Team:Kyoto/Parts
From 2010.igem.org
(→BBa_K358012: SΔTMD1) |
(→Details) |
||
(11 intermediate revisions not shown) | |||
Line 7: | Line 7: | ||
====Details==== | ====Details==== | ||
=====[http://partsregistry.org/Part:BBa_K358000 BBa_K358000]: Lac promoter with GFP===== | =====[http://partsregistry.org/Part:BBa_K358000 BBa_K358000]: Lac promoter with GFP===== | ||
- | [[Image:KyotoPartsK358000.png| | + | [[Image:KyotoPartsK358000.png|800px|center]] |
The lac promoter will be repressed and not induce GFP in the presence of ''lac''I. We measured the strength of fluorescence with low copy plasmid vector, [http://partsregistry.org/Part:pSB4K5 pSB4K5]. | The lac promoter will be repressed and not induce GFP in the presence of ''lac''I. We measured the strength of fluorescence with low copy plasmid vector, [http://partsregistry.org/Part:pSB4K5 pSB4K5]. | ||
=====[http://partsregistry.org/Part:BBa_K358001 BBa_K358001]: Measurement Standard===== | =====[http://partsregistry.org/Part:BBa_K358001 BBa_K358001]: Measurement Standard===== | ||
- | [[Image:KyotoPartsK358001.png| | + | [[Image:KyotoPartsK358001.png|800px|center]] |
Constitutive promoter [http://partsregistry.org/Part:BBa_J23101 BBa_J23101] with GFP on low plasmid [http://partsregistry.org/Part:pSB4K5 pSB4K5]. | Constitutive promoter [http://partsregistry.org/Part:BBa_J23101 BBa_J23101] with GFP on low plasmid [http://partsregistry.org/Part:pSB4K5 pSB4K5]. | ||
=====[http://partsregistry.org/Part:BBa_K358004 BBa_K358004]: lambda lysis cassette[SRRz/Rz1]===== | =====[http://partsregistry.org/Part:BBa_K358004 BBa_K358004]: lambda lysis cassette[SRRz/Rz1]===== | ||
+ | [[Image:KyotoPartsK358004.png|800px|center]] | ||
This part causes cell death. It contains Holin/Antiholin, Endolysin and Rz/Rz1 genes. | This part causes cell death. It contains Holin/Antiholin, Endolysin and Rz/Rz1 genes. | ||
=====[http://partsregistry.org/Part:BBa_K358006 BBa_K358006]: lambda lysis cassette with terminator===== | =====[http://partsregistry.org/Part:BBa_K358006 BBa_K358006]: lambda lysis cassette with terminator===== | ||
- | [[Image:KyotoPartsK358006.png| | + | [[Image:KyotoPartsK358006.png|800px|center]] |
λ lysis cassette [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] with double terminator [http://partsregistry.org/Part:BBa_B0015 BBa_B0015]. | λ lysis cassette [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] with double terminator [http://partsregistry.org/Part:BBa_B0015 BBa_B0015]. | ||
=====[http://partsregistry.org/Part:BBa_K358010 BBa_K358010]: anti-killer gene with GFP===== | =====[http://partsregistry.org/Part:BBa_K358010 BBa_K358010]: anti-killer gene with GFP===== | ||
- | [[Image:KyotoPartsK358010.png| | + | [[Image:KyotoPartsK358010.png|800px|center]] |
It codes S<sub>ΔTMD1</sub> as the anti-killer gene, which is derived from λ phage DNA and against the lambda lysis cassette [http://partsregistry.org/Part:BBa_K358005 BBa_K358005]: the killer gene. | It codes S<sub>ΔTMD1</sub> as the anti-killer gene, which is derived from λ phage DNA and against the lambda lysis cassette [http://partsregistry.org/Part:BBa_K358005 BBa_K358005]: the killer gene. | ||
=====[http://partsregistry.org/Part:BBa_K358012 BBa_K358012]: S<sub>ΔTMD1</sub>===== | =====[http://partsregistry.org/Part:BBa_K358012 BBa_K358012]: S<sub>ΔTMD1</sub>===== | ||
- | [[Image:KyotoPartsK358012.png| | + | [[Image:KyotoPartsK358012.png|800px|center]] |
S gene, which is derived from lambda phage DNA, contains holin and antiholin. These proteins have three transmembrane domains. | S gene, which is derived from lambda phage DNA, contains holin and antiholin. These proteins have three transmembrane domains. | ||
This S<sub>ΔTMD1</sub>, however, lacks one of those domains and works as the anti-killergene against the lysis cassette, killer gene. | This S<sub>ΔTMD1</sub>, however, lacks one of those domains and works as the anti-killergene against the lysis cassette, killer gene. | ||
=====[http://partsregistry.org/Part:BBa_K358013 BBa_K358013]: S<sub>ΔTMD1</sub> with terminator===== | =====[http://partsregistry.org/Part:BBa_K358013 BBa_K358013]: S<sub>ΔTMD1</sub> with terminator===== | ||
+ | [[Image:KyotoPartsK358013.png|800px|center]] | ||
S<sub>ΔTMD1</sub> with double terminator. | S<sub>ΔTMD1</sub> with double terminator. | ||
=====[http://partsregistry.org/Part:BBa_K358015 BBa_K358015]: pLac+anti-killer gene===== | =====[http://partsregistry.org/Part:BBa_K358015 BBa_K358015]: pLac+anti-killer gene===== | ||
+ | [[Image:KyotoPartsK358015.png|800px|center]] | ||
The anti-killer gene with GFP [http://partsregistry.org/Part:BBa_K358010 BBa_K358010] is expressed under the control of lac promoter. | The anti-killer gene with GFP [http://partsregistry.org/Part:BBa_K358010 BBa_K358010] is expressed under the control of lac promoter. | ||
=====[http://partsregistry.org/Part:BBa_K358016 BBa_K358016]: pLac+anti-killer gene+pConst===== | =====[http://partsregistry.org/Part:BBa_K358016 BBa_K358016]: pLac+anti-killer gene+pConst===== | ||
+ | [[Image:KyotoPartsK358016.png|800px|center]] | ||
pLac+anti-killergene+pConst. | pLac+anti-killergene+pConst. | ||
=====[http://partsregistry.org/Part:BBa_K358017 BBa_K358017]: low promoter+anti-killer gene===== | =====[http://partsregistry.org/Part:BBa_K358017 BBa_K358017]: low promoter+anti-killer gene===== | ||
+ | [[Image:KyotoPartsK358017.png|800px|center]] | ||
Low constitutive promoter [J23105] and anti-killer gene [http://partsregistry.org/Part:BBa_K358010 BBa_K358010]. | Low constitutive promoter [J23105] and anti-killer gene [http://partsregistry.org/Part:BBa_K358010 BBa_K358010]. | ||
=====[http://partsregistry.org/Part:BBa_K358018 BBa_K358018]: Low promoter+anti-killergene+lacP===== | =====[http://partsregistry.org/Part:BBa_K358018 BBa_K358018]: Low promoter+anti-killergene+lacP===== | ||
+ | [[Image:KyotoPartsK358018.png|800px|center]] | ||
Constitutive promoter [http://partsregistry.org/Part:BBa_J23105 BBa_J23105] + anti-killergene [http://partsregistry.org/Part:BBa_358010 BBa_358010] + lactose promoter [http://partsregistry.org/Part:BBa_R0011 BBa_R0011]. | Constitutive promoter [http://partsregistry.org/Part:BBa_J23105 BBa_J23105] + anti-killergene [http://partsregistry.org/Part:BBa_358010 BBa_358010] + lactose promoter [http://partsregistry.org/Part:BBa_R0011 BBa_R0011]. | ||
- | =====[http://partsregistry.org/Part:BBa_K358019 BBa_K358019]: | + | =====[http://partsregistry.org/Part:BBa_K358019 BBa_K358019]: lysis cassette regulated by lacP===== |
+ | [[Image:KyotoPartsK358019.png|800px|center]] | ||
Lysis cassette[SRRz] is regulated by lactose promoter. Activating lactose promoter and expressing SRRz gene, it causes the cell lysis. So, lactose promoter must be repressed when transform this part. | Lysis cassette[SRRz] is regulated by lactose promoter. Activating lactose promoter and expressing SRRz gene, it causes the cell lysis. So, lactose promoter must be repressed when transform this part. | ||
Line 51: | Line 58: | ||
=====[http://partsregistry.org/Part:BBa_K358020 BBa_K358020]: Lysisbox===== | =====[http://partsregistry.org/Part:BBa_K358020 BBa_K358020]: Lysisbox===== | ||
+ | [[Image:KyotoPartsK358020.png|800px|center]] | ||
This part consists two module. Constantly expressed killer gene [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] by low promoter and regulatory expressed anti-killer gene with GFP by lac promoter. | This part consists two module. Constantly expressed killer gene [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] by low promoter and regulatory expressed anti-killer gene with GFP by lac promoter. | ||
=====[http://partsregistry.org/Part:BBa_K358021 BBa_K358021]: Lysisbox -module2-===== | =====[http://partsregistry.org/Part:BBa_K358021 BBa_K358021]: Lysisbox -module2-===== | ||
+ | [[Image:KyotoPartsK358021.png|800px|center]] | ||
Anti-killergene is induced constitutively and killergene is regulated by lactose promoter. | Anti-killergene is induced constitutively and killergene is regulated by lactose promoter. | ||
=====[http://partsregistry.org/Part:BBa_K358022 BBa_K358022]: lacP + SΔTMD1RRz===== | =====[http://partsregistry.org/Part:BBa_K358022 BBa_K358022]: lacP + SΔTMD1RRz===== | ||
+ | [[Image:KyotoPartsK358022.png|800px|center]] | ||
TMD1 is deleted from lysis cassette [SRRz]. | TMD1 is deleted from lysis cassette [SRRz]. | ||
=====[http://partsregistry.org/Part:BBa_K358023 BBa_K358023]: Lysisbox ver.2===== | =====[http://partsregistry.org/Part:BBa_K358023 BBa_K358023]: Lysisbox ver.2===== | ||
+ | [[Image:KyotoPartsK358023.png|800px|center]] | ||
This part is the same to BBa_K358020[Lysisbox], except for its constitutive promoter[BBa_J23100]. So, this plasmid is able to induce the killer gene more than the plasmid contains BBa_K358020. | This part is the same to BBa_K358020[Lysisbox], except for its constitutive promoter[BBa_J23100]. So, this plasmid is able to induce the killer gene more than the plasmid contains BBa_K358020. | ||
This part also contains SΔTMD1, anti-killergene, regulated by lacP. | This part also contains SΔTMD1, anti-killergene, regulated by lacP. | ||
When transform this part, you must induce the SΔTMD1 highly, do not repress lacP, so that the cell lysis will be prevented. | When transform this part, you must induce the SΔTMD1 highly, do not repress lacP, so that the cell lysis will be prevented. | ||
- | This is a long part and a lactose operon was deleted sometimes unexpectedly in our experiments. | + | This is a long part and a lactose operon was deleted sometimes unexpectedly in our experiments. We recomend you that it is better to set the cultural temperature at 30C and store this part as a plasmid, not a glycerole stock. |
=====[http://partsregistry.org/Part:BBa_K358024 BBa_K358024]: Lysisbox -module2- ver2===== | =====[http://partsregistry.org/Part:BBa_K358024 BBa_K358024]: Lysisbox -module2- ver2===== | ||
+ | [[Image:KyotoPartsK358024.png|800px|center]] | ||
This part is the same to BBa_K358021[Lysisbox -module2-], except for its constitutive promoter[BBa_J23101]. So, this part also induces constitutively SΔTMD1 gene, the anti-killer gene, and lambda lysis cassette[SRRz], the killer gene, is regulated by lacP. | This part is the same to BBa_K358021[Lysisbox -module2-], except for its constitutive promoter[BBa_J23101]. So, this part also induces constitutively SΔTMD1 gene, the anti-killer gene, and lambda lysis cassette[SRRz], the killer gene, is regulated by lacP. | ||
Since the lysis cassette is toxic to E.coli, you must repress the lacP when you transform it. Because of this, Top 10 isn't suitable, we used KRX. | Since the lysis cassette is toxic to E.coli, you must repress the lacP when you transform it. Because of this, Top 10 isn't suitable, we used KRX. |
Latest revision as of 22:47, 27 October 2010
Parts
Original
List
<groupparts>iGEM010 Kyoto</groupparts>
Details
[http://partsregistry.org/Part:BBa_K358000 BBa_K358000]: Lac promoter with GFP
The lac promoter will be repressed and not induce GFP in the presence of lacI. We measured the strength of fluorescence with low copy plasmid vector, [http://partsregistry.org/Part:pSB4K5 pSB4K5].
[http://partsregistry.org/Part:BBa_K358001 BBa_K358001]: Measurement Standard
Constitutive promoter [http://partsregistry.org/Part:BBa_J23101 BBa_J23101] with GFP on low plasmid [http://partsregistry.org/Part:pSB4K5 pSB4K5].
[http://partsregistry.org/Part:BBa_K358004 BBa_K358004]: lambda lysis cassette[SRRz/Rz1]
This part causes cell death. It contains Holin/Antiholin, Endolysin and Rz/Rz1 genes.
[http://partsregistry.org/Part:BBa_K358006 BBa_K358006]: lambda lysis cassette with terminator
λ lysis cassette [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] with double terminator [http://partsregistry.org/Part:BBa_B0015 BBa_B0015].
[http://partsregistry.org/Part:BBa_K358010 BBa_K358010]: anti-killer gene with GFP
It codes SΔTMD1 as the anti-killer gene, which is derived from λ phage DNA and against the lambda lysis cassette [http://partsregistry.org/Part:BBa_K358005 BBa_K358005]: the killer gene.
[http://partsregistry.org/Part:BBa_K358012 BBa_K358012]: SΔTMD1
S gene, which is derived from lambda phage DNA, contains holin and antiholin. These proteins have three transmembrane domains. This SΔTMD1, however, lacks one of those domains and works as the anti-killergene against the lysis cassette, killer gene.
[http://partsregistry.org/Part:BBa_K358013 BBa_K358013]: SΔTMD1 with terminator
SΔTMD1 with double terminator.
[http://partsregistry.org/Part:BBa_K358015 BBa_K358015]: pLac+anti-killer gene
The anti-killer gene with GFP [http://partsregistry.org/Part:BBa_K358010 BBa_K358010] is expressed under the control of lac promoter.
[http://partsregistry.org/Part:BBa_K358016 BBa_K358016]: pLac+anti-killer gene+pConst
pLac+anti-killergene+pConst.
[http://partsregistry.org/Part:BBa_K358017 BBa_K358017]: low promoter+anti-killer gene
Low constitutive promoter [J23105] and anti-killer gene [http://partsregistry.org/Part:BBa_K358010 BBa_K358010].
[http://partsregistry.org/Part:BBa_K358018 BBa_K358018]: Low promoter+anti-killergene+lacP
Constitutive promoter [http://partsregistry.org/Part:BBa_J23105 BBa_J23105] + anti-killergene [http://partsregistry.org/Part:BBa_358010 BBa_358010] + lactose promoter [http://partsregistry.org/Part:BBa_R0011 BBa_R0011].
[http://partsregistry.org/Part:BBa_K358019 BBa_K358019]: lysis cassette regulated by lacP
Lysis cassette[SRRz] is regulated by lactose promoter. Activating lactose promoter and expressing SRRz gene, it causes the cell lysis. So, lactose promoter must be repressed when transform this part.
To repress lactose promoter tightly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX, not TOP10. KRX has lacI in its genome and TOP10 hasn't (see genotype [http://www.promega.com/pnotes/94/14410_27/14410_27.pdf], [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29]).
[http://partsregistry.org/Part:BBa_K358020 BBa_K358020]: Lysisbox
This part consists two module. Constantly expressed killer gene [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] by low promoter and regulatory expressed anti-killer gene with GFP by lac promoter.
[http://partsregistry.org/Part:BBa_K358021 BBa_K358021]: Lysisbox -module2-
Anti-killergene is induced constitutively and killergene is regulated by lactose promoter.
[http://partsregistry.org/Part:BBa_K358022 BBa_K358022]: lacP + SΔTMD1RRz
TMD1 is deleted from lysis cassette [SRRz].
[http://partsregistry.org/Part:BBa_K358023 BBa_K358023]: Lysisbox ver.2
This part is the same to BBa_K358020[Lysisbox], except for its constitutive promoter[BBa_J23100]. So, this plasmid is able to induce the killer gene more than the plasmid contains BBa_K358020. This part also contains SΔTMD1, anti-killergene, regulated by lacP. When transform this part, you must induce the SΔTMD1 highly, do not repress lacP, so that the cell lysis will be prevented. This is a long part and a lactose operon was deleted sometimes unexpectedly in our experiments. We recomend you that it is better to set the cultural temperature at 30C and store this part as a plasmid, not a glycerole stock.
[http://partsregistry.org/Part:BBa_K358024 BBa_K358024]: Lysisbox -module2- ver2
This part is the same to BBa_K358021[Lysisbox -module2-], except for its constitutive promoter[BBa_J23101]. So, this part also induces constitutively SΔTMD1 gene, the anti-killer gene, and lambda lysis cassette[SRRz], the killer gene, is regulated by lacP. Since the lysis cassette is toxic to E.coli, you must repress the lacP when you transform it. Because of this, Top 10 isn't suitable, we used KRX. This is a long part and a lactose operon was sometimes deleted unexpectedly in our experiments. So, we find that to set the cultural temperature at 30C and store this part as a plasmid, not a glycerol stock, is the prefareble.
BioBrick
Parts
Name | Description | Well*1 | Plasmid | Resistance | Insert Length | Vector Length |
---|---|---|---|---|---|---|
[http://partsregistry.org/Part:BBa_J23100 BBa_J23100] | Constitutive promoter family member | 1-18-C | [http://partsregistry.org/Part:BBa_J61002 BBa_J61002] | Ampicillin | 35 | 2948 |
[http://partsregistry.org/Part:BBa_J23105 BBa_J23105] | Constitutive promoter family member | 1-18-M | [http://partsregistry.org/Part:BBa_J61002 BBa_J61002] | Ampicillin | 35 | 2948 |
[http://partsregistry.org/Part:BBa_J23116 BBa_J23116] | Constitutive promoter family member | 1-20-M | [http://partsregistry.org/Part:BBa_J61002 BBa_J61002] | Ampicillin | 35 | 2948 |
[http://partsregistry.org/Part:BBa_R0011 BBa_R0011] | Promoter (lacI regulated, lambda pL hybrid) | 1-6-G | [http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2] | Ampicillin | 55 | 2079 |
[http://partsregistry.org/Part:BBa_B0015 BBa_B0015] | Double terminator ([http://partsregistry.org/Part:BBa_B0010 BBa_B0010]-[http://partsregistry.org/Part:BBa_B0012 BBa_B0012]) | 1-23-L | [http://partsregistry.org/Part:BBa_pSB1AK3 BBa_pSB1AK3] | Ampicillin, Kanamycin | 129 | 3189 |
[http://partsregistry.org/Part:BBa_E0840 BBa_E0840] | GFP generator | 1-12-O | [http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2] | Ampicillin | 878 | 2079 |
[http://partsregistry.org/Part:BBa_E0240 BBa_E0240] | GFP generator | 1-12-M | [http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2] | Ampicillin | 876 | 2079 |
[http://partsregistry.org/Part:BBa_I20260 BBa_I20260] | Measurement Kit Test of [http://partsregistry.org/Part:BBa_J23101 BBa_J23101] | 2-17-F | [http://partsregistry.org/Part:BBa_pSB3K3 BBa_pSB3K3] | Kanamycin | 919 | 2750 |
[http://partsregistry.org/Part:BBa_J06702 BBa_J06702] | mCherry, bacterial with RBS and forward terminator | 2-8-E | [http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2] | Ampicillin | 869 | 2079 |
[http://partsregistry.org/Part:BBa_pSB3K3 BBa_pSB3K3] | RFP Coding Device | 1-5-E | [http://partsregistry.org/Part:BBa_pSB3K3 BBa_pSB3K3] | Kanamycin | 1069 | 2750 |
[http://partsregistry.org/Part:BBa_pSB4K5 BBa_pSB4K5] | Low copy BioBrick standard vector | 1-5-G | [http://partsregistry.org/Part:BBa_pSB4K5 BBa_pSB4K5] | Kanamycin | 1069 | 3419 |
[http://partsregistry.org/Part:BBa_pSB1C3 BBa_pSB1C3] | High copy BioBrick assembly plasmid | [http://partsregistry.org/Part:BBa_pSB1C3 BBa_pSB1C3] | Chloramphenicol | 2072 |
- *1 "1-18-C" means well 18C in [http://partsregistry.org/Help:Spring_2010_DNA_distribution Spring 2010 DNA Distribution Kit] Plate 1.
Primers
Name | Description | Sequence |
---|---|---|
[http://partsregistry.org/Part:BBa_G00100 BBa_G00100] | Forward primer for sequencing/amplifying BioBrick parts (VF2) | tgccacctgacgtctaagaa |
[http://partsregistry.org/Part:BBa_G00101 BBa_G00101] | Reverse primer for sequencing/amplifying BioBrick parts (VR) | attaccgcctttgagtgagc |