Team:SDU-Denmark/primers

From 2010.igem.org

(Difference between revisions)
(Primers)
 
(17 intermediate revisions not shown)
Line 1: Line 1:
-
== '''Primers''' ==
+
{{:Team:SDU-Denmark/css2}}
 +
{{:Team:SDU-Denmark/navi2}}
 +
<div id="subnavi">
 +
<div id="parts">
-
On this page we list all the primers we designed and used during the summer. Numbers in paranthesis is basic temperature (celcius)
+
= Our Parts =
 +
<groupparts>iGEM010 SDU-Denmark</groupparts>
-
'''''Primers for FlhDC master operon'''''
+
<br>
-
 
+
-
We needed to design 4 primers for this part. The FlhDC operon contains a PST1 restriction site, therefore we wanted to introduce a silent mutation, C --> T, at position 822 in the operon.
+
-
 
+
-
 
+
-
''Reverse primer w. mutation at position 13 (gene position 822):'' 5’-CATAAGCTGCGGTCAAAGCTGCCAA -3’ (59)
+
-
 
+
-
''Forward primer w. mutation at position 13 (gene position 822):'' 5’-TTGGCAGCTTTGACCGCAGCTTATG-3’        (59)
+
-
 
+
-
 
+
-
Lastly we added primers with prefix and suffix to the PCR result of the above:
+
 +
== '''Primers''' ==
 +
<p style="text-align: justify;">
 +
<br>
 +
On this page we list all the primers we designed and used during the summer. All primers were kindly provided by [http://www.dna-technology.dk/ DNA Technology]. <br><br>
-
[[FlhDC forward:]]
+
In the following, coding sequences are colored <span
 +
style="color: rgb(88, 115, 248);">blue</span>, restriction sites are colored <span
 +
style="color: rgb(80, 204, 56);">green</span> and nucleotides that are both are shown in <span
 +
style="color: rgb(255, 153, 0);">orange</span>.<br>
 +
The mutation sites in the FlhDC mutation primers are shown in <span
 +
style="color: rgb(205, 51, 204);">purple</span>.
 +
<br><br>
-
''Prefixprimer:'' 5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCATACCTCCGAGTTGCT-3' (Coding sequence (CS): 52) (Primer total (PT): 72)
+
<html>
-
+
<head>
-
[[FlhDC reverse:]]
+
</head>
 +
<body>
 +
<table style="text-align: left; width: 630px; height: 508px;"
 +
border="1" cellpadding="2" cellspacing="2">
 +
  <tbody>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Primer
 +
name</td>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 638px;">Sequence</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">Tm
 +
(C)</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC
 +
fw</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span
 +
style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">TCTAG</span><span
 +
style="color: rgb(88, 115, 248);"><span
 +
style="color: rgb(255, 153, 0);">A</span>TGCATACCTCCGAGTTGCTGAAA</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">88.3</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC
 +
rv</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span
 +
style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCTACTATT<span
 +
style="color: rgb(88, 115, 248);">AAACAGCCTGTACTCTCTGTTC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">88.3</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC
 +
mutation fw*</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-<span
 +
style="color: rgb(88, 115, 248);">TTGGCAGCTTTGCC<span
 +
style="color: rgb(204, 51, 204);">C</span>GCAGCTTATG</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC
 +
mutation rv*</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-<span
 +
style="color: rgb(88, 115, 248);">CATAAGCTGC<span
 +
style="color: rgb(204, 51, 204);">G</span>GGCAAAGCTGCCAA</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Photosensor
 +
fw</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span
 +
style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">TCTAG</span><span
 +
style="color: rgb(88, 115, 248);"><span
 +
style="color: rgb(255, 102, 0);">A</span>TGGTGGGACTTACGACCTC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">73.1</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Photosensor
 +
rv</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span
 +
style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">ACTAGT</span>A<span
 +
style="color: rgb(88, 115, 248);">TCAGAAGGTTTCCCAGTTCGCATC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">73.9</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB
 +
fw</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-<span
 +
style="color: rgb(80, 204, 56);"><span
 +
style="color: black;">GTTTCTTC</span>GAATTC</span>GCGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">TCTAG</span><span
 +
style="color: rgb(88, 115, 248);"><span
 +
style="color: rgb(255, 102, 0);">A</span>TGGCAGCCGGTGTCTTCAAGAG</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">73.1</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB
 +
rv</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-<span
 +
style="color: rgb(80, 204, 56);"><span
 +
style="color: black;">GTGTCTTC</span>CTGCAG</span>CGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">ACTAGT</span>A<span
 +
style="color: rgb(88, 115, 248);">CTAAATGGCATTGGGTGCAAACCATC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">72.4</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB
 +
2 fw**</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-CCGCT<span
 +
style="color: rgb(80, 204, 56);">TCTAG</span><span
 +
style="color: rgb(88, 115, 248);"><span
 +
style="color: rgb(255, 102, 0);">A</span>TGGCAGCCGGTGTCTTCAAGAG</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">68.1</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB
 +
2 rv**</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-CGCT<span
 +
style="color: rgb(80, 204, 56);">ACTAGT</span>A<span
 +
style="color: rgb(88, 115, 248);">CTAAATGGCATTGGGTGCAAACCATC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">65.6</td>
 +
    </tr>
 +
  </tbody>
 +
</table>
 +
<br>
 +
</body>
 +
</html>
-
''Suffixprimer:'' 5'-GTTTCTTCCTGCAGCGGCCGCTACTAGTAAACAGCCTGTACTCTCT-3' (CS: 45) (PT: 72)
 
 +
(*) Mutation primers were designed to introduce a silent mutation at position 822 in the operon to eliminate an illegal PstI site.<br>
 +
(**) Due to the formation of hairpin structures of primers ninaB fw and ninaB rv, new primers were designed containing only the innermost restriction sites (XbaI and SpeI).<br><br>
-
'''''SopIItrs'''''
+
</p>
-
''Forward primer:''  5’-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGTGGGACTTACGACC-3’ (CS: 50) (PT: 73)
 
-
''Reverse primer:''  5’-GTTTCTTCCTGCAGCGGCCGCTACTAGTATTAAAATGTTTCCCAGTTCT-3’ (CS: 70) (PT: 44)
+
</div>
 +
</div>

Latest revision as of 21:47, 27 October 2010