG1655 cells
Week 41
Flagella
- flhD/Cmut composite part (K343004) was ligated into pSB1C3 and pSB3K3 and plasmids were transformed into E.coli TOP10 and MG1655 cells.
Retinal
- NinaB composite part (K343006) was ligated into pSB1C3 and plasmid was transformed into E.coli TOP10 and MG1655 cells
Week 42
Flagella
- Results of sequencing of flhD/Cmut composite part (K343004) in pSB1C3 was OK
Photosensor
- MG1655/pSB3T5-K343007 (NpSopII-NpHtrII-StTar composite part) was sequenced on THOR from [http://www.unisensor.dk/ Unisensor]