"

From 2010.igem.org

Revision as of 14:13, 9 August 2010 (view source) Mimmi (Talk | contribs) ← Older edit		Latest revision as of 10:45, 26 October 2010 (view source) Hassanforoughiasl (Talk | contribs)
(One intermediate revision not shown)
Line 147:		Line 147:
	| 10		| 10
	|}		|}
		+
		+	----
		+	==Nina==
		+	----
		+	===PCR on Tyrosinase===
		+
		+	I ran a new PCR on the Tyrosinase since I realized that the band from the last PCR on this gene was incorrect (too high than expected). The gene Tyrosinase is about 1900 nt.
		+
		+	PCR Mix (100 ul):
		+
		+	*Fprimer 50 uM 1 ul
		+	*Rprimer 50 uM 1 ul
		+	*dNTP 10 mM 2 ul
		+	*Buffer 5X 20 ul for phusion polymerase
		+	*Buffer 10X 10 ul for fermenta (Pfu) polymerase
		+	*phusion polymerase 1 ul
		+	*fermenta (Pfu) polymerase 1 ul
		+	*H2O 75 ul for phusion polymerase
		+	*H2O 85 ul for fermenta (Pfu) polymerase
		+	*DNA template 1 colony
		+
		+	Primer dilutions:
		+
		+	100 uM gets a 1:2 dilution to become 50 uM
		+
		+	cV = cV
		+
		+	100V = 50*10ul
		+
		+	V = 500 / 100 = 5 ul primer and fill up to 10 ul with H2O.
		+
		+	I aliquate the 100 ul in four PCR tubes, each with 25 ul PCR mix.
		+
		+	PCR prgm:
		+
		+	98 °C 2 min
		+
		+	2 * 29 cycles of:
		+
		+	*98 °C 30 sec
		+	*50-72 °C 30 sec
		+	*72 °C 2 min
		+
		+	72 °C 1 min
		+
		+	4 °C ∞
		+	----
		+	===Agarose gel on Tyrosinase===
		+
		+	I ran a 1 % agarose gel on the tyrosinase PCR productes.
		+
		+	Ladder: FastRuler™ Middle Range DNA Ladder, ready-to-use, 100-5000 bp Fermentas
		+
		+	Arrangement on gels:
		+
		+	[[Image:Steg.jpg]]
		+
		+	1 = 50 °C - 4 = 72 °C
		+
		+	[[Image:Tyrsuc.jpg|250px]]
		+
		+	P1 and 2 look like they have succesfully PCR:ed tyrosinase.
		+
		+	----
		+	===Sequencing yCCS===
		+
		+	I send two samples of yCCS for sequencing.
		+
		+	*15 ul vector
		+	*1.5 ul 10uM VF2 primer
		+
		+	A: ASB0045 246
		+
		+	B: ASB0045 245
		+
		+	{{Stockholm/Footer}}

---

Latest revision as of 10:45, 26 October 2010

Contents 1 Andreas 1.1 CPP DNA synthesis 1.2 Cm stocks 1.3 LB agar plates 2 Mimmi 2.1 MITF - amplifying and moving the gene to pSB1C3 3 Nina 3.1 PCR on Tyrosinase 3.2 Agarose gel on Tyrosinase 3.3 Sequencing yCCS

Andreas

CPP DNA synthesis

Designed a CPP cluster to be sent for synthesis, containing all CPPs (with Freiburg prefixes and suffixes) as follows:

(ApaI)—C-Tra10—(BamHI)—N-Tra10—(ClaI)—C-TAT—(NcoI)—N-TAT—(SmaI)—C-LMWP—(BglII)—N-LMWP—(HindIII)

>CPP_cluster
GGGCCCGCGAATTCGCGGCCGCTTCTAGATGGCCGGCGCGGGTTACCTGCTGGGTAAAAT
CAACCTGAAAGCGCTGGCGGCGCTGGCGAAAAAAATCCTGACCGGTTAATACTAGTAGCG
GCCGCTGCAGGCGGATCCGCGAATTCGCGGCCGCTTCTAGATGGCGGGTTACCTGCTGGG
TAAAATCAACCTGAAAGCGCTGGCGGCGCTGGCGAAAAAAATCCTGACCGGTTAATACTA
GTAGCGGCCGCTGCAGGCATCGATGCGAATTCGCGGCCGCTTCTAGATGGCCGGCTACGG
TCGTAAAAAACGTCGTCAGCGTCGTCGTACCGGTTAATACTAGTAGCGGCCGCTGCAGGC
CCATGGGCGAATTCGCGGCCGCTTCTAGATGTACGGTCGTAAAAAACGTCGTCAGCGTCG
TCGTACCGGTTAATACTAGTAGCGGCCGCTGCAGGCCCCGGGGCGAATTCGCGGCCGCTT
CTAGATGGCCGGCGTTTCTCGTCGTCGTCGTCGTCGTGGTGGTCGTCGTCGTCGTACCGG
TTAATACTAGTAGCGGCCGCTGCAGGCAGATCTGCGAATTCGCGGCCGCTTCTAGATGGT
TTCTCGTCGTCGTCGTCGTCGTGGTGGTCGTCGTCGTCGTACCGGTTAATACTAGTAGCG
GCCGCTGCAGGCAAGCTT

Cm stocks

Prepared 4 x 1 ml 25 μg/μl Cm stocks.

LB agar plates

Prepared Cm and Amp LB agar plates as follows:

• 20x 25 μg/ml Cm
• 20x 100 μg/ml Amp

---

Mimmi

MITF - amplifying and moving the gene to pSB1C3

• Using AmplifX, suggested T_a1 = 54.8°C, T_a2 = 62.6°C

Primers

(MW/10)/(OD*33)=df

1000/df=V for 100µM

1:10=V for 10µM

• MITF_F: 70.59µl H₂O --> 1:10
• MITF_R: 541.88µl H₂O --> 1:10

Mix	(µl)	X4 (µl)		Mix control	(µl)	X5 (µl)		contitions
H2O	39.5	158		H2O	22.5	112.5		time	°C
F primer	0.75	3		F primer	1	5		2m	94
R primer	0.75	3		R primer	1	5		30s	94	)
buffer	5	20		DNA	0.5	5*0.5		30s	55	> 5 cycles
Pfx pol	0.5	2		tot	25	125		1m30s	68	)
dNTPs	1.5	6						30s	94	)
MgSO4	1	4						30s	62	> 25 cycles
DNA	1	4						1m30s	68	)
tot	50	200						10m	68
								oo	10

---

Nina

---

PCR on Tyrosinase

I ran a new PCR on the Tyrosinase since I realized that the band from the last PCR on this gene was incorrect (too high than expected). The gene Tyrosinase is about 1900 nt.

PCR Mix (100 ul):

• Fprimer 50 uM 1 ul
• Rprimer 50 uM 1 ul
• dNTP 10 mM 2 ul
• Buffer 5X 20 ul for phusion polymerase
• Buffer 10X 10 ul for fermenta (Pfu) polymerase
• phusion polymerase 1 ul
• fermenta (Pfu) polymerase 1 ul
• H2O 75 ul for phusion polymerase
• H2O 85 ul for fermenta (Pfu) polymerase
• DNA template 1 colony

Primer dilutions:

100 uM gets a 1:2 dilution to become 50 uM

cV = cV

100V = 50*10ul

V = 500 / 100 = 5 ul primer and fill up to 10 ul with H2O.

I aliquate the 100 ul in four PCR tubes, each with 25 ul PCR mix.

PCR prgm:

98 °C 2 min

2 * 29 cycles of:

• 98 °C 30 sec
• 50-72 °C 30 sec
• 72 °C 2 min

72 °C 1 min

4 °C ∞

---

Agarose gel on Tyrosinase

I ran a 1 % agarose gel on the tyrosinase PCR productes.

Ladder: FastRuler™ Middle Range DNA Ladder, ready-to-use, 100-5000 bp Fermentas

Arrangement on gels:

1 = 50 °C - 4 = 72 °C

P1 and 2 look like they have succesfully PCR:ed tyrosinase.

---

Sequencing yCCS

I send two samples of yCCS for sequencing.

• 15 ul vector
• 1.5 ul 10uM VF2 primer

A: ASB0045 246

B: ASB0045 245