Team:St Andrews/project/laboratory

From 2010.igem.org

(Difference between revisions)

Revision as of 22:21, 26 October 2010 (view source) D (Talk | contribs) (→The CAI-1 sender) ← Older edit		Latest revision as of 01:15, 28 October 2010 (view source) D (Talk | contribs) (→The CAI-1 sender)
(35 intermediate revisions not shown)
Line 11:		Line 11:
	== Overview ==		== Overview ==
-	The lab work has focused on constructing two main biobricks - the bistable switch and the CAI-1 sender.	+	This part of the lab work has focused on constructing two main biobricks - the bistable switch and the CAI-1 sender.
	===The bistable switch===		===The bistable switch===
		+	To acheive bistable expression patterns in quorum sensing systems, we planned to rearrange the Lux operon so that both LuxI and LuxR were downstream of the Lux promotor.
-	===The CAI-1 sender===	+	[[Image:LuxOpWiki.png|600px]]
-	This biobrick is essential to our project. CAI-1, the cholera-specific auto inducing molecule, can switch off the production of cholera toxin by V. cholerae when it is present in high concentrations. To make this biobrick the gene responsible for making the CAI-1 synthase (cqsa) was optimised for E. coli and then synthesised by geneart.
-	CQSA can be found [http://partsregistry.org/Part:BBa_K356001 here].
-	first we found the cholera gene for Vibrio Cholera autoinducer synthase which is as follows.	+	To do this we planned to use already available parts from the registry to assemble our bistable operon.
-	>vch:VCA0523 hypothetical protein; K10915 CAI-1 autoinducer synthase [EC:2.3.-.-] (N)<br/>	+	[[Image:BuildingOperon.png|600px]]
-	atgaacaagcctcaacttcctgattttattcagaacaagatagatcactatattgaaaat<br/>	+
-	tattttgatataaacaaaaacggtaaacaccttgtattgggtaaacaagccagccctgat<br/>	+
-	gacattattttgcaaagtaatgattatctcgcattggccaatcatccgttgatcaaagct<br/>	+
-	cgtttggcgaagtcattactggaagaacaacaaagcttatttatgtcagcctcatttcta<br/>	+
-	caaaatgactatgacaaacccatgattgagaaacgtctggctaagttcacaggctttgat<br/>	+
-	gaatgtctattatctcaatctggttggaatgcaaacgtcggtttattacaaaccatctgc<br/>	+
-	cagcccaatacgaatgtttacattgattttttcgcgcacatgtcgttatgggaaggggcg<br/>	+
-	cgctacgccaatgctcaggcgcatccttttatgcataataactgtgaccatttacgtatg<br/>	+
-	ctgattcaacgtcatggtcctgggatcattgtcgtagactcgatttacagcactttaggt<br/>	+
-	acgattgcaccgctagcggaactggtcaatatcagtaaagagtttggctgcgccttatta<br/>	+
-	gtcgatgaatcccactctttgggcacacatggccctaatggtgcaggtttattggcagaa<br/>	+
-	ttaggcctcactcgtgaagtgcattttatgaccgcaagtttggccaaaacctttgcttat<br/>	+
-	cgcgcaggagccatttggtgtaacaatgaagtgaatcgctgcgttccttttattagttat<br/>	+
-	ccagctatttttagttctactttgctgccttatgaagcggcaggattagaaacgacttta<br/>	+
-	gagattattgaatctgcggataatcgtcgtcagcatttagatcgtatggcaagaaaatta<br/>	+
-	cgcataggattatcccagctgggattaaccattcgcagtgaaagccaaattattggtcta<br/>	+
-	gaaacaggagatgaacgaaataccgaaaaagttcgggattatttagaaagtaatggagtg<br/>	+
-	tttggctcagtattctgccgcccggcaacttcaaagaataaaaacattattcgcttatca<br/>	+
-	ctcaatagtgatgtgaacgatgagcaaatcgccaaaataattgaggtttgctctgatgcg<br/>	+
-	gtcaactacggtgatttttattttcgttaa<br/>	+
-	[http://www.genome.jp/dbget-bin/www_bget?vch:VCA0523 the CAI-1 autoinducer synthase at genome.jp]	+
		+	We encountered problems with both 3 antibiotic assembly and In-Fusion PCR based assembly. These are detailed in the lab nootbook, but we eventually decided we had spent far too much time debugging our assembly methods and needed to move onto other areas of the project. The bistable operon was never finished.
-	we then codon optomised this gene for E.coli using the functionality built into [http://mrgene.com/desktopdefault.aspx/tabid-2/ the Mr Gene Page]	+	===Reference===
-	which gave us	+	EL Haseltine, FH Arnold (2007) - Implications of Rewiring Bacterial Quorum Sensing. Applied and Environmental Microbiology 74-2 437-445
-	ATGAACAAACCTCAGCTGCCTGACTTTATCCAAAACAAAATCGACCACTATATCGAGAACT<br/>	+	===[http://partsregistry.org/Part:BBa_K356000 The CAI-1 sender]===
-	ATTTCGACATTAACAAAAACGGCAAACACCTGGTGCTGGGCAAACAAGCATCACCGGATGA<br/>	+
-	CATTATCCTGCAAAGCAACGACTATCTGGCCCTGGCTAATCACCCTCTGATCAAAGCTCGT<br/>	+
-	CTGGCGAAAAGCCTGCTGGAAGAACAGCAATCCCTGTTTATGAGCGCCTCCTTTCTGCAAA<br/>	+
-	ACGATTATGACAAACCGATGATTGAGAAACGCCTGGCCAAATTCACTGGTTTCGATGAATG<br/>	+
-	CCTGCTGTCTCAGTCTGGTTGGAATGCCAATGTTGGTCTGCTGCAAACAATCTGTCAGCCT<br/>	+
-	AACACGAACGTCTATATTGATTTCTTCGCCCACATGTCGCTGTGGGAAGGTGCTCGTTATG<br/>	+
-	CTAATGCTCAGGCCCATCCGTTTATGCACAACAACTGTGACCATCTGCGTATGCTGATTCA<br/>	+
-	GCGTCACGGTCCTGGTATTATCGTCGTGGACTCCATCTATTCTACCCTGGGGACCATTGCT<br/>	+
-	CCACTGGCTGAACTGGTGAATATCAGTAAAGAGTTTGGGTGTGCCCTGCTGGTTGATGAAA<br/>	+
-	GCCATTCTCTGGGAACCCATGGCCCGAACGGTGCCGGGCTGCTGGCGGAGCTGGGTCTGAC<br/>	+
-	ACGTGAAGTTCACTTCATGACCGCTTCGCTGGCAAAAACATTCGCCTATCGTGCTGGTGCC<br/>	+
-	ATTTGGTGTAACAACGAGGTTAATCGCTGTGTTCCGTTCATCTCTTATCCGGCCATCTTTA<br/>	+
-	GCAGTACACTGCTGCCGTATGAAGCTGCTGGTCTGGAAACAACCCTGGAGATTATCGAGTC<br/>	+
-	TGCCGATAACCGTCGTCAACATCTGGATCGTATGGCCCGTAAACTGCGTATTGGTCTGTCC<br/>	+
-	CAACTGGGTCTGACAATTCGTAGCGAATCTCAGATTATTGGCCTGGAGACTGGTGACGAGC<br/>	+
-	GTAATACCGAGAAAGTCCGTGATTATCTGGAGTCTAACGGCGTGTTTGGTAGCGTTTTTTG<br/>	+
-	TCGTCCGGCAACCTCTAAAAACAAAAACATCATCCGCCTGTCCCTGAATAGTGATGTGAAT<br/>	+
-	GATGAGCAGATCGCTAAAATCATTGAAGTCTGTTCGGATGCCGTGAATTATGGTGACTTCT<br/>	+
-	ATTTCCGCTGA<br/>	+
		+	This biobrick is essential to our project. CAI-1, the cholera-specific auto inducing molecule, can switch off the production of cholera toxin by ''Vibrio cholerae'' when it is present in high concentrations. To make this biobrick the gene responsible for making the CAI-1 synthase (CqsA) was optimised for E. coli and then synthesised by geneart.
		+	CqsA can be found [http://partsregistry.org/Part:BBa_K356001 here].
-	We then added the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix prefix], promoter [http://partsregistry.org/Part:BBa_J23100 J23100], ribosome binding site [http://partsregistry.org/Part:BBa_B0034 B0034] before the CQSA sequence <br/>	+	First we found a sequence for the cholera gene for ''Vibrio cholerae'' autoinducer synthase.
-	and the terminator [http://partsregistry.org/Part:BBa_B0015 B0015] and the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix suffix], after the sequence. We then sent these details of to Geneart<br/> and got them to do the hard work of synthesising our part for us.	+
		+	[http://www.genome.jp/dbget-bin/www_bget?vch:VCA0523 the CAI-1 autoinducer synthase at genome.jp]
-	once we received our DNA from synthesis we transformed it into E.coli and grew up some colonies.<br>
-	Unfortunately it is not currently possible to get parts synthesied and sent ready in the biobrick <br>
-	so we made an over night broth culture of a selection of colonies and then miniprepped them the <br>
-	following morning. We digested the resulting DNA with the restriction enzymes EcoR1 and Spe1 and <br>
-	ran a gel to ensure that we had the part sizes that we wanted, we got further confirmation using <br>
-	colony PCR with the [http://partsregistry.org/Part:BBa_G00100 VF2],[http://partsregistry.org/Part:BBa_G00101 VR] primer pair
-	we used gel extraction to get the parts of the size we wanted and ligated them into [http://www.example.com psb1c3]<br>	+	We then codon optomised this gene for ''Escherichia coli'' using the functionality built into [http://mrgene.com/desktopdefault.aspx/tabid-2/ the Mr Gene Page]
-	bobs your mother fucking uncle, we have a biobrick.	+
-	== Week by week progress ==	+	which gave us
-		+
-	=== Week 28th June ===	+
-		+
-	Chose roles within the team	+
-		+
-	Initial lab preparations including making agar, LB broth, antibiotic stock solutions, copied out protocols.	+
-		+
-	We decided to run test transformations on parts that we would not be using (Part BBa_K09899), as a transformation failure for a critical part would be a problem	+
-		+
-	First transformation was carried on the 30th of June. This first step was to set the tone for the rest of the project. It failed. Part BBa_K09899. A possible cause of this may be the fact that there was no LB in the agar, this was due to a recent change away from ready mixed LB agar powder (read: we forgot to put nutrients in our media – facepalm).	+
-		+
-	=== Week 5th July ===	+
-		+
-	Transformed BBa_C0077 resulting in another failure, although this time we made up LB agar properly.	+
-		+
-	Possible cause – competent cells being used were over three years old. We decided to streak out some of the 2007 competent cells, along with glycerol stocks of regular DH5-alpha and a tube of competent cells that had been kept in the -20 freezer. The old competent cells turned out to be still alive and grew just as vigorously as the regular DH5-alpha and predictably the ones from the -20 were dead. We decided to make up our own competent cells while trying to transform more unuseful parts	+
-		+
-	Appeared to have successful transformation on the 8th of July. This was a transform of J01003 using the 2007 competent cells. Miniprep and nanodrop readings confirmed presence of plasmid DNA (47.5ng/ul).	+
-		+
-	We were trained on the safe use of ethidium bromide and the techniques of gel electrophoresis, in addition to the real blast from the past that was figuring out the imaging system software which was made in 1993, on similarly aged hardware.	+
-		+
-	Following an analytical scale restriction digest of our plasmid DNA using EcoRI and PstI, gel electrophoresis showed plasmid and insert bands for each different amount of DNA we used in the digest. Success!	+
-		+
-	=== Week 12th July ===	+
-		+
-	We began trying to transform parts that would be required for the bi-stable switch. Dave had a bad feeling about this.	+
-		+
-	These parts were BBa_F1610, BBa_C0062 and BBa_R0062	+
-		+
-	Transformation appeared to be successful (colonies observed) but this later proved to be incorrect.	+
-		+
-	After setting up an overnight culture in antibiotic broth, we miniprepped each part to obtain plasmid DNA. Nanodrop readings varied wildly (this was later discovered to be because the Nanodrop is a difficult beast. It requires scrubbing thoroughly with ethanol and reinitialising before every reading for it to even think of giving you an accurate result, Otherwise the DNA concentration will appear to drop by around 20% with each reading taken)	+
-		+
-	A restriction digest with EcoRI and PstI followed by gel electrophoresis showed…. “bugger all DNA”. This phrase became commonplace in the following weeks.	+
-		+
-	=== Week 19th July ===	+
-		+
-	In this week it was discovered that we had been growing mutants, the transformation was not successful and our “competent” cells were in fact, not at all competent. We then found that the calcium chloride concentration used to make our competent cells was incorrect due to a calculation error (biologists can’t handle moles!) so we decided to make up the solution again and make more competent cells. After growing our culture overnight, we diluted 500ul into 50ml LB broth and grew for 2 hours. The protocol suggested measuring the absorbance with the Nanodrop to determine whether or not the cells were in the exponential phase of growth, which we did.	+
-		+
-	The problem was, the nanodrop gave us a concentration tenfold lower than what we expected. On the second reading, we saw a negative absorbance reading. This was strange. We thought perhaps the cells were dying, but then the ever cynical Dave actually read the Nanodrop manual (unprecedented in this department I think) and found that the protocol gave absorbance values for a 10mm pathlength (the Nanodrop measures a 1mm path).	+
-		+
-	Learned how to use the SORVALL RC6 Plus SS34 centrifuge (the washing machine sized monster upstairs). Made more competent cells.	+
-		+
-	=== Week 23rd July ===	+
-		+
-	Made new TBE buffer because an unnamed member of the team disposed of the last lot.	+
-		+
-	We began having success using competent cells made with the addition of beta mercapto ethanol. This success was short lived, it also turns out that beta mercapto ethanol is toxic, highly pungent and must be diluted to a stock solution in a fume hood.	+
-		+
-	=== Week 30th July ===	+
-		+
-	Began experimenting with isopropanol miniprep extraction procedure.	+
-		+
-	=== Week 2nd August ===	+
-		+
-	tansformed B0015, E0240, R0062, C0062, B0032 and R0063.	+
-		+
-	we compared DNA extraction using isopropanol to extraction using quiagen columns and determined that the isopropanol extracts much more DNA but it as not all plasmid DNA.	+
-		+
-	A gel was run which showed plasmid but no part.	+
-		+
-	Began using NEB high efficiency turbo K12 competent E. coli. In general these made life much easier because they allow paarts to be transformed and miniprepped on the same day. They were also much more competent than the cells that we were using before.	+
-		+
-	=== Week 9th August ===	+
-		+
-		+
-	Carried out a restriction digest on the results from the isopropanol extraction of E0240, B0032, C0062, R0063, R0062.	+
-		+
-		+
-		+
-		+
-	Transformed C0061 into new turbo cells, also transformed PUC19 control plasmid.	+
-		+
-	Ran a 1.5% agarose gel of the restriction digests. Even though the isopropanol extracted DNA gave very high nanodrop readings, the bands on the gel weren't any brighter than usual. Insert bands of the correct size were also not observable. We concluded that the nanodrop could become wildly inaccurate at high DNA concentrations, and the isopropanol extraction technique increased the amount of genomic DNA contamination.  Decided it was best to verify insert size using PCR with VF2 and VR primers.	+
-		+
-	Ran another gel, this time with regular miniprep products. Observed some faint bands at the correct insert sizes, but not for all parts. Found that the registry quality control gels also had very faint bands for small parts. Decided to trust the registry and go ahead with assembly.	+
-		+
-	Colonies from C0061 transformation observed in ring shape, but did not extend to the edge (so unrelated to antibiotic plating) Attributed to cell plating technique. Decided to modify our spreading style, making the "star" in the centre first. Single colonies used to innoculate three 10ml tubes of broth.	+
-		+
-	Performed miniprep of C0061 transformed previously. "Gunk" observed in culture tubes. Possibly biofilm associated with overgrowth of our Turbo E. coli. Ran restriction digests and gel on this part. Perfectly sized, bright insert bands observed for two of the three cultures taken.	+
-		+
-	This was the week of the Open golf tournament so the university was shut down for part of the week while the golfers and their fans brought the town to a standstill.	+
-		+
-	=== Week 16th August ===	+
-		+
-		+
-	Began biobrick assembly using NEB assembly kit (3A method).	+
-		+
-	Transformed 5 &micro;l of the ligation into Turbo E. coli.	+
-		+
-	Primers; f,r,VR and VF2 arrived on the 17th of August allowing PCR based assembly to begin. The primers were all resuspended to make stock solutions.	+
-		+
-	On the 18th  PCR amplification was carried out with VF2 and VR primers on B0032	+
-		+
-	A miniprep was carried on the O/N cultures from the 16/8/10 assembly.	+
-		+
-	On the 19th 10mM stock solutions of dNTP stock solutions were made.	+
-		+
-	PCR amplification of R0063, R0062 and B0015 was carried out. the resulting DNA was of very low concentration.	+
-		+
-	We ran a gel on digests of the biobrick composites plus some individual parts, the gel was not positive.	+
-		+
-	We received a stern warning from Olivia that we should be more complete when completing our lab notebooks, a mental note of this information was made.	+
-		+
-	We digested B0015 from the PCR product. We also digested R0063, R0062, B0015, C0062, C0061, E00240 and confirmed our results on a gel. There was a cock up with the promoter digestions so they were repeated. We then began ligating the different parts of our bistable switch together.	+
-		+
-	=== Week 23rd August ===	+
-		+
-	Transformed our ligations, made an overnight, colony PCR (Drew Endy protocol)	+
-		+
-		+
-	PCR purification, gel - gave a negative result.	+
-		+
-	We had not been getting the DNA yields that we would have liked using the column miniprep technique so this week we experimented with ethanol precipitation using the following protocol	+
-		+
-		+
-	This protocol led to massively increased DNA yield however it appeared that the majority of it was not plasmid.	+
-		+
-	=== Week 30th August ===	+
-		+
-	We inoculated LB using a C0261 colony and allowed it to grow. we followed this with a miniprep.	+
-		+
-	This week our CqsA gene arrived from Mr Gene. We transformed some cells with it and then did a miniprep. We then digested the miniprep using the standard NEB protocol. This was followed by ligating the CqsA into the standard biobrick plasmid, pSB1C3 <br>	+
-	We also did some colony pcr and ran more gels.	+
-		+
-	=== Week 6th September ===	+
-		+
-	Began by preparing CqsA for sequencing with VR primer. Clontech's In Fusion enzyme arrived so began In-Fusion PCR assembly by trying to optimise the PCR reaction. The upstream part gave a specific band exactly where we needed it but the downstream part in the destination plasmid gave many different products. We attributed this to the extension time being too short. We forgot for a moment that we were expecting an amplicon of >3kb. Increased extension time and observed one bright specific band at just over 3kb.	+
-		+
-	=== Week 13th September ===	+
-		+
-	Attempted In Fusion reaction, after analysis on gel it appeared the DNA had vanished. This was perplexing. Re checked the pH of our TE buffer to make sure it was not destroying our DNA.  Retried In Fusion reaction.	+
-		+
-	==Protocols==	+
-		+
-	We used a number of protocols from OpenWetWare in addition to the manufacturer's recommended protocols for our materials.	+
-		+
-	===Cell Culture===	+
-	OpenWetWare [http://openwetware.org/wiki/Bacterial_cell_culture Bacterial Cell Culture]	+
-	===Transformation===	+
-		+
-	NEB Turbo Competent E. coli	+
-		+
-	Clontech Stellar Competent E. coli.	+
-		+
-	===Restriction Digest===	+
-		+
-	Promega Enzymes	+
-	NEB Biobrick Assembly Kit (Gingko Bioworks)	+	<p>ATGAACAAACCTCAGCTGCCTGACTTTATCCAAAACAAAATCGACCACTATATCGAGAACT
		+	ATTTCGACATTAACAAAAACGGCAAACACCTGGTGCTGGGCAAACAAGCATCACCGGATGA
		+	CATTATCCTGCAAAGCAACGACTATCTGGCCCTGGCTAATCACCCTCTGATCAAAGCTCGT
		+	CTGGCGAAAAGCCTGCTGGAAGAACAGCAATCCCTGTTTATGAGCGCCTCCTTTCTGCAAA
		+	ACGATTATGACAAACCGATGATTGAGAAACGCCTGGCCAAATTCACTGGTTTCGATGAATG
		+	CCTGCTGTCTCAGTCTGGTTGGAATGCCAATGTTGGTCTGCTGCAAACAATCTGTCAGCCT
		+	AACACGAACGTCTATATTGATTTCTTCGCCCACATGTCGCTGTGGGAAGGTGCTCGTTATG
		+	CTAATGCTCAGGCCCATCCGTTTATGCACAACAACTGTGACCATCTGCGTATGCTGATTCA
		+	GCGTCACGGTCCTGGTATTATCGTCGTGGACTCCATCTATTCTACCCTGGGGACCATTGCT
		+	CCACTGGCTGAACTGGTGAATATCAGTAAAGAGTTTGGGTGTGCCCTGCTGGTTGATGAAA
		+	GCCATTCTCTGGGAACCCATGGCCCGAACGGTGCCGGGCTGCTGGCGGAGCTGGGTCTGAC
		+	ACGTGAAGTTCACTTCATGACCGCTTCGCTGGCAAAAACATTCGCCTATCGTGCTGGTGCC
		+	ATTTGGTGTAACAACGAGGTTAATCGCTGTGTTCCGTTCATCTCTTATCCGGCCATCTTTA
		+	GCAGTACACTGCTGCCGTATGAAGCTGCTGGTCTGGAAACAACCCTGGAGATTATCGAGTC
		+	TGCCGATAACCGTCGTCAACATCTGGATCGTATGGCCCGTAAACTGCGTATTGGTCTGTCC
		+	CAACTGGGTCTGACAATTCGTAGCGAATCTCAGATTATTGGCCTGGAGACTGGTGACGAGC
		+	GTAATACCGAGAAAGTCCGTGATTATCTGGAGTCTAACGGCGTGTTTGGTAGCGTTTTTTG
		+	TCGTCCGGCAACCTCTAAAAACAAAAACATCATCCGCCTGTCCCTGAATAGTGATGTGAAT
		+	GATGAGCAGATCGCTAAAATCATTGAAGTCTGTTCGGATGCCGTGAATTATGGTGACTTCT
		+	ATTTCCGCTGA </p>
-	===Ligation===
-	NEB Biobrick Assembly Kit (Gingko Bioworks)	+	<p>We then added the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix prefix], promoter [http://partsregistry.org/Part:BBa_J23100 J23100], ribosome binding site [http://partsregistry.org/Part:BBa_B0034 B0034] before the CQSA sequence
		+	and the terminator [http://partsregistry.org/Part:BBa_B0015 B0015] and the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix suffix], after the sequence.
		+	</p>
-	===PCR===	+	We then sent these details of to Geneart and got them to do the hard work of synthesising our part for us.
-	OpenWetWare [http://openwetware.org/wiki/Knight:Colony_PCR Knight - Colony PCR]	+	[[Image:CqsAinE.coli.png|600px]]
-	NEB Taq	+	<p>Once we received our DNA from synthesis we transformed it into E.coli and grew up some colonies.
		+	Unfortunately it is not currently possible to get parts synthesied and sent ready in the biobrick
		+	so we made an over night broth culture of a selection of colonies and then miniprepped them the
		+	following morning. We digested the resulting DNA with the restriction enzymes EcoR1 and Spe1 and
		+	ran a gel to ensure that we had the part sizes that we wanted, we got further confirmation using
		+	colony PCR with the [http://partsregistry.org/Part:BBa_G00100 VF2],[http://partsregistry.org/Part:BBa_G00101 VR] primer pair. </p>
-	Finnzymes Phusion	+	We used gel extraction to get the parts of the size we wanted and ligated them into [http://partsregistry.org/Part:pSB1C3 pSB1C3]<br>we did more confirmation using digestion + gel and colony PCR and sent the samples which gave the nicest looking gel to the registry.<br>
-	===DNA Extraction===	+	As you might imagine this is a very simplified account, for the a week by week account of our summer in the lab look at our [https://2010.igem.org/wiki/index.php?title=Team:St_Andrews/project/laboratory/notebook lab notebook.]
-	Quiagen Miniprep	+
-	Isopropanol Extraction of small DNA fragments	+
-	===Annealing of Complementary Primers===	+	===Reference===
-	OpenWetWare [http://openwetware.org/wiki/Endy:Annealing_complementary_primers Endy - Annealing Complementary Primers]	+	F Duan, J C March (2010) Engineered bacterial communication prevents Vibrio cholerae virulence in an infant mouse model. PNAS 107-25

---

Latest revision as of 01:15, 28 October 2010

University of St Andrews iGEM 2010

Welcome!

University of St Andrews iGEM 2010

Our first year at iGEM!

Laboratory

Introduction

The synthetic biology portion of our project has provided the undergraduate members of our team with a rare opportunity to work in the lab for an extended period of time. Many of us have gained important skills such as learning to use our time efficiently, planning the use of limited materials and organising experiments effectively.

Overview

This part of the lab work has focused on constructing two main biobricks - the bistable switch and the CAI-1 sender.

The bistable switch

To acheive bistable expression patterns in quorum sensing systems, we planned to rearrange the Lux operon so that both LuxI and LuxR were downstream of the Lux promotor.

To do this we planned to use already available parts from the registry to assemble our bistable operon.

We encountered problems with both 3 antibiotic assembly and In-Fusion PCR based assembly. These are detailed in the lab nootbook, but we eventually decided we had spent far too much time debugging our assembly methods and needed to move onto other areas of the project. The bistable operon was never finished.

Reference

EL Haseltine, FH Arnold (2007) - Implications of Rewiring Bacterial Quorum Sensing. Applied and Environmental Microbiology 74-2 437-445

[http://partsregistry.org/Part:BBa_K356000 The CAI-1 sender]

This biobrick is essential to our project. CAI-1, the cholera-specific auto inducing molecule, can switch off the production of cholera toxin by Vibrio cholerae when it is present in high concentrations. To make this biobrick the gene responsible for making the CAI-1 synthase (CqsA) was optimised for E. coli and then synthesised by geneart. CqsA can be found [http://partsregistry.org/Part:BBa_K356001 here].

First we found a sequence for the cholera gene for Vibrio cholerae autoinducer synthase.

[http://www.genome.jp/dbget-bin/www_bget?vch:VCA0523 the CAI-1 autoinducer synthase at genome.jp]

We then codon optomised this gene for Escherichia coli using the functionality built into [http://mrgene.com/desktopdefault.aspx/tabid-2/ the Mr Gene Page]

which gave us

ATGAACAAACCTCAGCTGCCTGACTTTATCCAAAACAAAATCGACCACTATATCGAGAACT ATTTCGACATTAACAAAAACGGCAAACACCTGGTGCTGGGCAAACAAGCATCACCGGATGA CATTATCCTGCAAAGCAACGACTATCTGGCCCTGGCTAATCACCCTCTGATCAAAGCTCGT CTGGCGAAAAGCCTGCTGGAAGAACAGCAATCCCTGTTTATGAGCGCCTCCTTTCTGCAAA ACGATTATGACAAACCGATGATTGAGAAACGCCTGGCCAAATTCACTGGTTTCGATGAATG CCTGCTGTCTCAGTCTGGTTGGAATGCCAATGTTGGTCTGCTGCAAACAATCTGTCAGCCT AACACGAACGTCTATATTGATTTCTTCGCCCACATGTCGCTGTGGGAAGGTGCTCGTTATG CTAATGCTCAGGCCCATCCGTTTATGCACAACAACTGTGACCATCTGCGTATGCTGATTCA GCGTCACGGTCCTGGTATTATCGTCGTGGACTCCATCTATTCTACCCTGGGGACCATTGCT CCACTGGCTGAACTGGTGAATATCAGTAAAGAGTTTGGGTGTGCCCTGCTGGTTGATGAAA GCCATTCTCTGGGAACCCATGGCCCGAACGGTGCCGGGCTGCTGGCGGAGCTGGGTCTGAC ACGTGAAGTTCACTTCATGACCGCTTCGCTGGCAAAAACATTCGCCTATCGTGCTGGTGCC ATTTGGTGTAACAACGAGGTTAATCGCTGTGTTCCGTTCATCTCTTATCCGGCCATCTTTA GCAGTACACTGCTGCCGTATGAAGCTGCTGGTCTGGAAACAACCCTGGAGATTATCGAGTC TGCCGATAACCGTCGTCAACATCTGGATCGTATGGCCCGTAAACTGCGTATTGGTCTGTCC CAACTGGGTCTGACAATTCGTAGCGAATCTCAGATTATTGGCCTGGAGACTGGTGACGAGC GTAATACCGAGAAAGTCCGTGATTATCTGGAGTCTAACGGCGTGTTTGGTAGCGTTTTTTG TCGTCCGGCAACCTCTAAAAACAAAAACATCATCCGCCTGTCCCTGAATAGTGATGTGAAT GATGAGCAGATCGCTAAAATCATTGAAGTCTGTTCGGATGCCGTGAATTATGGTGACTTCT ATTTCCGCTGA

We then added the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix prefix], promoter [http://partsregistry.org/Part:BBa_J23100 J23100], ribosome binding site [http://partsregistry.org/Part:BBa_B0034 B0034] before the CQSA sequence and the terminator [http://partsregistry.org/Part:BBa_B0015 B0015] and the biobrick [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix suffix], after the sequence.

We then sent these details of to Geneart and got them to do the hard work of synthesising our part for us.

Once we received our DNA from synthesis we transformed it into E.coli and grew up some colonies. Unfortunately it is not currently possible to get parts synthesied and sent ready in the biobrick so we made an over night broth culture of a selection of colonies and then miniprepped them the following morning. We digested the resulting DNA with the restriction enzymes EcoR1 and Spe1 and ran a gel to ensure that we had the part sizes that we wanted, we got further confirmation using colony PCR with the [http://partsregistry.org/Part:BBa_G00100 VF2],[http://partsregistry.org/Part:BBa_G00101 VR] primer pair.

We used gel extraction to get the parts of the size we wanted and ligated them into [http://partsregistry.org/Part:pSB1C3 pSB1C3]
we did more confirmation using digestion + gel and colony PCR and sent the samples which gave the nicest looking gel to the registry.

As you might imagine this is a very simplified account, for the a week by week account of our summer in the lab look at our lab notebook.

Reference

F Duan, J C March (2010) Engineered bacterial communication prevents Vibrio cholerae virulence in an infant mouse model. PNAS 107-25