From 2010.igem.org

(Difference between revisions)

Latest revision as of 04:48, 27 October 2010

notebook

Week 1	06-14-2010	06-15-2010	06-16-2010	06-17-2010	-
Week 2	-	-	-	-	06-25-2010
Week 3	06-28-2010	06-29-2010	06-30-2010	07-01-2010	07-02-2010
Week 4	-	07-06-2010	07-07-2010	07-08-2010	07-09-2010
Week 5	07-12-2010	07-13-2010	07-14-2010	07-15-2010	07-16-2010
Week 6	07-19-2010	07-20-2010	07-21-2010	-	07-23-2010
Week 7	07-26-2010	07-27-2010	07-28-2010	07-29-2010	07-30-2010
Week 8	08-02-2010	08-03-2010	08-04-2010	08-05-2010	08-06-2010
Fall Work	08-26-2010	08-27-2010	08-28-2010	08-29-2010	-

06-14-2010 [top]

Summary

Miraculin and brazzein constructs due to arrive on Wednesday from Mr. Gene.
Wintergreen and Banana parts obtained from registry and transformed.

BioBrick Transformation
BioBrick parts from the 2010 iGEM kit were transformed and grown in highly competent TURBO bacteria.

Wintergreen Scent Pathway:

BBa_J45700 - entire pathway, Ampicillin
BBa_J45004 - BSMT1 only, Ampicillin
(Not in 2010 BB Kit: BBa_J45017 - PchB, PchA)

Banana Scent Pathway:

BBa_J45250 - ATF3 + Promoter, Ampicillin?
BBa_J45014 - ATF3 only, Ampicillin
(Not in BB 2010 Kit: BBa_J45400 - BAT2 and THI3)

06-15-2010 [top]

Summary

Primers designed and ordered for promoter and terminator from pORE vector.
Transformation of registry parts was low quantity.
Miraculin and Brazzein were codon-optimized.
RNA was extracted from valencia oranges.

Primer Designs for Agrobacterium Vector

Primers were designed to amplify from the Expression Series pORE Agrobacterium plasmid (e3) 1)the pENTcup2 promoter, 2) the tNOS stop sequence, 3) the tNOS stop sequence + additional stop codon and 4) the pHLP promoter.

Note: the NOSterm_BB_R primer works for both tNOS and tNOS+STOP codon sequences.

   pENTcup2_BB_F
   CCTTTCTAGAGGGATCTTCTGCAAGCATCT

   pENTcup2_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTTCCGGTGGGTTTTGAGGT

   STOP_NOSterm_BB_F
   CCTTTCTAGATGAGATCGTTCAAACATTTGG

   NOSterm_BB_F
   CCTTTCTAGAGATCGTTCAAACATTTGGCA

   NOSterm_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTGATCTAGTAACATAGATGACA

   pHPL_BB_F
   CCTTTCTAGAAACGTGGATACTTGGCAGTG

   pHPL_BB_R
   AAGGCTGCAGCGGCCGCTACTAGTCTTTTGAGCTTAGAGGTTTTT

BioBrick Transformation

Colonies were observed after overnight culture growth, but in low quantities.
- J45700 and J45004 (both Wintergreen Pathway) showed minimal number of colonies on both 10μL and 100μL cultures.
- J45250 and J45014 (both Banana Pathway) showed no colonies on either the 10μL or 100μL cultures.

Codon Usage in Arabidopsis
Using http://gcua.schoedl.de/

Valencene Extraction
Used RNeasy Plant Mini Kit to extract RNA from the flavedo of an Organic Valencia Orange.

Location of Flavedo: click to enlarge

06-16-2010 [top]

Summary

Miniprep of Wintergreen registry parts.
Digestion and gel purification of Wintergreen parts.

MiniPrep

MiniPrep of Wintergreen parts from Registry (J45004 and J45700) following Qiagen MiniPrep protocol. MiniPrep three samples of each part.
- DNA concentrations:

         J45004-1: 59.1 ng/μL
         J45004-2: 72.9 ng/μL
         J45004-3: 88.1 ng/μL
 
         J45700-1: 146.7 ng/μL
         J45700-2: 187.4 ng/μL
         J45700-3: 175.5 ng/μL

Digestion with Enzymes

For J45004, we added: 9μL DNA, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast).
For J45700, we added 5μL DNA, 4μL H2O, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast).
We let mixtures sit for 30 minutes due to the use of xbaI restriction enzyme (slow). After the 30 minutes, we added 2.5μL dye to each mix.

Gel

We loaded 12.5μL of 1kb ladder to well 1 of the gel (numbered left to right). We then loaded 12.5μL of J45004-1, J45004-2, and J45004-3 to wells 2,3, and 4, respectively. We loaded J45700-1, J45700-2, J4500-3 in wells 5, 6, and 7, respectively (see images below for well locations).
Ran on 1% agarose gel.

Gel Purification
click to enlarge

click to enlarge

06-17-2010 [top]

Summary

PCR of pORE parts: pENTCUP2, NOSt, NOSt+STOP
Digest of pORE parts

PCR Purification of pORE Vector Parts

Following QIAgen PCR Purification Kit Protocol the following PCR products were purified:

pENTCUP2 Promoter - 16.1 ng/μL
NOSterminator Sequence - 76.3 ng/μL
STOP codon + NOSterminator Sequence - 76.5 ng/μL

To do: follow up with restriction digest ✓ and Agarose gel ✓ to confirm PCR and PCR purification.

Restriction Digest and Agarose Gel
Restriction Digest reactions were set up as follows:

pENTCUP2 Promoter:

27μL PCR product
3μL Loading Buffer w/ dye
1μL Xba1 Fast Enzyme
1μL Pst1 Fast Enzyme

NOSterm and NOSterm + STOP:

9μL PCR product
1μL Loading Buffer w/ dye
0.5μL Xba1 Fast Enzyme
0.5μL Pst1 Fast Enzyme

BioBrick Plasmid V0120 (Ampicillin Resistance):

3μL DNA
1μL Loading Buffer w/ dye
6μL diH₂O
0.5μL Xba1 Fast Enzyme
0.5μL Pst1 Fast Enzyme

Reactions were allowed to proceed for 45 minutes at 37°C.

06-25-2010 [top]

Summary

Trouble with ligations
Troubleshooting different enzymes showed a non-functional XbaI
Digest of parts using slow XbaI

We began this week trying to ligate the pENTCUP2 promoter, NosT terminator, and NosT terminator plus stop codon into the V0120 vector. We ran into several problems during this process.

We had previously digested the three inserts as well as the promoter with XbaI and PstI fast digest enzymes, ligated, and transformed the ligated vectors into e. coli. Unfortunately, we did not find any colonies of cells after over 14 hours of incubation. Furthermore, on Friday June 18th, after digesting all three inserts and vector and running them on a gel, we did not see any NosT + stop DNA. Therefore, on Monday June 21, we began by digesting more NosT + stop and V0120 vector with xba1 and pstI fast digestive enzymes. The gel showed DNA length to be consistent with the given parts. (See gel below)

click to enlarge

Gel Lanes (both inserts and vector were digested with xbaI/pstI): 1. 1kb plus ladder. 2. pENTCUP2 promoter. 3. NosT terminator. 4. NosT + stop terminator 5. V0120 digested.

click to enlarge

Gel Lanes (both inserts and vector were digested with xbaI/pstI): 1. 1kb plus ladder. 2. NosT + stop terminator. 3. V0120 digested.

Upon gel extraction and gel purification, we ligated the inserts into the vectors with a 2:1 insert to vector ratio (previously we had been using a 4:1 insert to vector ratio). We then transformed the plasmids into e.coli and plated; no colony growth was seen the next morning.

We used Team Vector's R3 ligation (they have successfully ligated and transformed) as a positive control. However, the bacteria containing the ligated plasmids were plated on Ampicillin plates, which turned out to be the wrong resistance.

Troubleshooting

In order to get a better understanding of the problem with our ligation, we ran a diagnostic gel with the V0120 backbone and vectors B15 and B21.

click to enlarge

   Gel Lanes: 
   1. 1 kb plus ladder
   2. v0120 undigested
   3. v0120 eco/spe
   4. v0120 eco/xba
   5. v0120 spe/pstI
   6. v0120 xba/pst
   7. v0120 ecoRI
   8. v0120 xba1
   9. v0120 pstI
   10. v0120 spe
   11. blank
   12. B15 (StrepII tag) xba/pstI
   13. B21 (YFP) xba/pstI

We concluded from the gel that xba1 is the problem in our ligation step. The pattern of bands in the v0120 xba1/pstI digest along with the v0120 xba1 digest illustrate that xba1 is not cutting correctly.

We began a slow enzyme xba1/pstI digest on Friday, but the gel was run in mismatching buffers (TAE and TBE).

click to enlarge

Gel Lanes (inserts and vector digested with xba1/pstI): 1. 1 kb plus ladder. 2. pENTCUP2 3. NosT 4. NosT & stop 5. v0120

Valencene Digestion of PCR products aimed to isolate valencene gene showed very short length on gel. These are not the correct size and are most likely primer dimers. PCR products were digested with EcoRI/SpeI. 5 μL of each sample was digested with pstI to be sure that the pstI site was in the sequence of DNA.

click to enlarge

Gel Lanes: 1. 1 kb plus ladder. 2. Flavedo EcoRI/SpeI. 3. Flavedo PstI 4. Open 5. Fruit EcoRI/SpeI. 6. Fruit pstI

06-28-2010 [top]

Summary

Miniprep of Miraculin and Brazzein parts
Digest, ligation and transformation of pORE parts into a BioBrick backbone (V0120)

Miniprep of Miraculin and Brazzein Constructs

Protocol used was from the Qiagen Miniprep Kit

Nanodrop Specs
Name	Concentration (ng/μL)
Miraculin 1	159.6
Miraculin 2	182.2
Brazzein 1	91.2
Brazzein 2	33.7

DTL (Digestion, Ligation, Transformation) of The Big Three (pENTCUP2, NOSt, NOSt + STOP)

Digestion Reactions
	pENTCUP2	NOSt	NOSt+STOP	B15
DNA	4	7	12	7
NEB Buffer 3 (10x)	2	2	2	2
diH₂O	10	7	2	7
Xba1	1	1	1	1
Pst1	1	1	1	1
BSA (10x)	2	2	2	2

Digestions were left for 1:30 at 37°C
2.2 μL of DNA Loading Buffer were added to each reaction and loaded onto a 1% Agarose gel (TAE buffer). Gel was ran at 125 V for 30 min.

click to enlarge

Lanes
Lane	Contents
Lane 1	1KB Plus Ladder
Lane 2	pENTCUP2
Lane 3	NOSt
Lane 4	NOSt+STOP
Lane 5	B15 digested
Lane 6	B15 undigested

The undigested B15 in lane 6 appears as two bands on account of supercoiling of the B15 plasmid.
Bands in lanes 2 - 5 were cut out and purified using a Qiagen Gel Purification kit
- The gel purification was done with 300 μL Buffer PB and 400 μL Buffer QG

Nanodrop Specs
Name	Concentration (ng/μL)
pENTCUP2	16.5
NOSt	10.2
NOSt+STOP	0.4
B15 (backbone vector)	10.9

Note the very low concentration of NOSt+STOP. It is uncertain as to what caused such a concentration, but transformation proceeded anyways with max volume
The ligation reactions were preformed at at 2:1 (insert to backbone) Molar Ratio
- The sole exception being the NOSt+STOP ligation, in which the lack of product forced us to use 1.8 ng DNA

Ligation Reactions
	pENTCUP2	NOSt	NOSt+STOP	Control
Insert	1	1	1	1
Vector	2	2	2	2
Buffer (10x)	5	5	5	5
Ligase	1	1	1	1
H₂O	11	11	0	12

Ligation reactions were preformed as per the Silver Lab ligation protocol (with the differences in concentration and ratio made as per the table above).
Transformations to E. Coli were preformed as per the Silver lab transformation protocol with ampicillin plates.
Plates were left overnight.

06-29-2010 [top]

Summary

Digestion, Ligation and Transformation of pORE parts.
Digestion, Ligation and Transformation of Miraculin and Brazzein into BioBrick.

Results of ligation and transformation of The Big Three (pENTCUP2, NosT, NosT + stop) with B15 backbone into E.coli

A few colonies were found on the pENTCUP2 + Backbone plate, NosT + stop and backbone plate, and b15 backbone control plate. Colonies were picked from the plates and placed in 3ml of LB and agarose in a culture tube. The tubes were placed in the 37°C shaker for 8 hours. 2 mL of LB+AMP was added to the cultures, bring the total volume to 5 mL of LB+AMP. Cultures were left to shake overnight.

DLT of the Sweethearts - Miraculin and Brazzein (and B21)

Digestion Reactions
	Miraculin	Brazzein	B21
DNA	6	11	7
FD Buffer (10x)	2	2	2
diH₂O	10	5	9
EcoRI	1	1	1
SpeI	1	1	1

Placed in 37°C waterbath for 20 minutes.

Digestion Gel

click to enlarge

   Gel Lanes:
    1. 1 kb plus ladder
    2. Miraculin digested with EcoRI/SpeI
    3. Brazzein digested with EcoRI/SpeI
    4. B21 digested with EcoRI/SpeI
    5. 1 kb plus ladder

Nanodrop Specs (from gel purification)
Name	Concentration (ng/μL)
Miraculin	9.5
Brazzein	10.2
B21 Vector (V0120)	8.4

Ligation Reactions
	Miraculin	Brazzein	Control
Insert	3.5	0.75	0
Vector	6	6	6
Buffer (10x)	2	2	2
Ligase	1	1	1
H₂O	6.5	10.25	0

The ligation of Miraculin was done at a 3:1 ratio (insert to vector) due to its larger size (~700 bp)
The ligation of Brazzein was done at a 2:1 ratio due to its smaller size (~200 bp)

06-30-2010 [top]

Summary

Started cultures of Miraculin and Brazzein.
Miniprepped pORE parts.
Digestion of pORE parts to confirm correct insert.

Miraculin, Brazzein

Colonies did grow!
Started 5 mL cultures of Miraculin and Brazzein biobrick constructs (5 cultures each)

The Big Three

Began miniprep of cultures of pENT, NOSt+STOP and our Control (for experimental purposes)

*OD specs*
	OD
pENTCUP2 #1	248.5 ng/μL
pENTCUP2 #2	447.7 ng/μL
NosT + stop #1	427.7 ng/μL
NosT + stop #2	303.9 ng/μL
Control #1	366.8 ng/μL
Control #2	359.2 ng/μL

Digestion

We digested miniprep samples with xbaI/pstI fast digest enzymes in order to determine if ligation was successful.

*Digestion Reactions*
	Control #1	Control #2	pENTCUP2 #1	pENTCUP2 #2	NosT & stop #1	NosT & stop #2
DNA	2	2	3	2	2	3
Green FD buffer	2	2	2	2	2	2
diH₂O	14	14	13	14	14	13
xbaI	1	1	1	1	1	1
pstI	1	1	1	1	1	1

Digestion mixes were placed in 37°C water bath for approximately 1 hr.

Big Three PCR digestion

We simultaneously digested PCR purified pENTCUP2, NosT, and NosT & stop inserts with xbaI/pstI. This way if the above digestion showed the ligation of the inserts into v0120 backbone was not successful, we can continue with these inserts.

*Digestion Reactions*
	pENTCUP2	NosT	NosT & stop
DNA	4	7	2
Green FD buffer	2	2	2
diH₂O	12	9	14
xbaI	1	1	1
pstI	1	1	1

Placed in 37°C water bath for 20 minutes.

07-01-2010 [top]

Summary

Miniprep of Miraculin and Brazzein.
RNA extraction from Valencia orange, second attempt, using Qiagen RNeasy kit.

We made glycerol stocks from our Miraculin & v0120 and Brazzein & v0120. 333 μL cultures with 666μL glycerol and placed in -80°C freezer.

We miniprepped our Miraculin and v0120 cultures and our Brazzein and v0120 cultures. Miniprep done per Qiagen protocol.

ODs

Sample	OD
Miraculin and v0120 #1	171.3ng/μL
Miraculin and v0120 #2	202.0ng/μL
Miraculin and v0120 #3	106.4ng/μL
Miraculin and v0120 #4	115.6ng/μL
Miraculin and v0120 #5	40.5ng/μL
Brazzein and v0120 #1	41.7ng/μL
Brazzein and v0120 #2	42.8ng/μL
Brazzein and v0120 #3	38.8ng/μL
Brazzein and v0120 #4	0ng/μL
Brazzein and v0120 #5	N/A

Valencia orange surgery (part two)

RNA extraction per Qiagen RNAeasy protocol.
- We made sure to apply RNAzap (RNAase-free) spray to all surfaces and instruments.

ODs

Sample	OD
RNA Flavedo extraction #1	93.1ng/μL
RNA Flavedo extraction #2	28.7ng/μL

07-02-2010 [top]

Summary

Confirmation gels of NOSt+STOP part and reverse transcriptase reaction.
- NOSt+STOP ligation was confirmed.
- RT reaction of Valencia RNA failed.

NosT + stop and v0120 We ran an xba/pstI fast enzyme digest on our miniprepped NosT + stop and v0120 plasmid. The gel was consistent with a successful ligation. (See lanes 7-10 in gel image below).

click to enlarge

Valencene After running a reverse transcriptase reaction on our RNA extraction, we ran PCR on the cDNA with Valencene specific primers. The gel did not show the proper fragment length of the Valencene gene. Instead, it appears primer dimers formed again. (See lanes 2-5)

click to enlarge

07-06-2010 [top]

Summary

Plan of attack for tagging Miraculin and Brazzein with YFP-2x and StrepII tags.
Miraculin, Brazzein and YFP (B21) Digestion, Ligation and Transformation.

Tagging Miraculin and Brazzein with YFP and StrepII tags

Tag: -E--N--X--STREP/YFP--S--N--P-
Insert: E--N--X--Miraculin/Brazzein--S--N--P-

The 'tag' biobrick (either YFP or STREPII) was used as the vector; Miraculin and Brazzein were used as the insert.
Tags were ligated to both the N- and C-terminal of Miraculin and Brazzein

click to enlarge

*BioBrick Digest Combinations*
	Vector	Insert
N-Terminus	Spe1/Pst1	Xba1/Pst1
C-Terminus	EcoR1/Xba1	EcoR1/Spe1

*Digestion Reactions*
	B21 S/P	B21 E/X	Miraculin X/P	Miraculin E/S	Brazzein X/P	Brazzein E/S
diH₂O	13	13	11	11	0	0
Green FD buffer (10x)	2	2	2	2	2	2
DNA	3	3	5	5	16	16
Spe1	1	-	-	1	-	1
PstI	1	-	1	-	1	-
EcoR1	-	1	-	1	-	1
Xba1	-	1	1	-	1	-

Gel The gel showed DNA fragments consistent with Miraculin and Brazzein. The digestion of B21 appeared to be succesful, but the DNA sequence cut out was too small to see on the gel.

click to enlarge

   Gel Lanes:
    1. 1 kb plus ladder
    2. B21 speI/pstI
    4. B21 ecoRI/xbaI
    6. Miraculin xbaI/pstI
    8. Miraculin ecoRI/speI
    10. Brazzein xbaI/pstI
    12. Brazzein ecoRI/pstI
    14. 1kb plus ladder

We extracted the circled bands and gel purified the gel per the Qiagen gel purification protocol.

   ODs of gel purified DNA
    B21 speI/pstI:  15.9 ng/μL
    B21 ecoRI/xbaI:  11.0 ng/μL
    Miraculin xbaI/pstI:  9.7 ng/μL
    Miraculin ecoRI/speI:  7.1 ng/μL
    Brazzein xbaI/pstI:  2.6 ng/μL
    Brazzein ecoRI/pstI:  5.0 ng/μL

Ligation We did 6 different ligation reactions. The chart below shows the different reactions. Ligation reactions were left at room temperature for 15 minutes.

*Ligation Reactions*
	Miraculin xbaI/pstI w/ B21 speI/pstI	Miraculin ecoRI/speI w/ B21 ecoRI/xbaI	Brazzein xbaI/pstI w/ B21 speI/pstI	Brazzein ecoRI/speI w/ B21 ecoRI/xbaI	Control B21 speI/pstI	Control B21 ecoRI/xbaI
DNA Insert	2	3	3	1	0	0
T4 DNA ligase buffer (10x)	2	2	2	2	2	2
diH₂O	12	9	11	11	14	12
T4 DNA ligase	1	1	1	1	1	1
DNA Backbone	1	1	1	1	1	1

Transformation We mixed 5μL ligation mix with 15μL Turbo e. coli cells. These were placed in ice for 30 minutes and then heat shocked in 42°C water bath for 30 seconds. The cells were placed back on ice for 2 minutes. 170 μL of SOC broth was added to each Eppendorf tube. The transformed e. coli were then plated on LB Ampicillin plates and left in the 37°C incubator overnight.

07-07-2010 [top]

Sequencing V0120 Plasmids containing the pENTCUP2 plant promoter, NOS terminator and NOS terminator + STOP were sent to GENEWIZ for sequencing. Sequencing results are expected tomorrow.

Cultures 5 mL cultures were started from the YFP-2x construct from yesterday, as well as the B15 (StrepII) tag.

2 x B21 E/X + Brazz E/S - C-Terminus
2 x B21 S/P + Brazz X/P - N-Terminus
2 x B21 E/X + Mira E/S - C-Terminus
2 x B21 S/P + Mira X/P - N-Terminus
2 x B15 Plate #1
2 x B15 Plate #2

Cultures were placed in a 37°C incubator and left to shake overnight.

Primers for Wintergreen pathway parts

J45004

Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)

J45017

Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'

07-08-2010 [top]

Summary

Confirmation digest of Flavor proteins with YFP tags
Ligated Flavor Proteins with StrepII tag

Re-submitted sequencing order, with correct primers, to GeneWiz
Did a confirmation digest of the Miraculin/Brazzein + YFP-2x constructs

Ladder
B15 E/X
B15 S/P
Mira+YFP N1
Mira+YFP N2
Mira+YFP C1
Mira+YFP C2
Brazz+YFP N1
Brazz+YFP N2
Brazz+YFP C1
Brazz+YFP C2
Ladder

- It appears that the digestion of Mira+YFP C2 (lane 7) did not work properly. This could have been the result of choosing a bacterial colony that was the result of contamination, or from simply an error in the digestion step.

Transformed two pDUET expression vectors for Miniprep

Ligated Miraculin/Brazzein to a StrepII tag

*Ligation Reactions*
	Miraculin xbaI/pstI w/ B15 speI/pstI	Miraculin ecoRI/speI w/ B15 ecoRI/xbaI	Brazzein xbaI/pstI w/ B15 speI/pstI	Brazzein ecoRI/speI w/ B15 ecoRI/xbaI	Control B15 speI/pstI	Control B15 ecoRI/xbaI
DNA Insert	3	4	4	2	0	0
T4 DNA ligase buffer (10x)	2	2	2	2	2	2
diH₂O	11	10	10	12	14	14
T4 DNA ligase	1	1	1	1	1	1
DNA Backbone	3	3	3	3	3	3

We then transformed the ligated plasmids into Turbo e. coli and plated the bacteria on Amp plates. Plates were left in the 37°C incubator overnight.

07-09-2010 [top]

Summary

Ligation of flavor proteins with YFP tags into DUET vector

Ligation of Brazzein & Miraculin (w/ YFP tags) into DUET vector

Digestion

*Digestion Reactions*
	Brazzein & YFP C EcoRI/SpeI	Brazzein & YFP N EcoRI/SpeI	Miraculin & YFP C EcoRI/SpeI	Miraculin & YFP N EcoRI/SpeI	V24 NotI/SpeI	NosT & Stop EcoRI/XbaI
DNA	2	2	2	3	5	2
FD Buffer (10x)	2	2	2	2	2	2
diH₂O	14	14	14	13	11	14
Enzyme	1	1	1	1	1	1
Enzyme	1	1	1	1	1	1

We are adding the NosT & stop to the C-terminus of the Miraculin and Brazzein constructs. This whole construct will then be ligated into the V24 DUET vector.

Gel

   Gel Lanes:
    1. 1kb plus ladder
    3. Miraculin & YFP N-terminus ecoRI/SpeI
    5. Miraculin & YFP C-terminus ecoRI/SpeI 
    7. Brazzein & YFP N-terminus ecoRI/SpeI 
    9. Brazzein & YFP C-terminus ecoRI/SpeI 
   11. V24 NotI/SpeI
   13. NosT & Stop EcoRI/XbaI

07-12-2010 [top]

Summary

Miniprep and digest tagged flavor proteins

We removed our cultures of e. coli containing Miraculin/Brazzein C/N YFP and NosT & Stop and e. coli containing Miraculin/Brazzein and StrepII tag from the 37°C shaker.

Glycerol stocks were made (666 μL glycerol and 333 μL cells)

Miniprep

   ODs
    Miraculin C YFP and NosT & Stop 1: 414.4 ng/μL
    Miraculin C YFP and NosT & Stop 2: 304.0 ng/μL
    Miraculin N YFP and NosT & Stop 1: 428.6 ng/μL
    Miraculin N YFP and NosT & Stop 2: 421.0 ng/μL
    Brazzein C YFP and NosT & Stop 1: 572.8 ng/μL
    Brazzein C YFP and NosT & Stop 2: 580.3 ng/μL
    Brazzein N YFP and NosT & Stop 1: 348.9 ng/μL
    Brazzein N YFP and NosT & Stop 2: 639.6 ng/μL

    Miraculin N StrepII 1: 888.6 ng/μL
    Miraculin N StrepII 2: 614.4 ng/μL
    Miraculin C StrepII 1: 677.1 ng/μL
    Miraculin C StrepII 2: 222.1 ng/μL
    Brazzein N StrepII 1: 352.6 ng/μL
    Brazzein N StrepII 2: 331.6 ng/μL
    Brazzein C StrepII 1: 209.3 ng/μL
    Brazzein C StrepII 2: 346.4 ng/μL

Digestion

*Digestion Reactions*
	Miraculin C YFP NST	Miraculin N YFP NST	Brazzein N YFP NST	Brazzein C YFP NST
diH₂O	14	14	13.5	14.3
Green FD buffer (10x)	2	2	2	2
DNA	2	2	2.5	1.7
NotI	1	1	1	1
SpeI	1	1	1	1

Gel

   Gel Lanes:
    1. 1 kb plus ladder
    3. Miraculin N YFP NST (NotI/SpeI)
    5. Miraculin C YFP NST (NotI/SpeI)
    7. Brazzein N YFP NST (NotI/SpeI)
    9. Brazzein C YFP NST (NotI/SpeI)
    11. 1 kb plus ladder

Gel purify per Qiagen protocol

   ODs
    Brazzein C YFP NST (NotI/SpeI): 6.3 ng/μL
    Brazzein N YFP NST (NotI/SpeI): 8.5 ng/μL
    Miraculin C YFP NST (NotI/SpeI): 3.6 ng/μL
    Miraculin N YFP NST (NotI/SpeI): 12.8 ng/μL

07-13-2010 [top]

Summary

Ligation of YFP tagged flavor proteins into v24 pETDUET vector

Ligation in V24

Ligation of of Mira/Brazz+YFP+NOSt+STOP Construct into the V24 pETDUET vector for expression of proteins in IPTG inducible bacteria.

*Ligation Reactions*
	Mira N + V24	Mira C + V24	Brazz N + V24	Brazz C + V24	Control
diH₂O	7	1	6	4	12
T4 DNA ligase buffer (10x)	2	3	2	2	2
DNA Insert	5	20	6	8	0
DNA Backbone	5	5	5	5	5
T4 DNA ligase	1	1	1	1	1

5μL of Ligation reactio

07-14-2010 [top]

Summary

Added Stop codon to flavor proteins tagged with StrepII

Miniprep of STOP + V0120 part

   Nanodrop O/D's:
   STOP V0120 1-1: 134.4 ng/μL
   STOP V0120 1-2: 98.7 ng/μL
   STOP V0120 2-1: 55.2 ng/μL
   STOP V0120 2-2: 121.8 ng/μL

DTL of StrepII+Mira/Brazz with STOP codon

To insert a STOP codon to the end of our Mira/Brazz StrepII constructs, we used the STOP+V0120 BioBrick as our vector (EcoR1/Xba1 digest) and our Miraculin/Brazzein construct as our insert (EcoR1/Spe1 digest)
Construct DNA used was from Miniprep 1 (Box 4)
~1μg of DNA was digested in each reaction

*Digestion Reactions*
	Mira Strep N	Mira Strep C	Brazz Strep N	Brazz Strep C	STOP+V0120 BioBrick
diH₂O	15	14.5	13.5	11.5	6
Green FD buffer (10x)	2	2	2	2	2
DNA	1	1.5	2.5	4.5	10
EcoR1	1	1	1	1	1
Xba1	-	-	-	-	1
Spe1	1	1	1	1	-

Digestion of Mira/Brazz+Strep and STOP codon BioBrick

Circled bands were cut and gel purified

   Miraculin + StrepII = 730 bp
   Brazzein + StrepII = 230 bp
   STOP + V0120 = 3200 bp

1kb Plus Ladder
Miraculin C Strep E/S
Miraculin N Strep E/S
Brazzein C Strep E/S
Brazzein N Strep E/S
STOP + V0120 E/X
1kb Plus Ladder

   Gel Purification Specs
   Mira N StrepII E/S: 3.0 ng/μL
   Mira C StrepII E/S: 2.8 ng/μL
   Brazz N StrepII E/S: 3.4 ng/μL
   Brazz C StrepII E/S: 1.3 ng/μL
   STOP+V0120 BB E/X: 7.1 ng/μL

Ligation of Mira/Brazz+Strep and STOP codon BioBrick

*Ligation Reactions*
	Mira StrepII N + STOP w/ v0120 BB	Mira StrepII C + STOP w/ v0120 BB	Brazz StrepII N + STOP w/ v0120 BB	Brazz StrepII C + STOP w/ v0120 BB	Control STOP w/ v0120 BB
diH₂O	4.5	4.5	9	5	12
T4 DNA ligase buffer (10x)	2	3	2	2	2
DNA Insert	7.5	7.5	2	6	0
DNA Backbone	5	5	6	6	5
T4 DNA ligase	1	1	1	1	1

Transformation

Transformed 5 μL ligation mix with 15 μL TURBO e. coli cells
Plated on LB + Amp plates and left in 37°C incubator overnight

07-15-2010 [top]

Summary

Flavor proteins tagged with YFP confirmed in v24 DUET vector

Miraculin/Brazzein YFP N/C and NosT + Stop in V24 DUET vector

Made glycerol stocks (666 μL glycerol and 333 μL cells)

   ODs
    Miraculin C1: 168.8 ng/μL
    Miraculin C2: 67.2 ng/μL
    Miraculin N1: 183.0 ng/μL
    Miraculin N2: 173.5 ng/μL
    Brazzein N1: 54.8 ng/μL
    Brazzein N2: 79.0 ng/μL
    Brazzein C1: 161.4 ng/μL
    Brazzein C2: 125.0 ng/μL

*Confirmation Digestion Reactions*
	Mira N1	Mira N2	Mira C1	Mira C2	Brazz N1	Brazz N2	Brazz C1	Brazz C2
diH₂O	13.5	13.5	13.5	11	11	11	13.5	13
Green FD buffer (10x)	2	2	2	2	2	2	2	2
DNA	2.5	2.5	2.5	5	5	5	2.5	3
PstI	1	1	1	1	1	1	1	1
Xba1	1	1	1	1	1	1	1	1

Confirmation Digest of Mira/Brazz + YFP + NOSt + STOP in V24 Expression Vector

Ladder
Mira N1
Mira N2
Mira C1
Mira C2
Brazz N1
Brazz N2
Brazz C1
Brazz C2
Ladder

The N & C designation corresponds to the terminus upon which the YFP was fused.

   Expected Lengths
    Miraculin + YFP + NOSt + STOP = 700 + 1500 + 250 = 2450 bp
    Brazzein + YFP + NOSt + STOP = 300 + 1500 + 250 = 2050 bp
    V24 = 5200 bp

07-16-2010 [top]

Summary

Retry adding stop codon to flavor proteins tagged with StrepII
PCR of valencene gene failed

Did minipreps of the Mira/Brazz + Strep constructs. All constructs had failed to ligate.

Ran PCR of Valencene gene from extracted genomic DNA. Followed with PCR purification
Re-digested STOP+V0120 BioBrick, gel purified. Gel Purification failed, no DNA was extracted.

07-19-2010 [top]

DTL of Mira/Brazz+StrepII into STOP+V0120

Digestion

*Digestion Reactions*
	Stop v0120 1	Stop v0120 2
DNA	10	8
FD Buffer (10x)	2	2
diH₂O	6	8
Xba1	1	1
EcoRI	1	1

*Ligation Reactions*
	Mira N + Stop	Mira C + Stop	Brazz N + Stop	Brazz C + Stop	Stop only Control
diH₂O	3	3	11	6	14
T4 DNA ligase buffer (10x)	2	3	2	2	2
DNA Insert	11	11	3	8	0
DNA Backbone	3	3	3	3	3
T4 DNA ligase	1	1	1	1	1

Confirm of valencene PCR (failed)

Re-do of Valencene PCR (failed)

07-20-2010 [top]

Summary

IPTG induced and tested for YFP expression in bacteria

Picked colonies from Mira/Brazz StrepII STOP constructs
- Only Mira N and Brazz C had colonies, 2 mL cultures were started and will be miniprepped to confirm ligation at the end of today.
Diluted Mira/Brazz YFP expression colonies 25:1 in LB+AMP for eventual IPTG induction. Will culture @ 37°C for 1 hour then take O/D's.

07-21-2010 [top]

Summary

Ligated Strep tagged flavor proteins with stop codon

Miraculin N/Brazzein C StrepII & Stop

We ran a confirmation digest on the miniprepped Miraculin N StrepII & Stop and the Brazzein C StrepII & Stop. We digested the samples with XbaI/PstI. We should have used NotI/SpeI in this digest if we planned on inserting into V24 pETDUET vector.
- We digested 558 ng of Mira N1, 516 ng Mira N2, 540 ng Brazz C1, and 551 ng Brazz C2 in 20 μL digestion reactions.

We also ran undigested samples of all four to help determine why the other ligations (Brazz N and Mira C) did not work.
- We ran 279 ng of Mira N1, 258 ng Mira N2, 270 ng of Brazz C1, and 275.5 ng Brazz C2.

Gel

   Gel Lanes:
    1. 1kb plus ladder
    2. Mira N1 XbaI/PstI
    3. Mira N2 XbaI/PstI
    4. Brazz C1 XbaI/PstI
    5. Brazz C2 XbaI/PstI
    6. 1kb plus ladder
    7. Mira N1 undigested
    8. Mira N2 undigested
    9. Brazz C1 undigested
   10. Brazz C2 undigested

Gel shows bands consistent with successful ligation!

Gel extraction and purification of Miraculin, StrepII & Stop insert and Brazzein, StrepII & Stop insert.

   ODs
    Mira N1: 5.4 ng/μL
    Mira N2: 3.1 ng/μL
    Brazz C1: 6.1 ng/μL
    Brazz C2: 10.1 ng/μL

Ligation/Transformation of Mira/Brazz+StrepII

Our Miraculin and Brazzein constructs with StrepII tags (pre-cut with EcoR1/Spe1) were re-ligated to STOP+V0120 backbone

*Ligation Reactions*
	Insert DNA	BackBone DNA
Mira N	9 ng	49.5 ng
Mira C	22.4 ng	49.5 ng
Brazz N	37.4 ng	49.5 ng
Brazz C	14.3 ng	53.4 ng
Control	0 ng	53.4 ng

NEB T4 Ligase was used for all reactions

Digestion & Gel Purification of V24

The pETDUET Expression Vector, V24, was digested with Not1/Spe1 for later use.

1039.9 ng of DNA was digested in both reactions

Digestion reactions were run on a 1% Agarose gel at 125V for 30 min

   OD's
    V24-1 N/S: 13.5 ng/μL
    V24-2 N/S: 17.9 ng/μL

07-23-2010 [top]

Summary

Genomic DNA extraction attempt from Valencia Oranges

Genomic DNA extraction from Valencia Oranges

We used Qiagen DNeasy Plant Mini Kit
100 mg (wet) sample from Flavedo tissue of orange
Samples had little DNA content and dirty 260/280

   ODs
    Orange genomic DNA 1-1: 1.8ng/μL (260/280: .82)
    Orange genomic DNA 1-2: 1.1ng/μL (260/280: .68)
    Orange genomic DNA 2-1: 2.6ng/μL (260/280: .85)
    Orange genomic DNA 2-2: 2.1ng/μL (260/280: .89)

PCR ran with between 40ng and 95ng of genomic DNA
Extension time increased to 1:30

Mira/Brazz StrepII & Stop

Miniprepped per Qiagen protocol and made glycerol stocks

07-26-2010 [top]

Summary

Confirm ligation of stop codon with Strep tagged flavor proteins
PCR attempt for Valencene gene from Valencia orange genomic DNA failed

Digested miniprepped Mira/Brazz+StrepII+STOP constructs with Not1/Spe1 for ligation confirmation: failed
Ran PCR product of Valencia Orange genome to confirm: failed

Digested Mira/Brazz+StrepII constructs EcoRI/SpeI, STOP+V0120 EcoRI/XbaI

   Digestion Reactions
    Mira N:  888ng
    Mira C:  888ng
    Brazz N: 993ng
    Brazz C: 1032ng
    STOP:    781ng x 2 (max DNA available)

07-27-2010 [top]

Summary

Ligation of Strep tagged flavor proteins and stop into V0120
PCR attempt of Valencene gene from Valencia orange genomic DNA using Pfx polymerase

Ligation of Mira/Brazz + StrepII to STOP + V0120

Insert to Backbone ration of 3:1

   Miraculin: 34ng
   Brazzein:  11ng
   Backbone:  50ng

Ligations were transformed, plated onto LB+AMP and left overnight @ 37°C

PCR of Valencene using Pfx Polymerase

Pfx polymerase was rumoured to be more accurate at PCR from genomic DNA

   Specs:
    DNA 1-1: 1.8 ng/μL
    DNA 1-2: 1.1 ng/μL
    DNA 2-1: 2.6 ng/μL
    DNA 2-2: 2.2 ng/μL

1μL of each DNA sample was used for PCR. Cycling procedure can be found here: http://www.invitrogen.com/etc/medialib/en/filelibrary/pdf.Par.79411.File.dat/platinumpfx_pps.pdf

Mira/Brazz+StrepII+STOP confirmation digest

   Digested DNA:
    MN2: 211.2 ng
    MC2: 190.2 ng
    BN2:  184.4 ng
    BC2:  219.2 ng

Digestions were run on a 1% agarose gel at 125V for 30 minutes.

Ladder
MN2
MC2
BN2
BC2
Ladder

07-28-2010 [top]

Summary

PCR of Wintergreen pathway parts
Gel of Valencene PCR products shows failed PCR attempt

PCR Confirmation

Ran gel to confirm Valencene PCR: failed

Ladder
DNA 1-1
DNA 1-2
DNA 2-1
DNA 2-2
Ladder

The numerical differentiation refers to the specific genomic DNA sample

PCR of Wintergreen parts

Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway

   Primers: 
    J45004_F
    Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
    J45004_R
    Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
    J45017_F
    Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
    J45017_R
    Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'

The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.

An annealing temperature of 62°C for 15s was used. Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb

PCR Confirmation

Ladder
J45004 PCR #1
J45004 PCR #2
J45017 PCR #1
J45017 PCR #2
Ladder

Both J45004 PCR reactions appear to have worked, with product at the expected size of 1.1 kb.
The J45017 PCR reactions appears to have amplified some of the wrong sequence, as suggested by the short DNA fragment. However, the longer ~2 kb fragment in PCR #1 does appear to be around the correct length.

07-29-2010 [top]

Summary

Miniprep strep tagged flavor proteins in V0120
Gel extract wintergreen pathway parts

Minipreps

Miniprep of Mira/Brazz+StrepII+STOP in V0120

Gel Extraction

Gel extraction of J45017:

Ladder
Mira N N/S
Mira C N/S
Brazz N N/S
Brazz C N/S
J45004 X/P
B21 X/P
J45017 undigested
Ladder

07-30-2010 [top]

Summary

Ligated StrepII tagged proteins into V24 backbone
Ligated cut J45004 into V0120 backbone

Ligations were plated and left @ 37°C O/N.

08-02-2010 [top]

Summary

Ligation of wintergreen parts into v0120 backbone

DTL of Mira/Brazz+StrepII+Stop into V24

Digested 1 microgram of DNA for each insert and for V24 backbone.
- Digested inserts and backbone with NotI/SpeI
Gel extracted and purified bands indicated in image below
Ligated insert into 50ng of V24 backbone with a 3:1 insert to backbone ratio
Transformed and plated on LB+AMP plates and left in 37°C incubator overnight

DTL of Wintergreen pathway

Digested 400ng of J45004, 20ng of J45017, and 1 microgram of B21 (for v0120 backbone)
- Digested J45004, J45017, and B21 BB with XbaI/PstI
PCR purified digested inserts
Gel extracted and purified B21 BB (see gel image below)
Ligated inserts into 50ng of B21 v0120 backbone with a 3:1 insert to backbone ratio
- Transformed and plated on LB+AMP plates and left in 37°C incubator overnight

Gel Purification

Ladder
Mira N SS
Mira C SS
Brazz N SS
Brazz C SS
V24 N/S
B21 X/P
Ladder

Gel bands indicated were cut and purified from the gel.

08-03-2010 [top]

Summary

Miniprepped wintergreen pathway and strep tagged flavor proteins

Colonies were obtained from all ligations; 5mL cultures were started, left ~5hrs @ 37°C
Glycerol stocks were made (666μL glycerol: 333μL cells; 50% glycerol final)
Miniprepped per Qiagen protocol

   ODs
    004-1: 95.5 ng/μL
    004-2: 124.5 ng/μL
    017-1: 109.7 ng/μL
    017-2: 77.5 ng/μL
    Miraculin N+Strep+Stop: 61.5 ng/μL
    Miraculin C+Strep+Stop: 78.5 ng/μL
    Brazzein N+Strep+Stop: 83.4 ng/μL
    Brazzein C+Strep+Stop: 99.4 ng/μL

08-04-2010 [top]

Summary

Wintergreen pathway ligations into v0120 did not work. Retry ligations.

Confirmation Digests

Ran confirmation digests of miniprepped J45004-1, J45004-2, J45017-1, J45017-2
- Digested approximately 500ng with xbaI/speI
Ran confirmation digests of miniprepped Miraculin N strep+stop and V24, Miraculin C strep+stop and V24, Brazzein N strep+stop and V24, Brazzein C strep+stop and V24.
- Digested 400-500ng with notI/speI

Retry Ligating j45004 and v0120

Used PCR purified J45004 that had been previously digested with xbaI/pstI
Used v0120 from Team Vector that they had digested with xbaI/pstI and used in a successful ligation
3:1 insert to backbone ration used in ligation
- 52ng of insert and 50ng v0120 backbone
- J45004 insert is 1100 bp
Transformed and plated on LB+Amp plates and left overnight

08-05-2010 [top]

Summary

Transformation of J45004
5μL of registry DNA was transformed with 15μL TURBO cells; mixture was plated on LB+AMP and left to grow O/N

08-06-2010 [top]

Summary

Confirm wintergreen part ligation into v0120
Transform strep tagged flavor proteins into E45 expression E. Coli

Confirmation Digest of J45004

J45004 in V0120 backbone; digested ~500ng DNA with Xba1/Pst1

1 kb Ladder (Invitrogen)
004-1
004-2
004-3
Ladder

Backbone: 3.2 kb; Insert: 1.1 kb

Analysis
Both the backbone and the insert in lane 1 look like the correct length (3.2 and 1.1 kb respectively). Lane two consists of a backbone of the correct length, but the insert appears to be ~1.5 kb, too long for the J45004 BioBrick part. Lane 3 appears undigested; we are uncertain as to why.

Transformation of Mira/Brazz StrepII constucts into E45

100-200 ng of construct DNA was transformed with 15μL of E45 expression E. Coli; transformation procedure was followed; transformed cells were plated on LB+AMP and left to grow O/N

Transformations: Mira N1 Mira N2 Mira C1 Mira C2 Brazz N1 Brazz N2 Brazz C1 Brazz C2

08-26-2010 [top]

Overnight cultures of E. Coli transformed with StrepII-tagged Miraculin and Brazzein under an inducible promoter were back-diluted to an optical-density of 0.1.
Cultures were allowed to reach an O/D of 0.5
IPTG was added to a final concentration of 100μM
After 3 hours, cultures were spun down, the supernatant removed and the bacteria frozen overnight at -80°C

08-27-2010 [top]

The IPTG induced bacteria were lysed with B-PER II lysis reagent via standard protocols
Total lysate was run on a 4-12% Bis-Tris NuPAGE gel and transferred to a PVDF membrane
Blocking buffer added, gel was left at 4°C overnight

08-28-2010 [top]

Blot was exposed to a StrepII-tag Antibody, HRP conjugate from Novagen
Left overnight at 4°C

08-29-2010 [top]

Blot was developed and imaged.

Strong expression of Brazzein was seen, however Miraculin was not. Despite this low expression, this could very well be a bacteria-specific reduction.

@@ Line 1: / Line 1: @@
+{{HarvardFancybox}}
 {{Harvard_flavor}}
+{{harvard_notebook}}
 __NOTOC__
-==<html><a class="labnotebook" name="top">notebook calendar</a></html> [ [[#top|top]] ]==
+<html><h1><a name="notebook">notebook</a></h1></html>
-{| class="wikitable" border="0" cellspacing="10"
+{| style="font-size:14px;text-align:center;width:550px;" border="0" cellspacing="6"
 |-
-| Week 1  || [[#06-14-2010|06-14-2010]] || [[#06-15-2010|06-15-2010]] || [[#06-16-2010|06-16-2010]] || [[#06-17-2010|06-17-2010]] || [[#06-18-2010|06-18-2010]]
+| Week 1  || [[#06-14-2010|06-14-2010]] || [[#06-15-2010|06-15-2010]] || [[#06-16-2010|06-16-2010]] || [[#06-17-2010|06-17-2010]] || align="center"|-
 |-
-| Week 2  || [[#06-21-2010|06-21-2010]] || [[#06-22-2010|06-22-2010]] || [[#06-23-2010|06-23-2010]] || [[#06-24-2010|06-24-2010]] || [[#06-25-2010|06-25-2010]]
+| Week 2  || align="center"|- || align="center"|- || align="center"|- || align="center"|- || [[#06-25-2010|06-25-2010]]
 |-
 | Week 3  || [[#06-28-2010|06-28-2010]] || [[#06-29-2010|06-29-2010]] || [[#06-30-2010|06-30-2010]] || [[#07-01-2010|07-01-2010]] || [[#07-02-2010|07-02-2010]]
 |-
-| Week 4  || [[#07-05-2010|07-05-2010]] || [[#07-06-2010|07-06-2010]] || [[#07-07-2010|07-07-2010]] || [[#07-08-2010|07-08-2010]] || [[#07-09-2010|07-09-2010]]
+| Week 4  || align="center"|- || [[#07-06-2010|07-06-2010]] || [[#07-07-2010|07-07-2010]] || [[#07-08-2010|07-08-2010]] || [[#07-09-2010|07-09-2010]]
 |-
 | Week 5  || [[#07-12-2010|07-12-2010]] || [[#07-13-2010|07-13-2010]] || [[#07-14-2010|07-14-2010]] || [[#07-15-2010|07-15-2010]] || [[#07-16-2010|07-16-2010]]
 |-
-| Week 6  || [[#07-19-2010|07-19-2010]] || [[#07-20-2010|07-20-2010]] || [[#07-21-2010|07-21-2010]] || [[#07-22-2010|07-22-2010]] || [[#07-23-2010|07-23-2010]]
+| Week 6  || [[#07-19-2010|07-19-2010]] || [[#07-20-2010|07-20-2010]] || [[#07-21-2010|07-21-2010]] || align="center"|- || [[#07-23-2010|07-23-2010]]
 |-
 | Week 7  || [[#07-26-2010|07-26-2010]] || [[#07-27-2010|07-27-2010]] || [[#07-28-2010|07-28-2010]] || [[#07-29-2010|07-29-2010]] || [[#07-30-2010|07-30-2010]]
@@ Line 22: / Line 24: @@
 | Week 8  || [[#08-02-2010|08-02-2010]] || [[#08-03-2010|08-03-2010]] || [[#08-04-2010|08-04-2010]] || [[#08-05-2010|08-05-2010]] || [[#08-06-2010|08-06-2010]]
 |-
-| Week 9  || [[#08-09-2010|08-09-2010]] || [[#08-10-2010|08-10-2010]] || [[#08-11-2010|08-11-2010]] || [[#08-12-2010|08-12-2010]] || [[#08-13-2010|08-13-2010]]
+| Fall Work  || [[#08-26-2010|08-26-2010]] || [[#08-27-2010|08-27-2010]] || [[#08-28-2010|08-28-2010]] || [[#08-29-2010|08-29-2010]] || align="center"|-
 |}
-==<html><a class="labnotebook" name="06-14-2010">06-14-2010</a></html> [ [[#top|top]] ]==
-* Miraculin and brazzein constructs due to arrive on Wednesday from Mr. Gene
+<html><div id="entry"><span id="date"><a name="06-14-2010" class="date">06-14-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-===BioBrick Transformation===
+'''Summary'''
+* Miraculin and brazzein constructs due to arrive on Wednesday from Mr. Gene.
+*Wintergreen and Banana parts obtained from registry and transformed.
+'''BioBrick Transformation'''<br>
 BioBrick parts from the 2010 iGEM kit were transformed and grown in highly competent TURBO bacteria. <br>
 *Wintergreen Scent Pathway: <br>
@@ Line 41: / Line 46: @@
 (Not in BB 2010 Kit: BBa_J45400 - BAT2 and THI3)<br>
-==<html><a class="labnotebook" name="06-15-2010">06-15-2010</a></html> [ [[#top|top]] ]==
+<html><div id="entry"><span id="date"><a name="06-15-2010" class="date">06-15-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-===Primer Designs for Agrobacterium Vector===
+'''Summary'''
+*Primers designed and ordered for promoter and terminator from pORE vector.
+*Transformation of registry parts was low quantity.
+*Miraculin and Brazzein were codon-optimized.
+*RNA was extracted from valencia oranges.
+'''Primer Designs for Agrobacterium Vector'''<br>
 *Primers were designed to amplify from the Expression Series pORE Agrobacterium plasmid (e3) 1)the pENTcup2 promoter, 2) the tNOS stop sequence, 3) the tNOS stop sequence + additional stop codon and 4) the pHLP promoter.<br>
 Note: the NOSterm_BB_R primer works for both tNOS and tNOS+STOP codon sequences.
@@ Line 66: / Line 78: @@
      AAGGCTGCAGCGGCCGCTACTAGTCTTTTGAGCTTAGAGGTTTTT
-===BioBrick Transformation===
+'''BioBrick Transformation'''
 *Colonies were observed after overnight culture growth, but in low quantities.
 **J45700 and J45004 (both Wintergreen Pathway) showed minimal number of colonies on both 10μL and 100μL cultures.
 **J45250 and J45014 (both Banana Pathway) showed no colonies on either the 10μL or 100μL cultures.
-===Codon Usage in Arabidopsis===
+'''Codon Usage in Arabidopsis'''<br>
-Using http://gcua.schoedl.de/ <br><br>
+Using http://gcua.schoedl.de/
+'''Valencene Extraction'''<br>
-===Valencene Extraction===
 Used RNeasy Plant Mini Kit to extract RNA from the <u>flavedo</u> of an Organic Valencia Orange.
+<html>
+<div>
+<strong>Location of Flavedo:</strong>
+<a href="https://static.igem.org/mediawiki/2010/f/f5/Flavedo.png" id="single_image" style="font-size:12px">click to enlarge</a></div>
+<a href="https://static.igem.org/mediawiki/2010/f/f5/Flavedo.png" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/f/f5/Flavedo.png" width="150px" border=0>
+</a>
+</div>
+</html>
-[[Image:Flavedo.png|200px|Flavedo]]
+<html><div id="entry"><span id="date"><a name="06-16-2010" class="date">06-16-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Miniprep of Wintergreen registry parts.
+*Digestion and gel purification of Wintergreen parts.
-==<html><a class="labnotebook" name="06-16-2010">06-16-2010</a></html> [ [[#top|top]] ]==
+'''MiniPrep'''
-===MiniPrep===
 * MiniPrep of Wintergreen parts from Registry (J45004 and J45700) following Qiagen MiniPrep protocol.  MiniPrep three samples of each part.
 ** DNA concentrations:
@@ Line 92: / Line 114: @@
            J45700-3: 175.5 ng/μL
-===Digestion with Enzymes===
+'''Digestion with Enzymes'''
 *  For J45004, we added: 9μL DNA, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast).
 *  For J45700, we added 5μL DNA, 4μL H2O, 1μL buffer, 1μL xbaI restriction enzyme (slow), and .5μL pstI restriction enzyme (fast).
 *  We let mixtures sit for 30 minutes due to the use of xbaI restriction enzyme (slow).  After the 30 minutes, we added 2.5μL dye to each mix.
-===Gel===
+'''Gel'''
 *  We loaded 12.5μL of 1kb ladder to well 1 of the gel (numbered left to right).  We then loaded 12.5μL of J45004-1, J45004-2, and J45004-3 to wells 2,3, and 4, respectively.  We loaded J45700-1, J45700-2, J4500-3 in wells 5, 6, and 7, respectively (see images below for well locations).
 *  Ran on 1% agarose gel.
+<html>
+<div>
+<p>
+<strong>Gel Purification</strong>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/3/36/J45004_J45700gel1.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/3/36/J45004_J45700gel1.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/3/36/J45004_J45700gel1.jpg" width="150px" border=0>
+</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/6/65/J45004_J45700gel2.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/6/65/J45004_J45700gel2.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/6/65/J45004_J45700gel2.jpg" width="150px" border=0>
+</a>
+</p>
+</div>
+</html>
+<html><div id="entry"><span id="date"><a name="06-17-2010" class="date">06-17-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-[[Image:J45004_J45700gel1.jpg|150px|BBa_J45700]]
+'''Summary'''
-[[Image:J45004_J45700gel2.jpg|150px|BBa_J45700]]
+*PCR of pORE parts: pENTCUP2, NOSt, NOSt+STOP
+*Digest of pORE parts
-==<html><a class="labnotebook" name="06-17-2010">06-17-2010</a></html> [ [[#top|top]] ]==
+'''PCR Purification of pORE Vector Parts'''
-===PCR Purification of pORE Vector Parts===
 Following QIAgen PCR Purification Kit Protocol the following PCR products were purified:
@@ Line 113: / Line 157: @@
 To do: follow up with restriction digest <font color="green"> &#x2713; </font> and Agarose gel<font color="green"> &#x2713; </font> to confirm PCR and PCR purification. <!--<font color="green"> &#x2713; </font>-->
-===Restriction Digest and Agarose Gel===
+'''Restriction Digest and Agarose Gel'''<br>
 Restriction Digest reactions were set up as follows:
@@ Line 135: / Line 179: @@
 *0.5μL Pst1 Fast Enzyme
-Reactions were allowed to proceed for 45 minutes at 37°C.<br>
+Reactions were allowed to proceed for 45 minutes at 37°C.
-==<html><a class="labnotebook" name="06-18-2010">06-18-2010</a></html> [ [[#top|top]] ]==
+<html><div id="entry"><span id="date"><a name="06-25-2010" class="date">06-25-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Trouble with ligations
+*Troubleshooting different enzymes showed a non-functional XbaI
+*Digest of parts using slow XbaI
+<br>
-==<html><a class="labnotebook" name="06-21-2010">06-21-2010</a></html> [ [[#top|top]] ]==
+We began this week trying to ligate the pENTCUP2 promoter, NosT terminator, and NosT terminator plus stop codon into the V0120 vector.  We ran into several problems during this process.
+We had previously digested the three inserts as well as the promoter with XbaI and PstI fast digest enzymes, ligated, and transformed the ligated vectors into e. coli.  Unfortunately, we did not find any colonies of cells after over 14 hours of incubation.  Furthermore, on Friday June 18th, after digesting all three inserts and vector and running them on a gel, we did not see any NosT + stop DNA.  Therefore, on Monday June 21, we began by digesting more NosT + stop and V0120 vector with xba1 and pstI fast digestive enzymes.  The gel showed DNA length to be consistent with the given parts.  (See gel below)
-==<html><a class="labnotebook" name="06-22-2010">06-22-2010</a></html> [ [[#top|top]] ]==
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/8/8b/Digestion_gel1.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/8/8b/Digestion_gel1.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/8/8b/Digestion_gel1.jpg" width="150px" border=0>
+</a>
+</div>
+</html>
-==<html><a class="labnotebook" name="06-23-2010">06-23-2010</a></html> [ [[#top|top]] ]==
+*Gel Lanes (both inserts and vector were digested with xbaI/pstI): 1. 1kb plus ladder. 2. pENTCUP2 promoter. 3. NosT terminator. 4. NosT + stop terminator 5. V0120 digested.
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/0/0b/Digestion_gel2.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/0/0b/Digestion_gel2.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/0/0b/Digestion_gel2.jpg" width="150px" border=0>
+</a>
+</div>
+</html>
-==<html><a class="labnotebook" name="06-24-2010">06-24-2010</a></html> [ [[#top|top]] ]==
+* Gel Lanes (both inserts and vector were digested with xbaI/pstI): 1. 1kb plus ladder. 2. NosT + stop terminator.  3. V0120 digested.
-==<html><a class="labnotebook" name="06-25-2010">06-25-2010</a></html> [ [[#top|top]] ]==
-We began this week trying to ligate the pENTCUP2 promoter, NosT terminator, and NosT terminator plus stop codon into the V0120 vector.  We ran into several problems during this process.
-We had previously digested the three inserts as well as the promoter with XbaI and PstI fast digest enzymes, ligated, and transformed the ligated vectors into e. coli.  Unfortunately, we did not find any colonies of cells after over 14 hours of incubation.  Furthermore, on Friday June 18th, after digesting all three inserts and vector and running them on a gel, we did not see any NosT + stop DNA.  Therefore, on Monday June 21, we began by digesting more NosT + stop and V0120 vector with xba1 and pstI fast digestive enzymes.  The gel showed DNA length to be consistent with the given parts.  (See gel below)
-[[Image:digestion_gel1.jpg||150px]]
-*Gel Lanes (both inserts and vector were digested with xbaI/pstI): 1. 1kb plus ladder. 2. pENTCUP2 promoter. 3. NosT terminator. 4. NosT + stop terminator 5. V0120 digested.
-[[Image:digestion_gel2.jpg||150px]]
-*Gel Lanes (both inserts and vector were digested with xbaI/pstI): 1. 1kb plus ladder. 2. NosT + stop terminator.  3. V0120 digested.
@@ Line 169: / Line 224: @@
 We used Team Vector's R3 ligation (they have successfully ligated and transformed) as a positive control. However, the bacteria containing the ligated plasmids were plated on Ampicillin plates, which turned out to be the wrong resistance.
-===Troubleshooting===
+'''Troubleshooting'''
 In order to get a better understanding of the problem with our ligation, we ran a diagnostic gel with the V0120 backbone and vectors B15 and B21.
-[[Image:V0120_gel_longer.jpg||250px]]
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/5/58/V0120_gel_longer.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/5/58/V0120_gel_longer.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/5/58/V0120_gel_longer.jpg" width="250px" border=0>
+</a>
+</div>
+</html>
      Gel Lanes:
 . 1 kb plus ladder
@@ Line 193: / Line 257: @@
 We began a slow enzyme xba1/pstI digest on Friday, but the gel was run in mismatching buffers (TAE and TBE).
-[[Image:slowdigest.jpg||150px]]
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/1/1a/Slowdigest.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/1/1a/Slowdigest.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/1/1a/Slowdigest.jpg" width="150px" border=0>
+</a>
+</div>
+</html>
 * Gel Lanes (inserts and vector digested with xba1/pstI): 1. 1 kb plus ladder.  2. pENTCUP2 3. NosT 4. NosT & stop  5. v0120
-===Valencene===
+'''Valencene'''
 Digestion of PCR products aimed to isolate valencene gene showed very short length on gel.  These are not the correct size and are most likely primer dimers.  PCR products were digested with EcoRI/SpeI.  5 μL of each sample was digested with pstI to be sure that the pstI site was in the sequence of DNA.
-[[Image:Valencene_pcr_gel.jpg||150px]]
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/4/44/Valencene_pcr_gel.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/4/44/Valencene_pcr_gel.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/4/44/Valencene_pcr_gel.jpg" width="150px" border=0>
+</a>
+</div>
+</html>
 * Gel Lanes: 1. 1 kb plus ladder.  2. Flavedo EcoRI/SpeI.  3. Flavedo PstI  4. Open  5. Fruit EcoRI/SpeI.  6. Fruit pstI
-==<html><a class="labnotebook" name="06-28-2010">06-28-2010</a></html> [ [[#top|top]] ]==
+<html><div id="entry"><span id="date"><a name="06-28-2010" class="date">06-28-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-===Miniprep of Miraculin and Brazzein Constructs===
+'''Summary'''
+*Miniprep of Miraculin and Brazzein parts
+*Digest, ligation and transformation of pORE parts into a BioBrick backbone (V0120)
+'''Miniprep of Miraculin and Brazzein Constructs'''
 *Protocol used was from the Qiagen Miniprep Kit
@@ Line 226: / Line 313: @@
 |}
-===DTL (Digestion, Ligation, Transformation) of The Big Three (pENTCUP2, NOSt, NOSt + STOP)===
+'''DTL (Digestion, Ligation, Transformation) of The Big Three (pENTCUP2, NOSt, NOSt + STOP)'''
 {| border="1"
 |+ Digestion Reactions
@@ Line 253: / Line 340: @@
 *2.2 μL of DNA Loading Buffer were added to each reaction and loaded onto a 1% Agarose gel (TAE buffer).  Gel was ran at 125 V for 30 min.
-[[Image:mrt&ag.jpg|150px|Digest Gel]]
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/4/47/Mrt%26ag.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/4/47/Mrt%26ag.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/4/47/Mrt%26ag.jpg" width="150px" border=0>
+</a>
+</div>
+</html>
 {| border ="1"
@@ Line 335: / Line 431: @@
 *Plates were left overnight.
-==<html><a class="labnotebook" name="06-29-2010">06-29-2010</a></html> [ [[#top|top]] ]==
+<html><div id="entry"><span id="date"><a name="06-29-2010" class="date">06-29-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-===Results of ligation and transformation of The Big Three (pENTCUP2, NosT, NosT + stop) with B15 backbone into E.coli===
+'''Summary'''
+*Digestion, Ligation and Transformation of pORE parts.
+*Digestion, Ligation and Transformation of Miraculin and Brazzein into BioBrick.
+'''Results of ligation and transformation of The Big Three (pENTCUP2, NosT, NosT + stop) with B15 backbone into E.coli'''
 A few colonies were found on the pENTCUP2 + Backbone plate, NosT + stop and backbone plate, and b15 backbone control plate.  Colonies were picked from the plates and placed in 3ml of LB and agarose in a culture tube. The tubes were placed in the 37°C shaker for 8 hours.  2 mL of LB+AMP was added to the cultures, bring the total volume to 5 mL of LB+AMP. Cultures were left to shake overnight.
-===DLT of the Sweethearts - Miraculin and Brazzein (and B21)===
+'''DLT of the Sweethearts - Miraculin and Brazzein (and B21)'''
 {| border="1"
@@ Line 366: / Line 466: @@
 ''Digestion Gel''
-[[Image:miraculin_gell.jpg|150px|Miraculin and Brazzein digestion]]
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/3/3c/Miraculin_gell.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/3/3c/Miraculin_gell.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/3/3c/Miraculin_gell.jpg" width="150px" border=0>
+</a>
+</div>
+</html>
      Gel Lanes:
@@ Line 417: / Line 525: @@
 *The ligation of Brazzein was done at a 2:1 ratio due to its smaller size (~200 bp)
-==<html><a class="labnotebook" name="06-30-2010">06-30-2010</a></html> [ [[#top|top]] ]==
-===Miraculin, Brazzein===
+<html><div id="entry"><span id="date"><a name="06-30-2010" class="date">06-30-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Started cultures of Miraculin and Brazzein.
+*Miniprepped pORE parts.
+*Digestion of pORE parts to confirm correct insert.
+'''Miraculin, Brazzein'''
 *Colonies did grow!
 *Started 5 mL cultures of Miraculin and Brazzein biobrick constructs (5 cultures each)
-===The Big Three===
+'''The Big Three'''
 *Began miniprep of cultures of pENT, NOSt+STOP and our Control (for experimental purposes)
@@ Line 511: / Line 626: @@
 Placed in 37°C water bath for 20 minutes.
-==<html><a class="labnotebook" name="07-01-2010">07-01-2010</a></html> [ [[#top|top]] ]==
+<html><div id="entry"><span id="date"><a name="07-01-2010" class="date">07-01-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Miniprep of Miraculin and Brazzein.
+*RNA extraction from Valencia orange, second attempt, using Qiagen RNeasy kit.
+<br>
 * We made glycerol stocks from our Miraculin & v0120 and Brazzein & v0120. 333 μL cultures with 666μL glycerol and placed in -80°C freezer.
@@ Line 555: / Line 677: @@
-===Valencia orange surgery (part two)===
+'''Valencia orange surgery (part two)'''
 * RNA extraction per Qiagen RNAeasy protocol.
 ** We made sure to apply RNAzap (RNAase-free) spray to all surfaces and instruments.
@@ Line 574: / Line 695: @@
 |}
-==<html><a class="labnotebook" name="07-02-2010">07-02-2010</a></html> [ [[#top|top]] ]==
+<html><div id="entry"><span id="date"><a name="07-02-2010" class="date">07-02-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Confirmation gels of NOSt+STOP part and reverse transcriptase reaction.
+**NOSt+STOP ligation was confirmed.
+**RT reaction of Valencia RNA failed.
+'''NosT + stop and v0120'''
+We ran an xba/pstI fast enzyme digest on our miniprepped NosT + stop and v0120 plasmid.  The gel was consistent with a successful ligation. (See lanes 7-10 in gel image below).
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/0/08/Val_dig_NOSt_dig_cofirm.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/0/08/Val_dig_NOSt_dig_cofirm.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/0/08/Val_dig_NOSt_dig_cofirm.jpg" width="150px" border=0>
+</a>
+</div>
+</html>
+'''Valencene'''
+After running a reverse transcriptase reaction on our RNA extraction, we ran PCR on the cDNA with Valencene specific primers.  The gel did not show the proper fragment length of the Valencene gene.  Instead, it appears primer dimers formed again.  (See lanes 2-5)
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/0/08/Val_dig_NOSt_dig_cofirm.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/0/08/Val_dig_NOSt_dig_cofirm.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/0/08/Val_dig_NOSt_dig_cofirm.jpg" width="150px" border=0>
+</a>
+</div>
+</html>
+<html><div id="entry"><span id="date"><a name="07-06-2010" class="date">07-06-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Plan of attack for tagging Miraculin and Brazzein with ''YFP-2x'' and StrepII tags.
+*Miraculin, Brazzein and YFP (B21) Digestion, Ligation and Transformation.
+'''Tagging Miraculin and Brazzein with YFP and StrepII tags'''
+Tag:  -E--N--X--<b>STREP/YFP</b>--S--N--P- <br/>
+Insert: E--N--X--<b>Miraculin/Brazzein</b>--S--N--P- <br/>
+*The 'tag' biobrick (either YFP or STREPII) was used as the vector; Miraculin and Brazzein were used as the insert.
+*Tags were ligated to both the N- and C-terminal of Miraculin and Brazzein
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/f/f0/NStrepII_flowchart.png" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/f/f0/NStrepII_flowchart.png" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/f/f0/NStrepII_flowchart.png" width="150px" border=0>
+</a>
+</div>
+</html>
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/d/d5/YFP_flowchart.png" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/d/d5/YFP_flowchart.png" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/d/d5/YFP_flowchart.png" width="150px" border=0>
+</a>
+</div>
+</html>
+{| border="1"
+|+ ''BioBrick Digest Combinations''
+!  !! Vector !! Insert
+|-
+! N-Terminus
+| align="center" | Spe1/Pst1 || align="center" |  Xba1/Pst1
+|-
+! C-Terminus
+| align="center"  | EcoR1/Xba1 || align="center" |  EcoR1/Spe1
+|-
+|}
+{| border="1"
+|+ ''Digestion Reactions''
+!  !! B21 S/P !! B21 E/X !! Miraculin X/P !! Miraculin E/S !! Brazzein X/P !! Brazzein E/S
+|-
+! diH<sub>2</sub>O
+| align="center" | 13 || align="center" |  13 || align="center" | 11 || align="center" | 11 || align="center" | 0 ||align="center"| 0
+|-
+! Green FD buffer (10x)
+| align="center"  | 2 || align="center" |  2 || align="center" |  2 || align="center" |  2 || align="center" |  2 || align="center" | 2
+|-
+! DNA
+| align="center"  | 3 || align="center" | 3 || align="center" | 5|| align="center"  | 5|| align="center"  | 16 || align="center"| 16
+|-
+! Spe1
+| align="center"  | 1 || align="center" | - || align="center" | - || align="center" | 1 || align="center" | - || align = "center"| 1
+|-
+! PstI
+| align="center"  | 1 || align="center" | - || align="center" | 1 || align="center" | - || align="center" |  1|| align = "center"| -
+|-
+! EcoR1
+| align="center"  | - || align="center" |  1 || align="center" | - || align="center" | 1 || align="center" | - || align = "center"| 1
+|-
+! Xba1
+| align="center" | - || align="center" | 1 || align="center" | 1 || align="center" | - || align="center" | 1|| align="center" | -
+|-
+|}
+'''Gel'''
+The gel showed DNA fragments consistent with Miraculin and Brazzein.  The digestion of B21 appeared to be succesful, but the DNA sequence cut out was too small to see on the gel.
+<html>
+<div>
+<a href="https://static.igem.org/mediawiki/2010/3/3d/Miraculin_brazzein_b21.jpg" id="single_image" style="font-size:12px">click to enlarge</a>
+</br>
+<a href="https://static.igem.org/mediawiki/2010/3/3d/Miraculin_brazzein_b21.jpg" id="single_image">
+<img src="https://static.igem.org/mediawiki/2010/3/3d/Miraculin_brazzein_b21.jpg" width="150px" border=0>
+</a>
+</div>
+</html>
+    Gel Lanes:
+. 1 kb plus ladder
+. B21 speI/pstI
+. B21 ecoRI/xbaI
+. Miraculin xbaI/pstI
+. Miraculin ecoRI/speI
+. Brazzein xbaI/pstI
+. Brazzein ecoRI/pstI
+. 1kb plus ladder
+We extracted the circled bands and gel purified the gel per the Qiagen gel purification protocol.
+    ODs of gel purified DNA
+     B21 speI/pstI:  15.9 ng/μL
+     B21 ecoRI/xbaI:  11.0 ng/μL
+     Miraculin xbaI/pstI:  9.7 ng/μL
+     Miraculin ecoRI/speI:  7.1 ng/μL
+     Brazzein xbaI/pstI:  2.6 ng/μL
+     Brazzein ecoRI/pstI:  5.0 ng/μL
+'''Ligation'''
+We did 6 different ligation reactions.  The chart below shows the different reactions. Ligation reactions were left at room temperature for 15 minutes.
+{| border="1"
+|+ ''Ligation Reactions''
+!  !! Miraculin xbaI/pstI w/ B21 speI/pstI!! Miraculin ecoRI/speI w/ B21 ecoRI/xbaI!! Brazzein xbaI/pstI w/ B21 speI/pstI !! Brazzein ecoRI/speI w/ B21 ecoRI/xbaI!! Control B21 speI/pstI!! Control B21 ecoRI/xbaI
+|-
+! DNA Insert
+| align="center" | 2 || align="center" |  3|| align="center" | 3|| align="center" | 1|| align="center" | 0||align="center"| 0
+|-
+! T4 DNA ligase buffer (10x)
+| align="center"  | 2 || align="center" |  2 || align="center" |  2|| align="center" |  2|| align="center" |  2|| align="center" |2
+|-
+! diH<sub>2</sub>O
+| align="center"  | 12 || align="center" |  9 || align="center" |  11|| align="center"  | 11|| align="center"  | 14|| align="center"| 12
+|-
+! T4 DNA ligase
+| align="center"  | 1 || align="center" |  1 || align="center" |  1|| align="center" |  1|| align="center" |  1|| align = "center"| 1
+|-
+! DNA Backbone
+| align="center" | 1 || align="center" |  1|| align="center" | 1|| align="center" | 1|| align="center" | 1|| align="center" |1
+|-
+|}
+'''Transformation'''
+We mixed 5μL ligation mix with 15μL Turbo e. coli cells.  These were placed in ice for 30 minutes and then heat shocked in 42°C water bath for 30 seconds.  The cells were placed back on ice for 2 minutes.  170 μL of SOC broth was added to each Eppendorf tube.  The transformed e. coli were then plated on LB Ampicillin plates and left in the 37°C incubator overnight.
+<html><div id="entry"><span id="date"><a name="07-07-2010" class="date">07-07-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Sequencing'''
+V0120 Plasmids containing the pENTCUP2 plant promoter, NOS terminator and NOS terminator + STOP were sent to GENEWIZ for sequencing.  Sequencing results are expected tomorrow.
+[[Image:sequencing_order.png|Sequencing Order]]
+'''Cultures'''
+mL cultures were started from the ''YFP-2x'' construct from yesterday, as well as the B15 (StrepII) tag.
+*2 x B21 E/X + Brazz E/S  - C-Terminus
+*2 x B21 S/P + Brazz X/P  - N-Terminus
+*2 x B21 E/X + Mira E/S  - C-Terminus
+*2 x B21 S/P + Mira X/P  - N-Terminus
+*2 x B15 Plate #1
+*2 x B15 Plate #2
+Cultures were placed in a 37°C incubator and left to shake overnight.
+'''Primers for Wintergreen pathway parts'''
+'''J45004'''
+*  Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
+*  Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3'  (last 5 bp omitted to meet 45 bp maximum)
+'''J45017'''
+*  Left Primer:  5' cctttctagaatgaaaactcccgaagactgc 3'
+*  Right Primer:  5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'
+<html><div id="entry"><span id="date"><a name="07-08-2010" class="date">07-08-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Confirmation digest of Flavor proteins with YFP tags
+*Ligated Flavor Proteins with StrepII tag
+*Re-submitted sequencing order, with correct primers, to GeneWiz
+*Did a confirmation digest of the Miraculin/Brazzein + ''YFP-2x'' constructs
+[[Image:Gel_b15_yfpconfirm.jpg|150px|BBa_J45700]]
+#Ladder
+#B15 E/X
+#B15 S/P
+#Mira+YFP N1
+#Mira+YFP N2
+#Mira+YFP C1
+#Mira+YFP C2
+#Brazz+YFP N1
+#Brazz+YFP N2
+#Brazz+YFP C1
+#Brazz+YFP C2
+#Ladder
+**It appears that the digestion of Mira+YFP C2 (lane 7) did not work properly. This could have been the result of choosing a bacterial colony that was the result of contamination, or from simply an error in the digestion step.
+*Transformed two pDUET expression vectors for Miniprep
+'''Ligated Miraculin/Brazzein to a StrepII tag'''
+{| border="1"
+|+ ''Ligation Reactions''
+!  !! Miraculin xbaI/pstI w/ B15 speI/pstI!! Miraculin ecoRI/speI w/ B15 ecoRI/xbaI!! Brazzein xbaI/pstI w/ B15 speI/pstI !! Brazzein ecoRI/speI w/ B15 ecoRI/xbaI!! Control B15 speI/pstI!! Control B15 ecoRI/xbaI
+|-
+! DNA Insert
+| align="center" | 3 || align="center" |  4|| align="center" | 4|| align="center" | 2|| align="center" | 0||align="center"| 0
+|-
+! T4 DNA ligase buffer (10x)
+| align="center"  | 2 || align="center" |  2 || align="center" |  2|| align="center" |  2|| align="center" |  2|| align="center" |2
+|-
+! diH<sub>2</sub>O
+| align="center"  | 11 || align="center" |  10 || align="center" |  10|| align="center"  | 12|| align="center"  | 14|| align="center"| 14
+|-
+! T4 DNA ligase
+| align="center"  | 1 || align="center" |  1 || align="center" |  1|| align="center" |  1|| align="center" |  1|| align = "center"| 1
+|-
+! DNA Backbone
+| align="center" | 3 || align="center" |  3|| align="center" | 3|| align="center" | 3|| align="center" | 3|| align="center" |3
+|-
+|}
+* We then transformed the ligated plasmids into Turbo e. coli and plated the bacteria on Amp plates.  Plates were left in the 37°C incubator overnight.
+<html><div id="entry"><span id="date"><a name="07-09-2010" class="date">07-09-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Ligation of flavor proteins with YFP tags into DUET vector
+'''Ligation of Brazzein & Miraculin (w/ YFP tags) into DUET vector'''
+''Digestion''
+{| border="1"
+|+ ''Digestion Reactions''
+!  !! Brazzein & YFP C EcoRI/SpeI!! Brazzein & YFP N EcoRI/SpeI!! Miraculin & YFP C EcoRI/SpeI !! Miraculin & YFP N EcoRI/SpeI!! V24 NotI/SpeI!! NosT & Stop EcoRI/XbaI
+|-
+! DNA
+| align="center" | 2 || align="center" |  2|| align="center" | 2|| align="center" | 3|| align="center" | 5||align="center"| 2
+|-
+! FD Buffer (10x)
+| align="center"  | 2 || align="center" |  2 || align="center" |  2|| align="center" |  2|| align="center" |  2|| align="center" |2
+|-
+! diH<sub>2</sub>O
+| align="center"  | 14 || align="center" |  14 || align="center" |  14|| align="center"  | 13|| align="center"  | 11|| align="center"| 14
+|-
+! Enzyme
+| align="center"  | 1 || align="center" |  1 || align="center" |  1|| align="center" |  1|| align="center" |  1|| align = "center"| 1
+|-
+! Enzyme
+| align="center" | 1 || align="center" |  1|| align="center" | 1|| align="center" | 1|| align="center" | 1|| align="center" |1
+|-
+|}
+* We are adding the NosT & stop to the C-terminus of the Miraculin and Brazzein constructs.  This whole construct will then be ligated into the V24 DUET vector.
+'''Gel'''
+[[Image:Adding stop codon.jpg|| 150px]]
+    Gel Lanes:
+. 1kb plus ladder
+. Miraculin & YFP N-terminus ecoRI/SpeI
+. Miraculin & YFP C-terminus ecoRI/SpeI
+. Brazzein & YFP N-terminus ecoRI/SpeI
+. Brazzein & YFP C-terminus ecoRI/SpeI
+. V24 NotI/SpeI
+. NosT & Stop EcoRI/XbaI
+<html><div id="entry"><span id="date"><a name="07-12-2010" class="date">07-12-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Miniprep and digest tagged flavor proteins
+*  We removed our cultures of e. coli containing Miraculin/Brazzein C/N YFP and NosT & Stop and e. coli containing Miraculin/Brazzein and StrepII tag from the 37°C shaker.
+*  Glycerol stocks were made (666 μL glycerol and 333 μL cells)
+'''Miniprep'''
+    ODs
+     Miraculin C YFP and NosT & Stop 1: 414.4 ng/μL
+     Miraculin C YFP and NosT & Stop 2: 304.0 ng/μL
+     Miraculin N YFP and NosT & Stop 1: 428.6 ng/μL
+     Miraculin N YFP and NosT & Stop 2: 421.0 ng/μL
+     Brazzein C YFP and NosT & Stop 1: 572.8 ng/μL
+     Brazzein C YFP and NosT & Stop 2: 580.3 ng/μL
+     Brazzein N YFP and NosT & Stop 1: 348.9 ng/μL
+     Brazzein N YFP and NosT & Stop 2: 639.6 ng/μL
+     Miraculin N StrepII 1: 888.6 ng/μL
+     Miraculin N StrepII 2: 614.4 ng/μL
+     Miraculin C StrepII 1: 677.1 ng/μL
+     Miraculin C StrepII 2: 222.1 ng/μL
+     Brazzein N StrepII 1: 352.6 ng/μL
+     Brazzein N StrepII 2: 331.6 ng/μL
+     Brazzein C StrepII 1: 209.3 ng/μL
+     Brazzein C StrepII 2: 346.4 ng/μL
+'''Digestion'''
+{| border="1"
+|+ ''Digestion Reactions''
+! !! Miraculin C YFP NST!! Miraculin N YFP NST!! Brazzein N YFP NST!! Brazzein C YFP NST
+|-
+! diH<sub>2</sub>O
+| align="center" | 14 || align="center" |  14 || align="center" | 13.5 || align="center" | 14.3
+|-
+! Green FD buffer (10x)
+| align="center"  | 2 || align="center" |  2 || align="center" |  2 || align="center" |  2
+|-
+! DNA
+| align="center"  | 2 || align="center" | 2 || align="center" | 2.5|| align="center"  | 1.7
+|-
+! NotI
+| align="center"  | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1
+|-
+! SpeI
+| align="center"  | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1
+|-
+|}
+'''Gel'''
+[[Image: Mira_brazz+YFP_7_12_2010.jpg|| 150 px]]
+    Gel Lanes:
+. 1 kb plus ladder
+. Miraculin N YFP NST (NotI/SpeI)
+. Miraculin C YFP NST (NotI/SpeI)
+. Brazzein N YFP NST (NotI/SpeI)
+. Brazzein C YFP NST (NotI/SpeI)
+. 1 kb plus ladder
+* Gel purify per Qiagen protocol
+    ODs
+     Brazzein C YFP NST (NotI/SpeI): 6.3 ng/μL
+     Brazzein N YFP NST (NotI/SpeI): 8.5 ng/μL
+     Miraculin C YFP NST (NotI/SpeI): 3.6 ng/μL
+     Miraculin N YFP NST (NotI/SpeI): 12.8 ng/μL
+<html><div id="entry"><span id="date"><a name="07-13-2010" class="date">07-13-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Ligation of YFP tagged flavor proteins into v24 pETDUET vector
+'''Ligation in V24'''
+* Ligation of  of Mira/Brazz+YFP+NOSt+STOP Construct into the V24 pETDUET vector for expression of proteins in IPTG inducible bacteria.
+{| border="1"
+|+ ''Ligation Reactions''
+!  !! Mira N + V24 !! Mira C + V24 !! Brazz N + V24 !! Brazz C + V24 !! Control
+|-
+! diH<sub>2</sub>O
+| align="center" | 7 || align="center" | 1 || align="center" | 6 || align="center" | 4 || align="center" | 12
+|-
+! T4 DNA ligase buffer (10x)
+| align="center"  | 2 || align="center" | 3 || align="center" | 2 || align="center" | 2 || align="center" | 2
+|-
+! DNA Insert
+| align="center"  | 5 || align="center" |  20 || align="center" | 6 || align="center"  | 8 || align="center"  | 0
+|-
+! DNA Backbone
+| align="center"  | 5 || align="center" |  5 || align="center" |  5 || align="center" |  5 || align="center" |  5
+|-
+! T4 DNA ligase
+| align="center" | 1 || align="center" |  1|| align="center" | 1|| align="center" | 1|| align="center" | 1
+|-
+|}
+* 5μL of Ligation reactio
+<html><div id="entry"><span id="date"><a name="07-14-2010" class="date">07-14-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Added Stop codon to flavor proteins tagged with StrepII
+'''Miniprep of STOP + V0120 part'''
+    Nanodrop O/D's:
+    STOP V0120 1-1: 134.4 ng/μL
+    STOP V0120 1-2: 98.7 ng/μL
+    STOP V0120 2-1: 55.2 ng/μL
+    STOP V0120 2-2: 121.8 ng/μL
+'''DTL of StrepII+Mira/Brazz with STOP codon'''
+*To insert a STOP codon to the end of our Mira/Brazz StrepII constructs, we used the STOP+V0120 BioBrick as our vector (EcoR1/Xba1 digest) and our Miraculin/Brazzein construct as our insert (EcoR1/Spe1 digest)
+*Construct DNA used was from Miniprep 1 (Box 4)
+*~1μg of DNA was digested in each reaction
+{| border="1"
+|+ ''Digestion Reactions''
+!  !! Mira Strep N !! Mira Strep C !! Brazz Strep N !! Brazz Strep C !! STOP+V0120 BioBrick
+|-
+! diH<sub>2</sub>O
+| align="center" | 15 || align="center" | 14.5 || align="center" | 13.5 || align="center" | 11.5 || align="center" | 6
+|-
+! Green FD buffer (10x)
+| align="center"  | 2 || align="center" |  2 || align="center" |  2 || align="center" |  2 || align="center" | 2
+|-
+! DNA
+| align="center"  | 1 || align="center" | 1.5 || align="center" | 2.5 || align="center"  | 4.5 || align="center"  | 10
+|-
+! EcoR1
+| align="center"  | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1
+|-
+! Xba1
+| align="center"  | - || align="center" | - || align="center" | - || align="center" | - || align="center" |  1
+|-
+! Spe1
+| align="center"  | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1 || align="center" | -
+|-
+|}
+''Digestion of Mira/Brazz+Strep and STOP codon BioBrick'' <br/>
+[[Image:strep+mirabrazz_STOP gel.jpg|| 250px]]
+*Circled bands were cut and gel purified
+    Miraculin + StrepII = 730 bp
+    Brazzein + StrepII = 230 bp
+    STOP + V0120 = 3200 bp
+# 1kb Plus Ladder
+# Miraculin C Strep E/S
+# Miraculin N Strep E/S
+# Brazzein C Strep E/S
+# Brazzein N Strep E/S
+# STOP + V0120 E/X
+# 1kb Plus Ladder
+    Gel Purification Specs
+    Mira N StrepII E/S: 3.0 ng/μL
+    Mira C StrepII E/S: 2.8 ng/μL
+    Brazz N StrepII E/S: 3.4 ng/μL
+    Brazz C StrepII E/S: 1.3 ng/μL
+    STOP+V0120 BB E/X: 7.1 ng/μL
+''Ligation of Mira/Brazz+Strep and STOP codon BioBrick'' <br/>
+{| border="1"
+|+ ''Ligation Reactions''
+!  !! Mira StrepII N + STOP w/ v0120 BB !! Mira StrepII C + STOP w/ v0120 BB !! Brazz StrepII N + STOP w/ v0120 BB !! Brazz StrepII C + STOP w/ v0120 BB !! Control STOP w/ v0120 BB
+|-
+! diH<sub>2</sub>O
+| align="center" | 4.5 || align="center" | 4.5 || align="center" | 9 || align="center" | 5 || align="center" | 12
+|-
+! T4 DNA ligase buffer (10x)
+| align="center"  | 2 || align="center" | 3 || align="center" | 2 || align="center" | 2 || align="center" | 2
+|-
+! DNA Insert
+| align="center"  | 7.5 || align="center" |  7.5 || align="center" | 2 || align="center"  | 6 || align="center"  | 0
+|-
+! DNA Backbone
+| align="center"  | 5 || align="center" |  5 || align="center" |  6 || align="center" |  6 || align="center" |  5
+|-
+! T4 DNA ligase
+| align="center" | 1 || align="center" |  1|| align="center" | 1|| align="center" | 1|| align="center" | 1
+|-
+|}
+''Transformation''
+* Transformed 5 μL ligation mix with 15 μL TURBO e. coli cells
+* Plated on LB +  Amp plates and left in 37°C incubator overnight
+<html><div id="entry"><span id="date"><a name="07-15-2010" class="date">07-15-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+* Flavor proteins tagged with YFP confirmed in v24 DUET vector
+'''Miraculin/Brazzein YFP N/C and NosT + Stop in V24 DUET vector'''
+* Made glycerol stocks (666 μL glycerol and 333 μL cells)
+    ODs
+     Miraculin C1: 168.8 ng/μL
+     Miraculin C2: 67.2 ng/μL
+     Miraculin N1: 183.0 ng/μL
+     Miraculin N2: 173.5 ng/μL
+     Brazzein N1: 54.8 ng/μL
+     Brazzein N2: 79.0 ng/μL
+     Brazzein C1: 161.4 ng/μL
+     Brazzein C2: 125.0 ng/μL
+{| border="1"
+|+ ''Confirmation Digestion Reactions''
+!  !! Mira N1 !! Mira N2 !! Mira C1 !! Mira C2 !! Brazz N1 !! Brazz N2 !! Brazz C1 !! Brazz C2
+|-
+! diH<sub>2</sub>O
+| align="center" | 13.5 || align="center" | 13.5 || align="center" | 13.5 || align="center" | 11 || align="center" | 11 || align="center" | 11 || align="center" | 13.5 || align="center" | 13
+|-
+! Green FD buffer (10x)
+| align="center"  | 2 || align="center" |  2 || align="center" |  2 || align="center" |  2 || align="center" | 2 || align="center" |2 || align="center" | 2 || align="center" | 2
+|-
+! DNA
+| align="center"  | 2.5 || align="center" | 2.5 || align="center" | 2.5 || align="center"  | 5 || align="center"  | 5 || align="center" | 5 || align="center" | 2.5 || align="center" | 3
+|-
+! PstI
+| align="center"  | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1 || align="center" | 1
+|-
+! Xba1
+| align="center"  | 1 || align="center" | 1 || align="center" | 1|| align="center" | 1 || align="center" |  1 || align="center" | 1 || align="center" | 1 || align="center" | 1
+|-
+|}
+''Confirmation Digest of Mira/Brazz + YFP + NOSt + STOP in V24 Expression Vector'' <br/>
+[[Image:MiraBrazzConstructConfirm.jpg|| 250px]]
+# Ladder
+# Mira N1
+# Mira N2
+# Mira C1
+# Mira C2
+# Brazz N1
+# Brazz N2
+# Brazz C1
+# Brazz C2
+# Ladder
+*''The N & C designation corresponds to the terminus upon which the YFP was fused.''
+    Expected Lengths
+     Miraculin + YFP + NOSt + STOP = 700 + 1500 + 250 = 2450 bp
+     Brazzein + YFP + NOSt + STOP = 300 + 1500 + 250 = 2050 bp
+     V24 = 5200 bp
+<html><div id="entry"><span id="date"><a name="07-16-2010" class="date">07-16-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+* Retry adding stop codon to flavor proteins tagged with StrepII
+* PCR of valencene gene failed
+* Did minipreps of the Mira/Brazz + Strep constructs.  All constructs had failed to ligate.
+[[Image:mbstrepfail.jpg|240px]]
+* Ran PCR of Valencene gene from extracted genomic DNA. Followed with PCR purification
+* Re-digested STOP+V0120 BioBrick, gel purified. Gel Purification failed, no DNA was extracted.
+<html><div id="entry"><span id="date"><a name="07-19-2010" class="date">07-19-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''DTL of Mira/Brazz+StrepII into STOP+V0120'''
+''Digestion''
+{| border="1"
+|+ ''Digestion Reactions''
+!  !! Stop v0120 1!! Stop v0120 2
+|-
+! DNA
+| align="center" |10|| align="center" |  8
+|-
+! FD Buffer (10x)
+| align="center"  | 2 || align="center" |  2
+|-
+! diH<sub>2</sub>O
+| align="center"  | 6 || align="center" |  8
+|-
+! Xba1
+| align="center"  | 1 || align="center" |  1
+|-
+! EcoRI
+| align="center" | 1 || align="center" |  1
+|-
+|}
+{| border="1"
+|+ ''Ligation Reactions''
+!  !! Mira N + Stop !! Mira C + Stop !! Brazz N + Stop !! Brazz C + Stop !! Stop only Control
+|-
+! diH<sub>2</sub>O
+| align="center" | 3 || align="center" | 3 || align="center" | 11 || align="center" | 6 || align="center" | 14
+|-
+! T4 DNA ligase buffer (10x)
+| align="center"  | 2 || align="center" | 3 || align="center" | 2 || align="center" | 2 || align="center" | 2
+|-
+! DNA Insert
+| align="center"  | 11 || align="center" |  11 || align="center" | 3 || align="center"  | 8 || align="center"  | 0
+|-
+! DNA Backbone
+| align="center"  | 3 || align="center" |  3 || align="center" |  3 || align="center" |  3 || align="center" |  3
+|-
+! T4 DNA ligase
+| align="center" | 1 || align="center" |  1|| align="center" | 1|| align="center" | 1|| align="center" | 1
+|-
+|}
+'''Confirm of valencene PCR (failed)'''
+[[Image:BackbonePCRconfirm.jpg|240px]]
+* Re-do of Valencene PCR (failed)
+[[Image:Valencene_egel.jpg|240px]]
+<html><div id="entry"><span id="date"><a name="07-20-2010" class="date">07-20-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+* IPTG induced and tested for YFP expression in bacteria
+* Picked colonies from Mira/Brazz StrepII STOP constructs
+**Only Mira N and Brazz C had colonies, 2 mL cultures were started and will be miniprepped to confirm ligation at the end of today.
+*Diluted Mira/Brazz YFP expression colonies 25:1 in LB+AMP for eventual IPTG induction.  Will culture @ 37°C for 1 hour then take O/D's.
+<html><div id="entry"><span id="date"><a name="07-21-2010" class="date">07-21-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*  Ligated Strep tagged flavor proteins with stop codon
+'''Miraculin N/Brazzein C StrepII & Stop'''
+* We ran a confirmation digest on the miniprepped Miraculin N StrepII & Stop and the Brazzein C StrepII & Stop. We digested the samples with XbaI/PstI.  We should have used NotI/SpeI in this digest if we planned on inserting into V24 pETDUET vector.
+**We digested 558 ng of Mira N1, 516 ng Mira N2, 540 ng Brazz C1, and 551 ng Brazz C2 in 20 μL digestion reactions.
+* We also ran undigested samples of all four to help determine why the other ligations (Brazz N and Mira C) did not work.
+**We ran 279 ng of Mira N1, 258 ng Mira N2, 270 ng of Brazz C1, and 275.5 ng Brazz C2.
+''Gel''
+[[Image: Mira_brazz_strep_stop_confirm.jpg || 250px]]
+    Gel Lanes:
+. 1kb plus ladder
+. Mira N1 XbaI/PstI
+. Mira N2 XbaI/PstI
+. Brazz C1 XbaI/PstI
+. Brazz C2 XbaI/PstI
+. 1kb plus ladder
+. Mira N1 undigested
+. Mira N2 undigested
+. Brazz C1 undigested
+. Brazz C2 undigested
+*  Gel shows bands consistent with successful ligation!
+*  Gel extraction and purification of Miraculin, StrepII & Stop insert and Brazzein, StrepII & Stop insert.
+    ODs
+     Mira N1: 5.4 ng/μL
+     Mira N2: 3.1 ng/μL
+     Brazz C1: 6.1 ng/μL
+     Brazz C2: 10.1 ng/μL
+'''Ligation/Transformation of Mira/Brazz+StrepII'''
+*Our Miraculin and Brazzein constructs with StrepII tags (pre-cut with EcoR1/Spe1) were re-ligated to STOP+V0120 backbone
+{| border="1"
+|+ ''Ligation Reactions''
+!  !! Insert DNA !! BackBone DNA
+|-
+! Mira N
+| align="center" | 9 ng || align="center" |  49.5 ng
+|-
+! Mira C
+| align="center"  | 22.4 ng || align="center" | 49.5 ng
+|-
+! Brazz N
+| align="center"  | 37.4 ng || align="center" |  49.5 ng
+|-
+! Brazz C
+| align="center"  | 14.3 ng || align="center" |  53.4 ng
+|-
+! Control
+| align="center" | 0 ng || align="center" |  53.4 ng
+|-
+|}
+''NEB T4 Ligase was used for all reactions''
+'''Digestion & Gel Purification of V24'''
+* The pETDUET Expression Vector, V24, was digested with Not1/Spe1 for later use.
+'''1039.9 ng''' of DNA was digested in both reactions
+''Digestion reactions were run on a 1% Agarose gel at 125V for 30 min''
+[[Image:V42NotSpeDigestgel.jpg|240px]]
+    OD's
+     V24-1 N/S: 13.5 ng/μL
+     V24-2 N/S: 17.9 ng/μL
+<html><div id="entry"><span id="date"><a name="07-23-2010" class="date">07-23-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+* Genomic DNA extraction attempt from Valencia Oranges
+'''Genomic DNA extraction from Valencia Oranges'''
+* We used Qiagen DNeasy Plant Mini Kit
+* 100 mg (wet) sample from Flavedo tissue of orange
+* Samples had little DNA content and dirty 260/280
+    ODs
+     Orange genomic DNA 1-1: 1.8ng/μL (260/280: .82)
+     Orange genomic DNA 1-2: 1.1ng/μL (260/280: .68)
+     Orange genomic DNA 2-1: 2.6ng/μL (260/280: .85)
+     Orange genomic DNA 2-2: 2.1ng/μL (260/280: .89)
+* PCR ran with between 40ng and 95ng of genomic DNA
+* Extension time increased to 1:30
+'''Mira/Brazz StrepII & Stop'''
+* Miniprepped per Qiagen protocol and made glycerol stocks
+<html><div id="entry"><span id="date"><a name="07-26-2010" class="date">07-26-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Confirm ligation of stop codon with Strep tagged flavor proteins
+*PCR attempt for Valencene gene from Valencia orange genomic DNA failed
+*Digested miniprepped Mira/Brazz+StrepII+STOP constructs with Not1/Spe1 for ligation confirmation: <font color="red">failed</font>
+*Ran PCR product of Valencia Orange genome to confirm: <font color="red">failed</font>
+[[Image:StrepStopNotSpeValPCR.jpg|240px]] [[Image:StrepStopNotSpeValPCR2.jpg|240px]]
+*Digested Mira/Brazz+StrepII constructs EcoRI/SpeI, STOP+V0120 EcoRI/XbaI
+    Digestion Reactions
+     Mira N:  888ng
+     Mira C:  888ng
+     Brazz N: 993ng
+     Brazz C: 1032ng
+     STOP:    781ng x 2 (max DNA available)
+<html><div id="entry"><span id="date"><a name="07-27-2010" class="date">07-27-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Ligation of Strep tagged flavor proteins and stop into V0120
+*PCR attempt of Valencene gene from Valencia orange genomic DNA using Pfx polymerase
+'''Ligation of Mira/Brazz + StrepII to STOP + V0120'''
+*Insert to Backbone ration of 3:1
+    Miraculin: 34ng
+    Brazzein:  11ng
+    Backbone:  50ng
+*Ligations were transformed, plated onto LB+AMP and left overnight @ 37°C
+'''PCR of Valencene using Pfx Polymerase'''
+*Pfx polymerase was rumoured to be more accurate at PCR from genomic DNA
+    Specs:
+     DNA 1-1: 1.8 ng/μL
+     DNA 1-2: 1.1 ng/μL
+     DNA 2-1: 2.6 ng/μL
+     DNA 2-2: 2.2 ng/μL
+*1μL of each DNA sample was used for PCR.  Cycling procedure can be found here: http://www.invitrogen.com/etc/medialib/en/filelibrary/pdf.Par.79411.File.dat/platinumpfx_pps.pdf
+'''Mira/Brazz+StrepII+STOP confirmation digest'''
+    Digested DNA:
+     MN2: 211.2 ng
+     MC2: 190.2 ng
+     BN2:  184.4 ng
+     BC2:  219.2 ng
-==<html><a class="labnotebook" name="07-05-2010">07-05-2010</a></html> [ [[#top|top]] ]==
+*Digestions were run on a 1% agarose gel at 125V for 30 minutes.
+[[Image:MBconfirm2.jpg|240px]]
+#Ladder
+#MN2
+#MC2
+#BN2
+#BC2
+#Ladder
-==<html><a class="labnotebook" name="07-06-2010">07-06-2010</a></html> [ [[#top|top]] ]==
+<html><div id="entry"><span id="date"><a name="07-28-2010" class="date">07-28-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*PCR of Wintergreen pathway parts
+*Gel of Valencene PCR products shows failed PCR attempt
-==<html><a class="labnotebook" name="07-07-2010">07-07-2010</a></html> [ [[#top|top]] ]==
+'''PCR Confirmation'''
+* Ran gel to confirm Valencene PCR: <font color="red">failed</font>
+[[Image:ValPfxConfirm.jpg|240px]]
+# Ladder
+# DNA 1-1
+# DNA 1-2
+# DNA 2-1
+# DNA 2-2
+# Ladder
+''The numerical differentiation refers to the specific genomic DNA sample''
-==<html><a class="labnotebook" name="07-08-2010">07-08-2010</a></html> [ [[#top|top]] ]==
+'''PCR of Wintergreen parts'''
+* Ran PCR to extract J45004 and J45017 parts from the Wintergreen Pathway
+    Primers:
+     '''J45004_F'''
+     Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
+     '''J45004_R'''
+     Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)
+     '''J45017_F'''
+     Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
+     '''J45017_R'''
+     Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'
-==<html><a class="labnotebook" name="07-09-2010">07-09-2010</a></html> [ [[#top|top]] ]==
+The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf).  For template DNA, '''3.5 ng''' of the '''J45700''' BioBrick part (the entire wintergreen pathway) was used. <br/>
+[[Image:PhusionDetails.png|240px]] [[Image:PhusionCycle.png|240px]] <br/>
+''An annealing temperature of 62°C for 15s was used.  Polymerase was allowed to extend for 60s; Phusion Polymerase extends at 1kb/15s, our longest construct is 1.7 kb''
+''PCR Confirmation'' <br/>
+[[Image:004017PCRconfirm.jpg|240px]]
-==<html><a class="labnotebook" name="07-12-2010">07-12-2010</a></html> [ [[#top|top]] ]==
+#Ladder
+#J45004 PCR #1
+#J45004 PCR #2
+#J45017 PCR #1
+#J45017 PCR #2
+#Ladder
+*Both J45004 PCR reactions appear to have worked, with product at the expected size of 1.1 kb.
+*The J45017 PCR reactions appears to have amplified some of the wrong sequence, as suggested by the short DNA fragment.  However, the longer ~2 kb fragment in PCR #1 does appear to be around the correct length.
-==<html><a class="labnotebook" name="07-13-2010">07-13-2010</a></html> [ [[#top|top]] ]==
+<html><div id="entry"><span id="date"><a name="07-29-2010" class="date">07-29-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
+'''Summary'''
+*Miniprep strep tagged flavor proteins in V0120
+*Gel extract wintergreen pathway parts
-==<html><a class="labnotebook" name="07-14-2010">07-14-2010</a></html> [ [[#top|top]] ]==
+'''Minipreps'''
+*Miniprep of Mira/Brazz+StrepII+STOP in V0120
+'''Gel Extraction'''
+*Gel extraction of J45017:
-==<html><a class="labnotebook" name="07-15-2010">07-15-2010</a></html> [ [[#top|top]] ]==
+[[Image:Mira_brass_ss_digest.jpg||240px]]
+# Ladder
+# Mira N N/S
+# Mira C N/S
+# Brazz N N/S
+# Brazz C N/S
+# J45004 X/P
+# B21 X/P
+# J45017 undigested
+# Ladder
+<html><div id="entry"><span id="date"><a name="07-30-2010" class="date">07-30-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="07-16-2010">07-16-2010</a></html> [ [[#top|top]] ]==
+'''Summary'''
+* Ligated StrepII tagged proteins into V24 backbone
+* Ligated cut J45004 into V0120 backbone
+Ligations were plated and left @ 37°C O/N.
+<html><div id="entry"><span id="date"><a name="08-02-2010" class="date">08-02-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="07-19-2010">07-19-2010</a></html> [ [[#top|top]] ]==
+'''Summary'''
+*Ligation of wintergreen parts into v0120 backbone
-==<html><a class="labnotebook" name="07-20-2010">07-20-2010</a></html> [ [[#top|top]] ]==
+'''DTL of Mira/Brazz+StrepII+Stop into V24'''
+* Digested 1 microgram of DNA for each insert and for V24 backbone.
+** Digested inserts and backbone with NotI/SpeI
+* Gel extracted and purified bands indicated in image below
+* Ligated insert into 50ng of V24 backbone with a 3:1 insert to backbone ratio
+* Transformed and plated on LB+AMP plates and left in 37°C incubator overnight
-==<html><a class="labnotebook" name="07-21-2010">07-21-2010</a></html> [ [[#top|top]] ]==
+'''DTL of Wintergreen pathway'''
+* Digested 400ng of J45004, 20ng of J45017, and 1 microgram of B21 (for v0120 backbone)
+** Digested J45004, J45017, and B21 BB with XbaI/PstI
+* PCR purified digested inserts
+* Gel extracted and purified B21 BB (see gel image below)
+* Ligated inserts into 50ng of B21 v0120 backbone with a 3:1 insert to backbone ratio
+** Transformed and plated on LB+AMP plates and left in 37°C incubator overnight
-==<html><a class="labnotebook" name="07-22-2010">07-22-2010</a></html> [ [[#top|top]] ]==
+'''Gel Purification'''
+[[Image:Mbv24b21digest.jpg||240px]]
+# Ladder
+# Mira N SS
+# Mira C SS
+# Brazz N SS
+#Brazz C SS
+# V24 N/S
+# B21 X/P
+# Ladder
-==<html><a class="labnotebook" name="07-23-2010">07-23-2010</a></html> [ [[#top|top]] ]==
+*Gel bands indicated were cut and purified from the gel.
+<html><div id="entry"><span id="date"><a name="08-03-2010" class="date">08-03-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="07-26-2010">07-26-2010</a></html> [ [[#top|top]] ]==
+'''Summary'''
+*Miniprepped wintergreen pathway and strep tagged flavor proteins
+* Colonies were obtained from all ligations; 5mL cultures were started, left ~5hrs @ 37°C
+* Glycerol stocks were made (666μL glycerol: 333μL cells; 50% glycerol final)
+* Miniprepped per Qiagen protocol
-==<html><a class="labnotebook" name="07-27-2010">07-27-2010</a></html> [ [[#top|top]] ]==
+    ODs
+-1: 95.5 ng/μL
+-2: 124.5 ng/μL
+-1: 109.7 ng/μL
+-2: 77.5 ng/μL
+     Miraculin N+Strep+Stop: 61.5 ng/μL
+     Miraculin C+Strep+Stop: 78.5 ng/μL
+     Brazzein N+Strep+Stop: 83.4 ng/μL
+     Brazzein C+Strep+Stop: 99.4 ng/μL
+<html><div id="entry"><span id="date"><a name="08-04-2010" class="date">08-04-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="07-28-2010">07-28-2010</a></html> [ [[#top|top]] ]==
+'''Summary'''
+*Wintergreen pathway ligations into v0120 did not work. Retry ligations.
+'''Confirmation Digests'''
-==<html><a class="labnotebook" name="07-29-2010">07-29-2010</a></html> [ [[#top|top]] ]==
+* Ran confirmation digests of miniprepped J45004-1, J45004-2, J45017-1, J45017-2
+** Digested approximately 500ng with xbaI/speI
+* Ran confirmation digests of miniprepped Miraculin N strep+stop and V24, Miraculin C strep+stop and V24, Brazzein N strep+stop and V24, Brazzein C strep+stop and V24.
+** Digested 400-500ng with notI/speI
+[[Image:J45004_017_mira_brazz_ss_annotated.jpg||250px]]
-==<html><a class="labnotebook" name="07-30-2010">07-30-2010</a></html> [ [[#top|top]] ]==
+'''Retry Ligating j45004 and v0120'''
+* Used PCR purified J45004 that had been previously digested with xbaI/pstI
+* Used v0120 from Team Vector that they had digested with xbaI/pstI and used in a successful ligation
+* 3:1 insert to backbone ration used in ligation
+** 52ng of insert and 50ng v0120 backbone
+** J45004 insert is 1100 bp
+* Transformed and plated on LB+Amp plates and left overnight
+<html><div id="entry"><span id="date"><a name="08-05-2010" class="date">08-05-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="08-02-2010">08-02-2010</a></html> [ [[#top|top]] ]==
+'''Summary'''
+*Transformation of J45004
+*5μL of registry DNA was transformed with 15μL TURBO cells; mixture was plated on LB+AMP and left to grow O/N
+<html><div id="entry"><span id="date"><a name="08-06-2010" class="date">08-06-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="08-03-2010">08-03-2010</a></html> [ [[#top|top]] ]==
+'''Summary'''
+*Confirm wintergreen part ligation into v0120
+*Transform strep tagged flavor proteins into E45 expression E. Coli
+'''Confirmation Digest of J45004'''
+*J45004 in V0120 backbone; digested ~500ng DNA with Xba1/Pst1
-==<html><a class="labnotebook" name="08-04-2010">08-04-2010</a></html> [ [[#top|top]] ]==
+[[Image:J45004_confirm2.jpg||240px]] <br/>
+# 1 kb Ladder (Invitrogen)
+# 004-1
+# 004-2
+# 004-3
+# Ladder
-==<html><a class="labnotebook" name="08-05-2010">08-05-2010</a></html> [ [[#top|top]] ]==
+Backbone: 3.2 kb; Insert: 1.1 kb
+'''Analysis'''<br>
+Both the backbone and the insert in lane 1 look like the correct length (3.2 and 1.1 kb respectively).  Lane two consists of a backbone of the correct length, but the insert appears to be ~1.5 kb, too long for the J45004 BioBrick part.  Lane 3 appears undigested; we are uncertain as to why.
-==<html><a class="labnotebook" name="08-06-2010">08-06-2010</a></html> [ [[#top|top]] ]==
+'''Transformation of Mira/Brazz StrepII constucts into E45'''
+*100-200 ng of construct DNA was transformed with 15μL of E45 expression ''E. Coli''; transformation procedure was followed; transformed cells were plated on LB+AMP and left to grow O/N
+Transformations:
+Mira N1
+Mira N2
+Mira C1
+Mira C2
+Brazz N1
+Brazz N2
+Brazz C1
+Brazz C2
+<html><div id="entry"><span id="date"><a name="08-26-2010" class="date">08-26-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="08-09-2010">08-09-2010</a></html> [ [[#top|top]] ]==
+*Overnight cultures of ''E. Coli'' transformed with StrepII-tagged Miraculin and Brazzein under an inducible promoter were back-diluted to an optical-density of 0.1.
+*Cultures were allowed to reach an O/D of 0.5
+*IPTG was added to a final concentration of 100μM
+*After 3 hours, cultures were spun down, the supernatant removed and the bacteria frozen overnight at -80°C
+<html><div id="entry"><span id="date"><a name="08-27-2010" class="date">08-27-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="08-10-2010">08-10-2010</a></html> [ [[#top|top]] ]==
+*The IPTG induced bacteria were lysed with B-PER II lysis reagent via standard protocols
+*Total lysate was run on a 4-12% Bis-Tris NuPAGE gel and transferred to a PVDF membrane
+*Blocking buffer added, gel was left at 4°C overnight
+<html><div id="entry"><span id="date"><a name="08-28-2010" class="date">08-28-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="08-11-2010">08-11-2010</a></html> [ [[#top|top]] ]==
+*Blot was exposed to a StrepII-tag Antibody, HRP conjugate from Novagen
+*Left overnight at 4°C
+<html><div id="entry"><span id="date"><a name="08-29-2010" class="date">08-29-2010</a></span> [<a class="top" href="#notebook">top</a>]</div><hr /></html>
-==<html><a class="labnotebook" name="08-12-2010">08-12-2010</a></html> [ [[#top|top]] ]==
+*Blot was developed and imaged.
+[[Image:Western_Fig_2-crop.jpg|| 300px]]
-==<html><a class="labnotebook" name="08-13-2010">08-13-2010</a></html> [ [[#top|top]] ]==
+*Strong expression of Brazzein was seen, however Miraculin was not.  Despite this low expression, this could very well be a bacteria-specific reduction.

Team:Harvard/flavor/notebook

From 2010.igem.org

Latest revision as of 04:48, 27 October 2010

notebook