"
Team:Imperial College London/Software Tool
From 2010.igem.org
(Difference between revisions)
| Line 19: | Line 19: | ||
det[3] = "Currently, a lumbar puncture is necessary to diagnose the devastating Chagas' disease. However, a simple blood test could test for a specific protease called cruzipain which is produced by the Trypanasoma cruzi parasite."; | det[3] = "Currently, a lumbar puncture is necessary to diagnose the devastating Chagas' disease. However, a simple blood test could test for a specific protease called cruzipain which is produced by the Trypanasoma cruzi parasite."; | ||
det[4] = "Detecting this coagulation factor could be a way of determining if patients should be given warfarin or a low molecular weight heparin (LMWH) if they are displaying atrial fibrilation following a stroke. Factor X is the first member of the thrombin pathway which essentially leads to blood clotting."; | det[4] = "Detecting this coagulation factor could be a way of determining if patients should be given warfarin or a low molecular weight heparin (LMWH) if they are displaying atrial fibrilation following a stroke. Factor X is the first member of the thrombin pathway which essentially leads to blood clotting."; | ||
| - | det[5] = " | + | det[5] = "The complement system is part of the innate immune response to an acute infection. Detecting C3 convertase could give medical professionals a rapid method of seeing if a patient is fighting an acute infection."; |
var prefix = "GAATTCGCGGCCGCTTCTAG"; | var prefix = "GAATTCGCGGCCGCTTCTAG"; | ||
var promoter = "blank"; | var promoter = "blank"; | ||
Revision as of 11:23, 20 October 2010
| Software Tool |
| We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct. |
| Select Protease | Description | |
|
This was our primary target. Read our wiki to find out more! | ||
|
Awaiting sequence generation...
| ||
|
Yellow - Biobrick Prefix/Suffix Orange - Promoter Red - Ribosome Binding Site Purple - Cell Wall Binding Domain Dark Blue - Adjustable Linker Light Blue - Protease Cleavage Site Dark Green - Autoinducing Peptide Light Green - Terminator | ||
