"
Team:Kyoto/Parts
From 2010.igem.org
(→K358000) |
(→K358000) |
||
| Line 5: | Line 5: | ||
<groupparts>iGEM010 Kyoto</groupparts> | <groupparts>iGEM010 Kyoto</groupparts> | ||
| - | ====<partinfo>K358000</partinfo>==== | + | ====<partinfo>K358000</partinfo>: Lac promoter with GFP==== |
| - | + | ||
| - | + | ||
The lac promoter will be repressed and not induce GFP in the presence of ''lac''I. We measured the strength of fluorescence with low copy plasmid vector, pSB4K5. | The lac promoter will be repressed and not induce GFP in the presence of ''lac''I. We measured the strength of fluorescence with low copy plasmid vector, pSB4K5. | ||
Revision as of 07:27, 25 October 2010
Parts
Original
List
<groupparts>iGEM010 Kyoto</groupparts>
<partinfo>K358000</partinfo>: Lac promoter with GFP
The lac promoter will be repressed and not induce GFP in the presence of lacI. We measured the strength of fluorescence with low copy plasmid vector, pSB4K5.
<partinfo>K358001</partinfo>
<partinfo>BBa_K358001 short</partinfo>
constitutive promoter[J23101] with GFP on low plasmid[pSB4K5]
<partinfo>K358004</partinfo>
<partinfo>BBa_K358004 short</partinfo>
This part causes cell death. It contains holin/antiholin, endolysin and Rz/Rz1 genes.
<partinfo>K358006</partinfo>
<partinfo>BBa_K358006 short</partinfo>
λ lysis cassette <partinfo>BBa_K358004</partinfo> with double terminator <partinfo>BBa_B0015</partinfo>.
<partinfo>K358010</partinfo>
<partinfo>BBa_K358010 short</partinfo>
It codes SΔTMD1 as the anti-killer gene, which is derived from λ phage DNA and against the lambda lysis cassette[BBa_K358005]: the killer gene.
<partinfo>K358012</partinfo>
<partinfo>K358013</partinfo>
<partinfo>K358015</partinfo>
<partinfo>K358016</partinfo>
<partinfo>K358017</partinfo>
<partinfo>K358018</partinfo>
<partinfo>K358019</partinfo>
<partinfo>K358020</partinfo>
<partinfo>K358021</partinfo>
BioBrick
Parts
| Name | Description | Well*1 | Plasmid | Resistance | Insert Length | Vector Length |
|---|---|---|---|---|---|---|
| <partinfo>J23100</partinfo> | Constitutive promoter family member | 1-18-C | <partinfo>J61002</partinfo> | Ampicillin | 35 | 2948 |
| <partinfo>J23105</partinfo> | Constitutive promoter family member | 1-18-M | <partinfo>J61002</partinfo> | Ampicillin | 35 | 2948 |
| <partinfo>J23116</partinfo> | Constitutive promoter family member | 1-20-M | <partinfo>J61002</partinfo> | Ampicillin | 35 | 2948 |
| <partinfo>R0011</partinfo> | Promoter (lacI regulated, lambda pL hybrid) | 1-6-G | <partinfo>pSB1A2</partinfo> | Ampicillin | 55 | 2079 |
| <partinfo>B0015</partinfo> | Double terminator (<partinfo>B0010</partinfo>-<partinfo>B0012</partinfo>) | 1-23-L | <partinfo>pSB1AK3</partinfo> | Ampicillin, Kanamycin | 129 | 3189 |
| <partinfo>E0840</partinfo> | GFP generator | 1-12-O | <partinfo>pSB1A2</partinfo> | Ampicillin | 878 | 2079 |
| <partinfo>E0240</partinfo> | GFP generator | 1-12-M | <partinfo>pSB1A2</partinfo> | Ampicillin | 876 | 2079 |
| <partinfo>I20260</partinfo> | Measurement Kit Test of <partinfo>J23101</partinfo> | 2-17-F | <partinfo>pSB3K3</partinfo> | Kanamycin | 919 | 2750 |
| <partinfo>J06702</partinfo> | mCherry, bacterial with RBS and forward terminator | 2-8-E | <partinfo>pSB1A2</partinfo> | Ampicillin | 869 | 2079 |
| <partinfo>pSB3K3</partinfo> | RFP Coding Device | 1-5-E | <partinfo>pSB3K3</partinfo> | Kanamycin | 1069 | 2750 |
| <partinfo>pSB4K5</partinfo> | Low copy BioBrick standard vector | 1-5-G | <partinfo>pSB4K5</partinfo> | Kanamycin | 1069 | 3419 |
| <partinfo>pSB1C3</partinfo> | High copy BioBrick assembly plasmid | <partinfo>pSB1C3</partinfo> | Chloramphenicol | 2072 |
- *1 "1-18-C" means well 18C in [http://partsregistry.org/Help:Spring_2010_DNA_distribution Spring 2010 DNA Distribution Kit] Plate 1.
Primers
| Name | Description | Sequence |
|---|---|---|
| <partinfo>G00100</partinfo> | Forward primer for sequencing/amplifying BioBrick parts (VF2) | tgccacctgacgtctaagaa |
| <partinfo>G00101</partinfo> | Reverse primer for sequencing/amplifying BioBrick parts (VR) | attaccgcctttgagtgagc |
