Team:St Andrews/project/laboratory

From 2010.igem.org

(Difference between revisions)
(The CAI-1 sender)
 
(78 intermediate revisions not shown)
Line 1: Line 1:
 +
{{:Team:St_Andrews/defaulttemplate}}
 +
<html>
<html>
-
<head>
+
<h1> Laboratory </h1>
-
<head>
+
</html>
-
<script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.js" type="text/javascript"></script>
+
-
<script src="http://www.lycifer.co.cc/java/s3Slider.js" type="text/javascript"></script>
+
-
<script src="http://www.lycifer.co.cc/java/jquery.corner.js" type="text/javascript"></script>
+
-
<script src="http://www.lycifer.co.cc/java/liquid-canvas.js" type="text/javascript"></script>
+
-
<script src="http://www.lycifer.co.cc/java/liquid-canvas-plugins.js" type="text/javascript"></script>
+
-
<script language="JavaScript" type="text/JavaScript">
+
-
$(document).ready(function(){
+
-
$(".exphoto").corner("32px")
+
-
$(".exphoto").corner("80px tr")
+
-
$(".exmain").corner("32px bl")
+
-
$(".main").corner("80px tl")
+
-
$(".main").corner("32px bl")
+
-
$(".tag").corner("32px tl bl")
+
-
$("#navmenu-h li,#navmenu-v li").hover(
+
-
function() { $(this).addClass("iehover"); },
+
-
function() { $(this).removeClass("iehover"); }
+
-
);});
+
-
</script>
+
-
<script src="http://www.lycifer.co.cc/java/jquery.nivo.slider.pack.js" type="text/javascript"></script>
+
-
<script type="text/javascript">
+
-
$(window).load(function() {
+
-
$('#slider').nivoSlider({
+
-
effect:'fade', //Specify sets like: 'fold,fade,sliceDown'
+
-
slices:50,
+
-
animSpeed:1000,
+
-
pauseTime:5000,
+
-
startSlide:0, //Set starting Slide (0 index)
+
-
directionNav:false, //Next & Prev
+
-
directionNavHide:true, //Only show on hover
+
-
controlNav:false, //1,2,3...
+
-
controlNavThumbs:false, //Use thumbnails for Control Nav
+
-
      controlNavThumbsFromRel:true, //Use image rel for thumbs
+
-
controlNavThumbsSearch: '.jpg', //Replace this with...
+
-
controlNavThumbsReplace: '_thumb.jpg', //...this in thumb Image src
+
-
keyboardNav:false, //Use left & right arrows
+
-
pauseOnHover:true, //Stop animation while hovering
+
-
manualAdvance:false, //Force manual transitions
+
-
captionOpacity:0.8, //Universal caption opacity
+
-
beforeChange: function(){},
+
-
afterChange: function(){},
+
-
slideshowEnd: function(){} //Triggers after all slides have been shown
+
-
}
+
-
);
+
-
})
+
-
</script>
+
-
<link rel="stylesheet" type="text/css" href="http://www.lycifer.co.cc/css/lymain6.css" />
+
-
</head>
+
-
<body>
+
-
<img class="background" border="0" src="http://farm5.static.flickr.com/4138/4850316388_ffee095f41_t_d.jpg"/>
+
-
<img class="gradient" border="0" src="http://farm5.static.flickr.com/4090/4839791534_ee9a9c2a4a_m_d.jpg"/>
+
-
<img class="gradientb" border="0" src="http://farm5.static.flickr.com/4088/4839184741_cdc2138f55_m_d.jpg"/>
+
-
<img class="lybanner" border="0" src="http://farm5.static.flickr.com/4092/4839727380_8a96bda148_b_d.jpg" width="977"/>
+
-
<ul id="navmenu-h" class="navigation2">
+
-
<li class="current"><a href="https://2010.igem.org/Team:St_Andrews">Home</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team">Team</a>
+
-
<ul>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members">Members</a>
+
-
<ul>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members#Rachael Blackburn">Rachael Blackburn</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members#Lukas Ly">Lukas Ly</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members#Alasdair Morton">Alasdair Morton</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members#Patrick Olden">Patrick Olden</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members#David Owen">David Owen</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members#Fatemeh Salimi">Fatemeh Salimi</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members#Sarah Shapiro">Sarah Shapiro</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members#James Taylor">James Taylor</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/members#Jonathan Ward">Jonathan Ward</a></li>
+
-
</ul>
+
-
</li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/advisors">Advisors</a>
+
-
<ul>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/advisors#Chris Hooley">Chris Hooley</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/advisors#Olivia Mendivil">Olivia Mendivil</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/advisors#John Mitchell">John Mitchell</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/advisors#Anne Smith">Anne Smith</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/advisors#Wim Verleyen">Wim Verleyen</a></li>
+
-
</ul>
+
-
</li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors">Sponsors</a>
+
-
<ul>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#GENEART">GENEART</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#Mr Gene">Mr Gene</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#New England Biolabs">New England Biolabs</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#SALTIRE">SALTIRE</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#SULSA">SULSA</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#School of Biology">School of Biology</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#School of Chemistry">School of Chemistry</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#School of Computer Science">School of Computer Science</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#School of Physics and Astronomy">School of Physics and Astronomy</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#University of St Andrews">University of St Andrews</a></li>
+
-
<li><a href="https://2010.igem.org/Team:St_Andrews/team/sponsors#Wellcome Trust">Wellcome Trust</a></li>
+
-
</ul>
+
-
</li><li><a href="https://2010.igem.org/Team:St_Andrews/official">Official Team Profile</a></li>
+
== Introduction ==
-
</ul>
+
 
-
</li>
+
The synthetic biology portion of our project has provided the undergraduate members of our team with a rare opportunity to work in the lab for an extended period of time. Many of us have gained important skills such as learning to use our time efficiently, planning the use of limited materials and organising experiments effectively.
-
<li><a href="https://2010.igem.org/Team:St_Andrews/project">Project</a>
+
 
-
<ul>
+
== Overview ==
-
<li><a href="https://2010.igem.org/Team:St_Andrews/project/objectives">Objectives</a></li>
+
 
-
<li><a href="https://2010.igem.org/Team:St_Andrews/project/laboratory">Laboratory</a></li>
+
This part of the lab work has focused on constructing two main biobricks - the bistable switch and the CAI-1 sender.
-
<li><a href="https://2010.igem.org/Team:St_Andrews/project/modeling">Modeling</a></li>
+
 
-
<li><a href="https://2010.igem.org/Team:St_Andrews/project/notebook">Notebook</a></li>
+
===The bistable switch===
-
<li><a href="https://2010.igem.org/Team:St_Andrews/project/blog">Blog</a></li>
+
 
-
</ul>
+
To acheive bistable expression patterns in quorum sensing systems, we planned to rearrange the Lux operon so that both LuxI and LuxR were downstream of the Lux promotor.
-
</li>
+
 
-
<li><a href="https://2010.igem.org/Team:St_Andrews/contact">Contact</a></li>
+
 
-
<li><a href="https://2010.igem.org/Team:St_Andrews/about">About</a></li>
+
[[Image:LuxOpWiki.png|600px]]
-
</ul>
+
 
-
+
 
-
<ul id="crumbs" class="navigation1">
+
To do this we planned to use already available parts from the registry to assemble our bistable operon.
-
<li><a href="https://2010.igem.org/Team:St_Andrews/project">Project</a></li>
+
 
-
<li>Laboratory</li>
+
[[Image:BuildingOperon.png|600px]]
-
</ul>
+
 
-
</div>
+
We encountered problems with both 3 antibiotic assembly and In-Fusion PCR based assembly. These are detailed in the lab nootbook, but we eventually decided we had spent far too much time debugging our assembly methods and needed to move onto other areas of the project. The bistable operon was never finished.
-
<div class="ry">
+
 
-
<p class="right">
+
===Reference===
-
<script src="http://widgets.twimg.com/j/2/widget.js"></script>
+
 
-
<script>
+
EL Haseltine, FH Arnold (2007) - Implications of Rewiring Bacterial Quorum Sensing. Applied and Environmental Microbiology 74-2 437-445
-
new TWTR.Widget({
+
 
-
  version: 2,
+
===[http://partsregistry.org/Part:BBa_K356000 The CAI-1 sender]===
-
  type: 'profile',
+
 
-
  rpp: 3,
+
This biobrick is essential to our project. CAI-1, the cholera-specific auto inducing molecule, can switch off the production of cholera toxin by ''Vibrio cholerae'' when it is present in high concentrations. To make this biobrick the gene responsible for making the CAI-1 synthase (CqsA) was optimised for E. coli and then synthesised by geneart.
-
  interval: 3500,
+
CqsA can be found [http://partsregistry.org/Part:BBa_K356001 here].
-
  width: 155,
+
 
-
  height: 390,
+
First we found a sequence for the cholera gene for ''Vibrio cholerae'' autoinducer synthase.
-
  theme: {
+
 
-
    shell: {
+
[http://www.genome.jp/dbget-bin/www_bget?vch:VCA0523 the CAI-1 autoinducer synthase at genome.jp]
-
      background: '#ffffff',
+
 
-
      color: '#808080'
+
 
-
    },
+
We then codon optomised this gene for ''Escherichia coli'' using the functionality built into [http://mrgene.com/desktopdefault.aspx/tabid-2/ the Mr Gene Page]
-
    tweets: {
+
 
-
      background: '#ffffff',
+
which gave us
-
      color: '#000000',
+
 
-
      links: '#3c07eb'
+
<p>ATGAACAAACCTCAGCTGCCTGACTTTATCCAAAACAAAATCGACCACTATATCGAGAACT
-
    }
+
ATTTCGACATTAACAAAAACGGCAAACACCTGGTGCTGGGCAAACAAGCATCACCGGATGA
-
  },
+
CATTATCCTGCAAAGCAACGACTATCTGGCCCTGGCTAATCACCCTCTGATCAAAGCTCGT
-
  features: {
+
CTGGCGAAAAGCCTGCTGGAAGAACAGCAATCCCTGTTTATGAGCGCCTCCTTTCTGCAAA
-
    scrollbar: false,
+
ACGATTATGACAAACCGATGATTGAGAAACGCCTGGCCAAATTCACTGGTTTCGATGAATG
-
    loop: true,
+
CCTGCTGTCTCAGTCTGGTTGGAATGCCAATGTTGGTCTGCTGCAAACAATCTGTCAGCCT
-
    live: true,
+
AACACGAACGTCTATATTGATTTCTTCGCCCACATGTCGCTGTGGGAAGGTGCTCGTTATG
-
    hashtags: true,
+
CTAATGCTCAGGCCCATCCGTTTATGCACAACAACTGTGACCATCTGCGTATGCTGATTCA
-
    timestamp: true,
+
GCGTCACGGTCCTGGTATTATCGTCGTGGACTCCATCTATTCTACCCTGGGGACCATTGCT
-
    avatars: true,
+
CCACTGGCTGAACTGGTGAATATCAGTAAAGAGTTTGGGTGTGCCCTGCTGGTTGATGAAA
-
    behavior: 'default'
+
GCCATTCTCTGGGAACCCATGGCCCGAACGGTGCCGGGCTGCTGGCGGAGCTGGGTCTGAC
-
  }
+
ACGTGAAGTTCACTTCATGACCGCTTCGCTGGCAAAAACATTCGCCTATCGTGCTGGTGCC
-
}).render().setUser('igemsaints').start();
+
ATTTGGTGTAACAACGAGGTTAATCGCTGTGTTCCGTTCATCTCTTATCCGGCCATCTTTA
-
</script>
+
GCAGTACACTGCTGCCGTATGAAGCTGCTGGTCTGGAAACAACCCTGGAGATTATCGAGTC
 +
TGCCGATAACCGTCGTCAACATCTGGATCGTATGGCCCGTAAACTGCGTATTGGTCTGTCC
 +
CAACTGGGTCTGACAATTCGTAGCGAATCTCAGATTATTGGCCTGGAGACTGGTGACGAGC
 +
GTAATACCGAGAAAGTCCGTGATTATCTGGAGTCTAACGGCGTGTTTGGTAGCGTTTTTTG
 +
TCGTCCGGCAACCTCTAAAAACAAAAACATCATCCGCCTGTCCCTGAATAGTGATGTGAAT
 +
GATGAGCAGATCGCTAAAATCATTGAAGTCTGTTCGGATGCCGTGAATTATGGTGACTTCT
 +
ATTTCCGCTGA </p>
 +
 
 +
 
 +
<p>We then added the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix prefix], promoter [http://partsregistry.org/Part:BBa_J23100 J23100], ribosome binding site [http://partsregistry.org/Part:BBa_B0034 B0034] before the CQSA sequence
 +
and the terminator [http://partsregistry.org/Part:BBa_B0015 B0015] and the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix suffix], after the sequence.
</p>
</p>
-
</div>
 
-
<div class="main">
 
-
<div class="tag">
 
-
The Problem
 
-
</div>
 
-
<div class="exmain">
 
-
The St Andrews iGEM team plan is to do something useful with quorum sensing – the method by which bacteria make decisions in a cell density dependent manner. They do this by secreting autoinducer molecules, which diffuse back into the cells and regulate their own biosynthesis. Certain concentrations of autoinducer represent to a bacterium an amount of fellow-bacteria in the environment and the response is activation or deactivation of a set of genes.
 
-
We are interested in the quorum sensing system of Vibrio cholerae, the bacterium understood to be responsible for the deadly diarrhoeal disease, <dfn>cholera</dfn>. <dfn>Cholera</dfn> is extremely rare in the developed world, but in areas with poor sanitation it affects people who drink unsafe water. Young children are the most at risk, and left untreated death can occur by dehydration. According to the WHO, cholera kills between 100,000 and 120,000 people every year. Efforts have been made towards an effective cholera vaccine suitable for young children, but they have not yet been successful. It is now suggested that synthetic probiotic bacteria could be a safe and economical way to confer resistance to cholera.
 
-
</div>
 
-
<div class="tag">
+
We then sent these details of to Geneart and got them to do the hard work of synthesising our part for us.  
-
Quorum Sensing in <dfn>Vibrio cholerae</dfn>
+
-
</div>
+
-
<div class="exmain">
+
-
Most <dfn>cholera</dfn> cells are killed off by stomach acid, but those that remain alive attach to the gut wall and multiply. At this low cell density, autoinducer concentration is low, and virulence factors are expressed. Once high cell density is reached, enough toxin is present to cause severe diarrhoea. At this point, the autoinducer concentration is high, and virulence factors are repressed. The now avirulent V. Cholerae detach from the gut wall and are flushed out of the body to infect a new host.
+
-
Our idea is to synthesise <dfn>Escherichia coli</dfn> bacteria that will use this ingenious mechanism to communicate with <dfn>Vibrio cholerae</dfn>. Our engineered <dfn>Escherichia coli</dfn> will harmlessly colonise the gut, and in large numbers secrete the cholera autoinducer, CAI-1. This will cause an immediate high autoinducer concentration to be detected by incoming <dfn>Vibrio cholerae</dfn> cells which then become avirulent and harmlessly pass out of the body.
+
-
</div>
+
 +
[[Image:CqsAinE.coli.png|600px]]
-
<div class="tag">
+
<p>Once we received our DNA from synthesis we transformed it into E.coli and grew up some colonies.
-
Our Plan
+
Unfortunately it is not currently possible to get parts synthesied and sent ready in the biobrick
-
</div>
+
so we made an over night broth culture of a selection of colonies and then miniprepped them the  
-
<div class="exmain">
+
following morning. We digested the resulting DNA with the restriction enzymes EcoR1 and Spe1 and
-
The wet work will focus on two challenges. The first being to add new functionality to the signalling parts present in the registry by re-engineering the existing <dfb>LuxR</dfn> quorum sensing system to create a bistable switch. This will allow us to infer a signalling molecule concentration required to deactivate the system much lower than the concentration required to activate it. We will characterise this system by using a fluorescent protein reporter and measuring fluorescence at different cell densities. The second challenge will be adding the cholera autoinducer synthase gene CqsA to <dfn>Escherichia coli</dfn> so that CAI-1 is secreted. The eventual aim is that the bistable switching system will be used to control CqsA expression, so that the ability to compete with other bacteria in the human gut is not compromised by this metabolic burden.  
+
ran a gel to ensure that we had the part sizes that we wanted, we got further confirmation using
-
The computational side of the team are focusing on generating ordinary differential equations to model quorum sensing in <dfn>Vibrio cholerae</dfn> and on modelling more complex problems such as bistability and multiple quorum loops working in tandem of our parts.
+
colony PCR with the [http://partsregistry.org/Part:BBa_G00100 VF2],[http://partsregistry.org/Part:BBa_G00101 VR] primer pair. </p>
-
</div>
+
-
</div>
+
-
</body>
+
We used gel extraction to get the parts of the size we wanted and ligated them into [http://partsregistry.org/Part:pSB1C3 pSB1C3]<br>we did more confirmation using digestion + gel and colony PCR and sent the samples which gave the nicest looking gel to the registry.<br>
-
</html>
+
 
 +
As you might imagine this is a very simplified account, for the a week by week account of our summer in the lab look at our [https://2010.igem.org/wiki/index.php?title=Team:St_Andrews/project/laboratory/notebook lab notebook.]
 +
 
 +
===Reference===
 +
 
 +
F Duan, J C March (2010) Engineered bacterial communication prevents Vibrio cholerae virulence in an infant mouse model. PNAS 107-25

Latest revision as of 01:15, 28 October 2010


St Andrews from East Sands

University of St Andrews iGEM 2010

Welcome!

The Saints

University of St Andrews iGEM 2010

Our first year at iGEM!

Laboratory

Contents

Introduction

The synthetic biology portion of our project has provided the undergraduate members of our team with a rare opportunity to work in the lab for an extended period of time. Many of us have gained important skills such as learning to use our time efficiently, planning the use of limited materials and organising experiments effectively.

Overview

This part of the lab work has focused on constructing two main biobricks - the bistable switch and the CAI-1 sender.

The bistable switch

To acheive bistable expression patterns in quorum sensing systems, we planned to rearrange the Lux operon so that both LuxI and LuxR were downstream of the Lux promotor.


LuxOpWiki.png


To do this we planned to use already available parts from the registry to assemble our bistable operon.

BuildingOperon.png

We encountered problems with both 3 antibiotic assembly and In-Fusion PCR based assembly. These are detailed in the lab nootbook, but we eventually decided we had spent far too much time debugging our assembly methods and needed to move onto other areas of the project. The bistable operon was never finished.

Reference

EL Haseltine, FH Arnold (2007) - Implications of Rewiring Bacterial Quorum Sensing. Applied and Environmental Microbiology 74-2 437-445

[http://partsregistry.org/Part:BBa_K356000 The CAI-1 sender]

This biobrick is essential to our project. CAI-1, the cholera-specific auto inducing molecule, can switch off the production of cholera toxin by Vibrio cholerae when it is present in high concentrations. To make this biobrick the gene responsible for making the CAI-1 synthase (CqsA) was optimised for E. coli and then synthesised by geneart. CqsA can be found [http://partsregistry.org/Part:BBa_K356001 here].

First we found a sequence for the cholera gene for Vibrio cholerae autoinducer synthase.

[http://www.genome.jp/dbget-bin/www_bget?vch:VCA0523 the CAI-1 autoinducer synthase at genome.jp]


We then codon optomised this gene for Escherichia coli using the functionality built into [http://mrgene.com/desktopdefault.aspx/tabid-2/ the Mr Gene Page]

which gave us

ATGAACAAACCTCAGCTGCCTGACTTTATCCAAAACAAAATCGACCACTATATCGAGAACT ATTTCGACATTAACAAAAACGGCAAACACCTGGTGCTGGGCAAACAAGCATCACCGGATGA CATTATCCTGCAAAGCAACGACTATCTGGCCCTGGCTAATCACCCTCTGATCAAAGCTCGT CTGGCGAAAAGCCTGCTGGAAGAACAGCAATCCCTGTTTATGAGCGCCTCCTTTCTGCAAA ACGATTATGACAAACCGATGATTGAGAAACGCCTGGCCAAATTCACTGGTTTCGATGAATG CCTGCTGTCTCAGTCTGGTTGGAATGCCAATGTTGGTCTGCTGCAAACAATCTGTCAGCCT AACACGAACGTCTATATTGATTTCTTCGCCCACATGTCGCTGTGGGAAGGTGCTCGTTATG CTAATGCTCAGGCCCATCCGTTTATGCACAACAACTGTGACCATCTGCGTATGCTGATTCA GCGTCACGGTCCTGGTATTATCGTCGTGGACTCCATCTATTCTACCCTGGGGACCATTGCT CCACTGGCTGAACTGGTGAATATCAGTAAAGAGTTTGGGTGTGCCCTGCTGGTTGATGAAA GCCATTCTCTGGGAACCCATGGCCCGAACGGTGCCGGGCTGCTGGCGGAGCTGGGTCTGAC ACGTGAAGTTCACTTCATGACCGCTTCGCTGGCAAAAACATTCGCCTATCGTGCTGGTGCC ATTTGGTGTAACAACGAGGTTAATCGCTGTGTTCCGTTCATCTCTTATCCGGCCATCTTTA GCAGTACACTGCTGCCGTATGAAGCTGCTGGTCTGGAAACAACCCTGGAGATTATCGAGTC TGCCGATAACCGTCGTCAACATCTGGATCGTATGGCCCGTAAACTGCGTATTGGTCTGTCC CAACTGGGTCTGACAATTCGTAGCGAATCTCAGATTATTGGCCTGGAGACTGGTGACGAGC GTAATACCGAGAAAGTCCGTGATTATCTGGAGTCTAACGGCGTGTTTGGTAGCGTTTTTTG TCGTCCGGCAACCTCTAAAAACAAAAACATCATCCGCCTGTCCCTGAATAGTGATGTGAAT GATGAGCAGATCGCTAAAATCATTGAAGTCTGTTCGGATGCCGTGAATTATGGTGACTTCT ATTTCCGCTGA


We then added the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix prefix], promoter [http://partsregistry.org/Part:BBa_J23100 J23100], ribosome binding site [http://partsregistry.org/Part:BBa_B0034 B0034] before the CQSA sequence and the terminator [http://partsregistry.org/Part:BBa_B0015 B0015] and the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix suffix], after the sequence.

We then sent these details of to Geneart and got them to do the hard work of synthesising our part for us.

CqsAinE.coli.png

Once we received our DNA from synthesis we transformed it into E.coli and grew up some colonies. Unfortunately it is not currently possible to get parts synthesied and sent ready in the biobrick so we made an over night broth culture of a selection of colonies and then miniprepped them the following morning. We digested the resulting DNA with the restriction enzymes EcoR1 and Spe1 and ran a gel to ensure that we had the part sizes that we wanted, we got further confirmation using colony PCR with the [http://partsregistry.org/Part:BBa_G00100 VF2],[http://partsregistry.org/Part:BBa_G00101 VR] primer pair.

We used gel extraction to get the parts of the size we wanted and ligated them into [http://partsregistry.org/Part:pSB1C3 pSB1C3]
we did more confirmation using digestion + gel and colony PCR and sent the samples which gave the nicest looking gel to the registry.

As you might imagine this is a very simplified account, for the a week by week account of our summer in the lab look at our lab notebook.

Reference

F Duan, J C March (2010) Engineered bacterial communication prevents Vibrio cholerae virulence in an infant mouse model. PNAS 107-25