Happy Birthday, Paul!!

Himika

• Today I reran the transformation that I did yesterday July 5th where I constructed E0040 and pSB1AC3 and plate it on chloramphenicol.
• I also miniprepped the overnight cultures from last night. I13504 and I13507. The only cultures that grew were I13504 and I miniprepped 6 colonies from 1 plate.

• I also constructed E1010 with B0015.

• Procedure:
  • Insert
  • E1010 (pSB2k3) cut with EcoI/SpeI 5uL DNA
  • Buffer I was used 3.5uL
  • 0.5 uL of EcoRI and 0.5 uL of SpeI
  • 25.5 uL of water

• • Vector
  • B0015 (pSB1AK3) cut with EcoI/XbaI 5uL DNA
  • Buffer I was used 3.5uL
  • 0.5 uL of EcoRI and 0.5 uL of XbaI
  • 25.5 uL of water

• The vector was phosphatased with 5uL water, 4uL Buffer and 1uL phosphatase. The solution was left in 37 degree Celcius for 30 minutes and heat killed for 10 minutes in 65 degree Celcius.

• 5ul of the vector and the insert in a tube and add 10 ul of quick ligase buffer and 1 ul of quick ligase. The solution was left in room temperature for 10 minutes and transformed.

• I also did research on the ibpA/ ibpB pathways in order to present on to Dr. Schryvers on Friday.
• I also overnight cultured I13507 and plated the contstruct.

Raida

Today I worked on the Construction of R0040 (TetR promoter) in front of GFP construct (I13504) to test the reporter. This construction is working as our positive control of verifying that our GFP reporter works.

'Restriction Enzyme Digest of Insert (R0040)"

• 17.2 uL DNA
• 3.5 uL React 1 Buffer
• 0.5 uL EcoI, 0.5 uL SpeI
• 13.5 uL of Water

Restriction Enzyme Digest of Vector (I13504) Trial F

• 4.4 uL DNA
• 3.5 uL React 2 Buffer
• 0.5 uL EcoI, 0.5 uL XbaI
• 26.1 uL of Water

Restriction Enzyme Digest of Vector (I13504) Trial C

• 4.0 uL DNA
• 3.5 uL React 2 Buffer
• 0.5 uL EcoI, 0.5 uL XbaI
• 26.5 uL of Water

Restriction Enzyme Digest of Vector (I13504) Trial D

• 1.6 uL DNA
• 3.5 uL React 2 Buffer
• 0.5 uL EcoI, 0.5 uL XbaI
• 28.9 uL of Water

At the end of the heat killing process, I added

• 5 uL Antartic Phosphotase Buffer
• 5 uL of Water and
• 1 uL Antartic Phosphotase

It was placed in the water bath at 37°C for half an hour and then I ligated the insert and the vector using

• 5 uL of Insert and 5 uL of Vector
• 1 uL Quick Ligase
• 10 uL 2x Quick Ligase Buffer

The construct is left in the fridge overnight and transformation will be done tomorrow.

• Today I also worked on the Ethics component of our Project. In particular I looked at the "feasibility" of ynthetic Biology to be manipulated for Bioterrorism Purpose.

Jeremy

Today I ordered the primers for biobricking periplasmic RFP, plasmid switched last years I0500 into pSB1AK3 and overnights of construct I0500+B0034.

• Primers:
  • Forward Primer-GAATTCGCGGCCGCTTCTAGATGCAAAACGCC
  • Reverse Primer- GCTACTAGTATCACGACGTTGTAAAACGAC

• Plasmid Switch:
• Restriction Enzyme Digest of Insert C1 (I0500)
  • 7.5 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 23.0 uL of Water

• Restriction Enzyme Digest of Insert C2 (I0500)
  • 11.3 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 19.2 uL of Water

• Restriction Enzyme Digest of Insert C1 D (I0500)
  • 13.6 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 16.9 uL of Water

• Restriction Enzyme Digest of Insert C2 D (I0500)
  • 2.9 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 27.6 uL of Water

• Restriction Enzyme Digest of Vector (pSB1AK3)
  • 2.1 uL DNA
  • 3.5 uL React 1 Buffer
  • 0.5 uL EcoI, 0.5 uL PstI
  • 28.4 uL of Water

• Overnight
  • Same for each colony
    • -5mL LB Broth
    • -5uL Kanamycin Antibiotic
    • -inoculate with pipette tip

Non-wetlab tasks worked on today include researching wiki templates and designing t-shirt logo

Chris

Today, I received the list of contacts of possible sponsors from last year's iGEM team as well as some contacts from our lab technician Deirdre Lobb. From this list, I have added our own numbers and contacts to make a larger list of which to ask for sponsorship. I called the representative from Sigma Aldrich and left a message on Craig Andrew's voicemail. Since a message was left, I will follow up if no response is received by Friday. For the rest of the week, I plan to call two-three companies per day and then follow up with emails. I also looked at the plates of the plasmid switch that was done yesterday of B0034 from Kan to an ampicillin-kanamycin plasmid. There was no growth from the use of the enzymes EcoRI and PstI so it will be redone with different restriction enzymes either tomorrow or Thursday.

Alex

Today I obtained a list of media and marketing contacts from the previous team. I am going to wait until July 12th, when our media relations contacts return from vacation to start contacting the media outlets. Today the reverse primer for cpxp, which contains the entire biobrick suffix was created and ordered as well. Overnight colonies of the cpxp in the new pSB1AK3 plasmid were also created.

Patrick

Today, I helped make overnight colonies of the cpxP promoter, in pSB1AK3. As well, I continued looking into various wiki designs. There are a few design ideas floating out there that were very good, but it was suggested to us that we consider creating a layout that would complement the content in the wiki. A flashy website does nothing if it does not direct people quickly and effectively to all the important content in the wiki.

Back to square one.