Team:SDU-Denmark/notebook

From 2010.igem.org

(Difference between revisions)
(→Phototaxis)
 
(25 intermediate revisions not shown)
Line 8: Line 8:
<br>
<br>
== Flagella ==
== Flagella ==
-
<br>
+
* Studied inhibition and activation of the FlhD/C operon. <br>
-
- Studied inhibition and activation FlhD/C operon. <br>
+
* We found out that PskA is an important inhibitor, which also is part of ribosome synthesis.
-
- Found out that PskA is an important inhibitor, which also is part of ribosome synthesis.
+
<br><br>
<br><br>
== Phototaxis ==  
== Phototaxis ==  
-
<br>
+
* Ordered proteorhodopsin biobrick [http://partsregistry.org/Part:BBa_I711040 I711040] <br>
-
* Ordered proteorhodopsin biobrick [http://partsregistry.org/Part:BBa_I711040 I611040] <br>
+
* Did research on the light-sensitive proteorhodopsin ionpump.  
* Did research on the light-sensitive proteorhodopsin ionpump.  
<br><br>
<br><br>
Line 22: Line 20:
<br>
<br>
== Flagella ==  
== Flagella ==  
-
<br>
+
* Read up on the flagella regulon using the following articles;
-
''''' July 1st ''''' <br>
+
<br><br>
-
''Progress report:'' <br>
+
-
The Last couple of days I’ve been reading up on the flagella regulon. We want to hyper flagellate our cells to see if this will create more power in our system. Therefore we need to know how the flagellar genes are regulated and if these genes are coupled to other processes than flagella synthesis. For this I’ve used the following articles; <br><br>
+
[http://ncbi.nlm.nih.gov/pmc/articles/PMC179437/pdf/1795602.pdf]  
[http://ncbi.nlm.nih.gov/pmc/articles/PMC179437/pdf/1795602.pdf]  
''Cell Cycle Regulation of Flagellar Genes'' <br>
''Cell Cycle Regulation of Flagellar Genes'' <br>
Line 34: Line 30:
Xiaoying Liu and Philip Matsumura <br>
Xiaoying Liu and Philip Matsumura <br>
Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, Illinois 60612-7344 <br><br>
Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, Illinois 60612-7344 <br><br>
-
- The flagellar regulon consists of at least 14 operons which encode more than 40 genes. The operons are divided into three classes with one master operon (FlhDC)in class I which encodes the transcription factors (TF)FlhD and -C. These TF activate the class II genes which entail FliA and Sigma factor-28. The class II gene products are TF's for the class III genes which amongst others code for the FliC protein. <br>
 
-
- The FlhDC operon is not only important in expression of flagella but also functions in the cell division. <br>
 
-
- The FlhDC operon is activated by environmental factors such as cAMP-CAP and H-NS. <br>
 
-
- All three classes of genes can be deactivated by DksA and ppGpp. DksA is also important for ribosomal expression. <br>
 
-
''Working Hypothesis:'' <br>
 
-
We thought about knocking DskA out and thereby rendering the FlhDC operon active. But since DksA is important for ribosomal expression knocking this gene out might have other severe consequences for the cells. <br>
 
-
We know that the FlhDC operon is an important factor in the cell cycle and we don't know if over-activation of this master operon will have important effects on the cell division.<br><br>
 
-
So we are now following the popular "trial-and-error" method and testing what effects it will have to put the FlhDC operon after a constitutive promoter.
 
-
If this does not have serious effects that will disturb our project, we hope to be able to get hyper flagellated cells. <br><br>
 
-
We hope the hyper flagellation will produce a more powerful flow in our system, but we are aware of the risk that the extra flagellas will only produce chaos. The extra flagellas increase the tumbling rate of the cells and this we don't want. We need a steady laminar flow so we want to reduce the tumbling as much as possible,but this is the focus of the phototaxis group. However, if the hyper flagellation does disrupt the system we have to drop the idea of overexpression and use E. coli with normal flagella expression. <br><br>
 
-
''BioBrick Design:'' <br>
 
-
I will work on the biobrick for this project tomorrow. <br>
 
-
 
-
--[[User:Louch07|Louch07]] 09:43, 2 July 2010 (UTC)
 
-
 
-
''''' July 2nd '''''
 
<br>
<br>
-
''Biobrick design:'' <br>
+
* Decided to follow the popular "trial-and-error" method and tested what effects it will have to put the FlhD/C operon after a constitutive active promoter.
-
We want to make a constitutive active FlhDC operon. For this we will use a sigma 70 promotor. Sigma 70 is a constitutive active housekeeping gene. We have ordered FlhDC and are waiting for it to arrive. Also we need a terminator and a ribosomal binding sequence (RBS). The promotor (BBa_J23100), the terminator (BBa_B0015) and the RBS (BBa_J61100) are all in the 2010 spring kit. <br><br>
+
* Ordered the FlhD/C primers.  
-
We have created this as a part on Partsregistry.org <br><br>
+
* Designed the biobrick ''K343000'' – ''FlhDCmut'' coding sequence <br><br>  
 +
<br><br>
== Phototaxis ==
== Phototaxis ==
-
<br>
+
* Decided to go back to the original idea for controlling phototaxis via a SRII/HtrII/EcTsr fusion-chimeric protein described in the following article; <br><br>
-
''''' July 1st ''''' <br>
+
-
''Progress report:'' <br>
+
-
We've gone back to our original idea for controlling phototaxis via a SRII/HtrII/EcTsr fusion-chimeric protein described in the following article; <br><br>
+
[http://pubs.acs.org/doi/abs/10.1021/bi034399q]
[http://pubs.acs.org/doi/abs/10.1021/bi034399q]
''Photostimulation of a Sensory Rhodopsin II/HtrII/Tsr Fusion Chimera Activates CheA-Autophosphorylation and CheY-Phosphotransfer in Vitro†'' <br>
''Photostimulation of a Sensory Rhodopsin II/HtrII/Tsr Fusion Chimera Activates CheA-Autophosphorylation and CheY-Phosphotransfer in Vitro†'' <br>
Line 70: Line 48:
Jung, Kwang-Hwan, Spudich, Elena N., Trivedi, Vishwa D., Spudich, John L. <br>
Jung, Kwang-Hwan, Spudich, Elena N., Trivedi, Vishwa D., Spudich, John L. <br>
J. Bacteriol. 2001 183: 6365-6371 <br><br>
J. Bacteriol. 2001 183: 6365-6371 <br><br>
-
- It works primarily by inducing autophosphorylation in CheA that in turn phosphorylates CheY into it's active state, that controls the flagellar switch. <br>
+
* Contacted the original researchers on the mentioned papers for the protein sequences and plasmids <br><br>
-
- It is activated by blue light. <br>
+
-
- CheY's effect on flagellar function is to increase the frequency of tumbling episodes. <br><br>
+
-
''Working Hypothesis:'' <br>
+
-
Right now our work with the Fusion-Chimeric photosensitive protein is oriented towards creating a negative feed-back regulation of our flow-generating system. We are working from the idea that inducing more frequent tumbling events in our bacterial colony will increase the amount of turbulence generated in our system, so as to reduce flow. Hereby we can control flow with light. <br><br>
+
-
''BioBrick Design:'' <br>
+
-
Since the fusion-chimeric protein is very large we will need to assemble it as a composite part. Luckily parts of it are connected by AA linker chains, we can exploit in our assembly, to reduce the effect of the BioBrick scar. Important considerations concerning staying in-frame and designing good BioBricks for assembly will be met in the coming days. <br><br>
+
-
Note: We need to contact the original researchers on the mentioned papers for protein sequences and possibly plasmids or strains of their bacteria. <br><br>
+
-
--[[User:CKurtzhals|CKurtzhals]] 19:38, 1 July 2010 (UTC)
+
== Retinal Production ==
-
<br><br>
+
* Decided that we would try to make our bacteria synthesize retinal endogenously.  
-
''''' July 2nd ''''' <br>
+
* Designed a new BioBrick around the ''ninaB'' gene from ''D. melanogaster'', which has shown to produce a beta-carotene 15,15'-monooxygenase [http://www.jbc.org/content/275/16/11915.long][http://www.ncbi.nlm.nih.gov/pmc/articles/PMC14720/?tool=pubmed].  
-
''Progress report:'' <br>
+
* Isolated the gene sequence and suggested biobricks for the coding region (K343001)
-
Today the decision to atempt to make our backteria synthesise retinal endogenously was made. We will be using old material from the Cambridge 2009 project (Part:BBa_K274210) to make our bacteria synthesise beta-carotene, and we have designed a new biobrick around the ninaB gene from D. melanogaster, that has been shown to produce a beta-carotene 15,15'-monooxygenase [http://www.jbc.org/content/275/16/11915.long][http://www.ncbi.nlm.nih.gov/pmc/articles/PMC14720/?tool=pubmed]. An enzyme that catalyses cleavage beta-carotene into two retinal molecules. This protein has been shown to function in E. <br> coli[http://www.jbc.org/content/275/16/11915.long[1]], along with a synthetic operon closely matching the one from the cambridge project. <br><br>
+
* Proposed three new biobricks
-
We have already isolated the gene sequence, and suggested biobricks for the coding region (BBa_K343001) and a combined part (BBa_K343002) that will work as a protein generator. The relevant cDNA is available for purchase, and should be easy to acquire. <br><br>
+
 
-
On top of this we deduced the coding sequence for the SopII-HtrII-Tsr fusion, chimera protein from Spudich et al. <br>
+
''K343001'' - Sandboxed coding sequence from ''ninaB'' gene. <br><br>
-
[http://jb.asm.org/cgi/content/full/183/21/6365] From the information given in the materials and methods section of the article, we could deduce the exact sequence. The amount of amino acid residues were given and the gene sequences known. From there we could find out where and how the gene sequences were stitched together. By that we could already sandbox the planned biobrick for the bluelight receptor sensory rhodopsin II coupled to the chemotaxis pathway of E.Coli via the HtrII and Tsr fusion. The next part is obtaining the physical DNA, for which we will have to contact Spudich lab and ask for a plasmid containing the chimera-protein. <br><br>
+
''K343002'' - Sandboxed coding sequence from ''ninaB'' gene on one of the weaker Anderson promoters, with rbs and dual terminator. <br><br>
-
''BioBrick Design:'' <br>
+
''K343003'' - Sandboxed coding sequence for the ''SopII-HtrII-Tsr'' fusion protein. <br><br>
-
Today we have proposed four biobricks: <br><br>
+
-
''BBa_K343000'' – FlhDCmut coding sequence <br><br>
+
-
''BBa_K343001'' - Sandboxed coding sequence from ninaB gene. <br><br>
+
-
''BBa_K343002'' - Sandboxed coding sequence from ninaB gene on one of the weaker Anderson promoters, with rbs and dual terminator. <br><br>
+
-
''BBa_K343003'' - Sandboxed coding sequence for the SopII-HtrII-Tsr fusion protein. <br><br>
+
-
The sequence for the D. melanogaster gene is taken from the cDNA sequence from flybase.org, and matched by length to the b-diox protein. Choice of promoter was made on the consideration that much of this enzyme might not be needed to supply sufficient retinal. Rbs and terminators are entirely standard. <br><br>
+
-
The Cambridge part needed is already on one of our distribution plates: 
+
-
Spring 2010 Distribution 2010 Kit Plate 3, Well 6N, pSB1A2 <br><br>
+
-
--[[User:CKurtzhals|CKurtzhals]] 17:11, 2 July 2010 (UTC), --[[User:Lclund|Lclund]] 13:34, 3 July 2010 (UTC)
+
-
<br><br>
+
''References:'' <br>
''References:'' <br>
-
1. ''Filling the gap in vitamin A research. Molecular identification of an enzyme cleaving beta-carotene to retinal.'',von Lintig J, Vogt K., J Biol Chem. 2000 Apr 21;275(16):11915-20. <br><br>
+
5. ''Filling the gap in vitamin A research. Molecular identification of an enzyme cleaving beta-carotene to retinal.'',von Lintig J, Vogt K., J Biol Chem. 2000 Apr 21;275(16):11915-20. <br><br>
-
2. ''Analysis of the blind Drosophila mutant ninaB identifies the gene encoding the key enzyme for vitamin A formation in vivo'', Johannes von Lintig,* Armin Dreher, Cornelia Kiefer, Mathias F. Wernet, and Klaus Vogt, Proc Natl Acad Sci U S A. 2001 January 30; 98(3): 1130–1135. <br><br>
+
6. ''Analysis of the blind ''Drosophila mutant'' ''ninaB'' identifies the gene encoding the key enzyme for vitamin A formation in vivo'', Johannes von Lintig,* Armin Dreher, Cornelia Kiefer, Mathias F. Wernet, and Klaus Vogt, Proc Natl Acad Sci U S A. 2001 January 30; 98(3): 1130–1135. <br><br>
-
3. "An Archaeal Photosignal-Transducing Module Mediates Phototaxis in Escherichia coli", Jung K-H, Spudich EN, Trivedi VD and Spudich JL ; Journal of Bacteriology, Nov. 2001, p. 6365–6371. <br><br>
+
-
 
+
-
''''' July 3rd '''''
+
-
<br>
+
-
''Progress report:'' <br>
+
-
We've not been doing any real project work today. Instead we've done work on the project description on the wiki, and made a couple of graphics.<br><br>
+
-
'''Other''' <br>
+
-
We've found an interesting project from the 2008 competition. Paris has apparently already worked with the flagellas regulation, although not with intent to produce flagella themselves. Instead they have worked on the regulation, and expression-cascade of flagella proteins, and their work might well help us figure out how we might hyperflagellate our backteria, or how we will model the system. <br><br>
+
-
 
+
-
--[[User:CKurtzhals|CKurtzhals]] 21:04, 3 July 2010 (UTC)
+
== Modelling ==  
== Modelling ==  
-
<br>
+
* Read articles about modelling the flagella movement and their influence on the water flow.  
-
''''' July 1st '''''
+
* Looked at the equations describing the system from the article to get an idea of how the physics is applied. The following articles was used in this progress; <br><br>
-
<br>
+
-
''Progress report:'' <br>
+
-
The last couple of days we have been reading articles about modelling the flagella movement and their influence on the water flow. Because we need to understand the physics of the system before we are able to model it. Today we have been looking at the equations describing the system from the article to get an idea of how the physics is applied. The following articles have been used in this progress; <br><br>
+
[http://docs.google.com/viewer?a=v&pid=wave&srcid=8e-fLRxU2&chrome=true]  
[http://docs.google.com/viewer?a=v&pid=wave&srcid=8e-fLRxU2&chrome=true]  
''Synchronization in a carpet of hydrodynamically coupled rotors with random intrinsic frequency'' N. Uchida 1 and R. Golestanian 2,  ELP(Europhysics Letters) volume 89, number 5. <br><br>
''Synchronization in a carpet of hydrodynamically coupled rotors with random intrinsic frequency'' N. Uchida 1 and R. Golestanian 2,  ELP(Europhysics Letters) volume 89, number 5. <br><br>
[http://docs.google.com/viewer?a=v&pid=wave&srcid=sz1nqWu52&chrome=true]
[http://docs.google.com/viewer?a=v&pid=wave&srcid=sz1nqWu52&chrome=true]
''The physics of flagellar motion of E. coli during chemotaxis'' M. Siva Kumar and P. Philominathan Biophysical Reviews Volume 2, Number 1 / February, 2010. <br><br>
''The physics of flagellar motion of E. coli during chemotaxis'' M. Siva Kumar and P. Philominathan Biophysical Reviews Volume 2, Number 1 / February, 2010. <br><br>
-
''Working hypothesise:'' <br>
+
* Met with our advisor Associate professor Julian C. Shillcock, PhD (SDU) who helped us plan a model for the system using the article; <br><br>
-
Understanding the physics of flagella systems, their movement in a fluid and their effects on the fluids, is important for setting up models describing the system we would like to produce. We haven’t yet found a model describing our system fully and this is therefore our next assignment. <br><br>
+
-
 
+
-
--[[User:Toand|Toand]] 15:29, 2 July 2010 (UTC)
+
-
<br><br>
+
-
''''' July 2nd '''''
+
-
<br>
+
-
''Progress report:'' <br>
+
-
Today we continued looking at the equations from the article, then had a meeting with Associate professor Julian C. Shillcock, PhD (SDU) who help us plan a model for the system. Our further work will consist of connecting the physics to the system and device equations that describe it. The article uses was: <br><br>
+
[http://docs.google.com/viewer?a=v&pid=wave&srcid=8e-fLRxU2&chrome=true]
[http://docs.google.com/viewer?a=v&pid=wave&srcid=8e-fLRxU2&chrome=true]
Synchronization in a carpet of hydrodynamically coupled rotors with random intrinsic frequency N. Uchida 1 and R. Golestanian 2, ELP(Europhysics Letters) volume 89, number 5.  <br><br>
Synchronization in a carpet of hydrodynamically coupled rotors with random intrinsic frequency N. Uchida 1 and R. Golestanian 2, ELP(Europhysics Letters) volume 89, number 5.  <br><br>
-
''Working hypothesise:'' <br>
 
-
A set of rigid screws with one end attached to a surface with the ability to bend in an angel θi and generate a force Fi. The forces generated by a screw may influence the angel of other screws and the effect the entire system witch in term affects the first screw. When the physics of the system is determined we hope to model variations of θi with the force Fi. <br><br>
 
-
 
-
--[[User:Toand|Toand]] 08:46, 4 July 2010 (UTC)
 
-
<br><br>
 
= Week 28 =
= Week 28 =
<br>  
<br>  
-
''''' July 7th '''''
+
== Flagella ==
-
<br>
+
* Extracted the FlhDC master operon from ''E. coli'' strain MG1655 <br>
-
''In the Lab:''
+
-
<br>
+
-
* Extracted FlhDC master operon from ''E. coli'' strain MG1655 <br>
+
* Showed pressence of pst1 site in FlhC <br>
* Showed pressence of pst1 site in FlhC <br>
* Introduced silent mutation into FlhC <br><br>
* Introduced silent mutation into FlhC <br><br>
-
Experiments: <br>
 
-
We are apparently having problems with our PCR since no PCR has worked for the last two days. This has resulted in three failed PCR experiments: <br>
 
-
-pSB1A2 <br>
 
-
-pSB1A3 <br>
 
-
-Genomic purification <br><br>
 
-
We had some succes with minipreps, and now have plasmids pSB1A2 and pSB1A3 ready for assemblies. <br><br>
 
-
We made six batches of competent cells, and made two transformations: <br>
 
-
-pBad L-arabinose inducible promoter <br>
 
-
-cambridge beta-carotene biosynthesis operon <br>
 
-
9 colonies of each were plated ON along with a positive and negative control. More transformations will follow tomorrow. <br><br>
 
-
''''' July 8th '''''
 
<br>
<br>
-
''Experiments:'' Today we were troubleshooting the PCR process, which miraculously worked today. We only used TAQ polymerase for the reactions today and no PFU. This helped us narrow the reason for the last few days failure down to either human error or bad PFU enzyme. The good news is that PCR is finally working, which means that we will be able to run some colony PCR tomorrow.<br><br>
+
== Retinal ==
-
We also transformed quite a few cells today. We did transformations for four different biobricks, BBa_J13002 (a TetR repressed generator), BBa_K274210 (Beta carotene enzymes), BBa_B0012 (double terminator) and BBa_K098995 (heat sensitive promoter). We will see tomorrow morning if the transformations were a success. <br><br>
+
* Transformed pSB1A2-J13002(TetR repressed generator), pSB1A2-K274210 (CrtEBIY under constitutive promoter), pSB1AK3-B0015 into ''E.coli'' MG1655
-
Last but not least we made an overnight culture of the biobrick backbone pSB3k3, which we'll use for miniprep tomorrow. <br><br>
+
-
== Flagella ==
+
-
<br>
+
-
''''' July 5th ''''' <br>
+
-
Today we have designed mutation primers, to remove a Pst1 site inside our operon. We have planned a silent mutation, so if we get it right it shouldn't affect our final protein.
+
-
<br>
+
-
''Biobrick design:''
+
-
<br>
+
-
FlhDC mutationsprimers:<br>
+
-
Passer til komplimentærstrengen:<br>
+
-
5' - GGCAGCTTTGCCCGCAGCTTATGTC - 3' (Melting point basic: 63°C)<br>
+
-
<br>
+
-
Passer til coding strand: <br>
+
-
5' - GACATAAGCTGCGGGCAAAGCTGCC - 3' (Melting point basic: 63°C) <br>
+
-
<br>
+
-
--CKurtzhals 20:04, 5 July 2010 (UTC)
+
-
 
+
-
<br>
+
-
''''' July 8th '''''
+
-
<br>
+
-
The FlhD,C group ran into some problems today regarding the primers for the silent mutation we want to introduce in our brick (for removing an illegal Pst1 site). The forward and reverse primers melting point is much too low in comparison to the mutation primers' melting point. We also hope to resolve that issue over the next few days. <br><br>
+
-
''''' July 9th '''''
+
-
<br>
+
-
''Overview of the projekt progress and process:'' <br>
+
-
1) We have had problems with out PCR's, none of them work! We have spent the last week trouble-shooting to find the problem and are down to the last few possible causes. It seems now, that the most likely cause is the annealing temperature of the primers, it is too low and the differences between the FW- and the RV-primers are too grate. We hope to solve the mystery soon. When the primer problem is solved we can finally extract the FlhDC operon from the bacteria. <br>
+
-
2) The FlhDC operon entails an internal PST1 site, so we need to induce a silent mutation. For this we need the primers mentioned yesterday. We have fixed the primer annealing temperature problem and have ordered the primers. We hope to get them medio next week.<br><br>
+
-
These two steps are the most urgent that we work on now. Later on we have to do as follows:<br><br>
+
-
3) We need to insert the FlhDC operon into the psb3k3 plasmid.<br><br>
+
-
4) The psb3k3-FlhDC plasmid has to be transformed into cells.<br><br>
+
-
5) Detect if cells are hyperflagellated.<br><br>
+
-
''Progress report:'' Pernille, Sheila and I have worked as a group for the first time today. We have done Miniprep to extract the plasmids we want to insert our biobricks in and Chromosomal DNA PCR to test our primers and the perfect annealing temperature(documented in ''labnotes'') <br><br>
+
-
''Working Hypothesis:'' No Change <br><br>
+
-
''BioBrick Design:'' No Change <br><br>
+
-
 
+
-
--[[User:Louch07|Louch07]] 16:00, 9 July 2010 (UTC)
+
-
 
+
-
 
+
-
== Phototaxis ==
+
-
<br>
+
-
''''' July 5th '''''
+
-
<br>
+
-
''Lab progress:''
+
-
* Transformed the [http://partsregistry.org/Part:BBa_K274210 Cambridge part] in to Top10 cells <br>
+
-
* Transformed an [http://partsregistry.org/Part:BBa_I0500 inducible promoter] in to Top10 cells <br>
+
-
* Transformed [http://partsregistry.org/Part:BBa_E0040 GFP] in to MG1655 cells <br>
+
-
<br>
+
-
''Progress report:''
+
-
<br>
+
-
Today we've designed primers and worked out how we plan to characterize our light sensor. The experiment has to determine how much our protein stimulates the kinase activity of CheA, and in turn the phosphorylation of CheY. <br> We plan to measure directly on CheY. <br>
+
-
<br>
+
-
''Exsperiment:'' <br>
+
-
- first we create a suspension of cells in water, keeping them in the dark until the experiment. <br><br>
+
-
- Then we take small microcapillary tubes, and use them to draw a specific amounts of fluid and bacteria from the suspension, as to ensure equal amounts of protein in our gels, more on which later. <br><br>
+
-
- We will then ad radio labeled ATP to our cells. (This step might be done earlier) <br><br>
+
-
- We now shine a colored light into our tube, varying wavelength and intensity in separate experiments.<br><br>
+
-
- After an equal length of time for each tube, we lyse the cells, and run the proteins through a gell. <br><br>
+
-
- We might need to tag our CheY with antibodies to show them, but in theory the only proteins that should increase in phosphorylation states would be CheY and CheA, and therefore the remaining bands should stay unchanged. <br>
+
-
<br>
+
-
We hope to show how the kinase activity of CheA on CheY is stimulated by our blue light, which wavelengths are optimal, and whether varying intensity of light has an effect on activity. <br>
+
-
<br>
+
-
''BioBrick Design:'' We designed and ordered the following primers: <br>
+
-
// Melting points calculated with Oligocalc [1]<br>
+
-
<br>
+
-
NpSRII-HtrII-EcTsr primers:<br>
+
-
Upstream primer:<br>
+
-
5' - GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGTGGGACTTACG - 3' (Melting point basic: 71°C) <br>
+
-
<br>
+
-
Downstream primer:<br>
+
-
5' - GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATTAAAATGTTTCCCAGTTCTCCTCG - 3' (Melting point basic: 71°C)<br>
+
-
<br>
+
-
ninaB primers (Retinal enzym):<br>
+
-
Upstream primer:<br>
+
-
5' - GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGCAGCCGGTGTCTTCAA - 3' (Melting point basic: 73°C)<br>
+
-
<br>
+
-
Downstream primer:<br>
+
-
5' - GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTACTAAATGGCATTGGGTGCAA - 3' (Melting point basic: 71°C) <br>
+
-
<br>
+
-
References: <br>
+
-
OligoCalc: http://www.basic.northwestern.edu/biotools/oligocalc.html
+
-
<br><br>
+
-
''''' July 6th '''''
+
-
<br>
+
-
''Morning Meeting:''
+
-
<br>
+
-
A morning meeting was held with our supervisors and instructors, to determine the overall structure of our lab activities. We came to consensus on dividing into three lab groups and a modelling group. The three lab groups will be working on: <br><br>
+
-
-The ninaB brick <br><br>
+
-
-The FlhDC operon <br><br>
+
-
-The Photosensor <br><br>
+
-
Each group will be responsible for further development of their bricks, construction and planning of experiments to characterize them. The modelling group will be responsible for advising groups on what characteristics to model. <br><br>
+
-
We've planned for the crash course team to attempt transformation of our bacteria with the cambridge part. These transformed strains will be used by the retinal group. <br><br>
+
-
We further reached consensus on office hours, cake issues and calendar issues. <br><br>
+
-
''In the lab:''
+
-
<br>
+
-
Participants in the lab-crash-course v. 2.0 have conducted to experiments. Both failed, but we have learned lessons for further lab-work. <br><br>
+
-
- Purification of Genomic DNA: We failed to collect a sufficient biomass. Use overnight cultures from now on. <br><br>
+
-
- Quick and dirty microwave-oven + primer PCR amplification of FlhDC operon: We might not have nuked the bacteria enough, or we might fave failed to design our pcr process properly. (did we remember primers?!) <br><br>
+
-
Phototaxis (Retinal and Fusion protein.) <br><br>
+
-
Progress report: From now on the phototaxis group will consist of Maria, LC, Tommy and Chritsian. We will prioritize work on the Drosophila retinal enzyme gene, until we get physical DNA for the synthetic protein. <br><br>
+
-
If we fail to establish contact with Spudich lab within 14 days, our work will shift to synthesizing the protein ourselves, using physical DNA from halobacteria and e. coli, together with the sequence and the recipe for success, found in their article. <br><br>
+
-
--CKurtzhals 19:42, 6 July 2010 (UTC)
+
-
<br><br>
+
-
''''' July 7th '''''
+
-
<br>
+
-
''Progress Report:'' <br>
+
-
We have not yet established contact with Spudich Lab, who are in possesion of strains with the physical DNA we need. Our cDNA from the Drosophila registry hasn't been ordered either. <br><br>
+
-
We might have to make the fusion protein ourselves. We are therefore looking into protocols for growing halobacteria. The ones we are interested, N. Pharaonis are apparently not able to grow well in standard agar, as they require large salt concentrations, and don't run on glucose since their glycolysis is non-functional. <br><br>
+
-
no real work has been done with regards to the retinal brick. <br<<br>
+
-
Working Hypothesis no changes here. <br><br>
+
-
--CKurtzhals
+
-
<br><br>
+
-
''''' July 8th '''''
+
-
<br>
+
-
We sent an email to the Spudich lab today, asking if we could get the SRII,HtrII,Tsr fusion,chimera-protein from them. Now we are just waiting (and hoping) for a positive answer, so that we will be able to proceed with this part of the project. <br><br>
+
-
''''' July 9th '''''
+
-
<br>
+
-
''progress report:'' We have run colony-PCR on the cambridge BBa_K274210 brick we have attempted to transform into our cells. We have also run colony pcr on a RBS, a RFP reporter and a heat inducible promoter. All but the K274210 colonies showed bands at correct lengths, and the RFP colonies had turned bright red.
+
-
<br>Jakob has ordered primers and cDNA from drosophila melanogaster.
+
-
<br>Lars Christian and Maria will be working over the weekend, to make overnight cultures, and freeze cells, so we will be ready to make a new batch of competent cells next week. We need both coli TOP10 and M1655.
+
-
<br><br>Troubleshooting on Cambridge brick:
+
-
<Br>We suspect our elongation time of being to short. This might explain the smear at the bottom of each well.
+
-
<Br>-The length of the part in this plasmid is 4856Bp.
+
-
<br>-The reaction rate for this enzyme is stated as 35-100nt/sec at 72°C and 40% of that at 55°C
+
-
<br>-we ran the elongation for 5 minutes at 55°C giving us 4200-12.000 nt/elongation.
+
-
<br><br>Another problem could be the length of our part. Apparently we are opperating on the limit of what the polymerase can do, most companies stating that it will work for 3-4kb and can be pressed to 5kb if conditions are optimal. Many also suggest increasing [MgCl2] at low yields. We might also attempt that. Yet another possibility is that our colonies didn't contain any plasmids with our part.
+
-
<br><br>We will be attempting new colony pcr in the coming week, with elongation set to at least 6 minutes at 55°C. Perhaps we will attempt it with two different polymerases, increasing [MgCl2] in the Taq mix.
+
-
<Br><br>We have considered other ways of getting physical dna for our fusion protein. Two options come to mind if we can't get it from spudich lab.
+
-
<br>- getting it synthesized
+
-
<br>- Maybe getting the strain with the natromonas proteins from the 2007 melbourne team.
+
-
<br><br>''working hypothosis'': No changes
+
-
<br><br>--[[User:CKurtzhals|CKurtzhals]] 21:23, 9 July 2010 (UTC)
+
-
 
+
-
 
+
-
== Modelling: ==
+
-
<br>
+
-
''''' July 5th '''''
+
<br>
<br>
-
''Progress report:'' Today we have been discussing Stokes and Navier-Stokes equations in relation to the system we would like to model. After witch we tried to identify a differential equation describing the system. The following physics books have been used: <br><br>
+
== Modelling ==
 +
* Discussed Stokes and Navier-Stokes equations in relation to the system we would like to model.  
 +
* Tied to identify a differential equation describing the system. The following physics books have been used: <br><br>
The theory of polymer dynamics, M. DOI, S. F. Edwards, oxford science publications, 4. edition 1992. <br><br>
The theory of polymer dynamics, M. DOI, S. F. Edwards, oxford science publications, 4. edition 1992. <br><br>
Physics of continuous matter, B. Lautrup, IOP publishing, 2005. <br><br>
Physics of continuous matter, B. Lautrup, IOP publishing, 2005. <br><br>
-
''Working hypothesises:'' a row of rigid screws with one end attached to a surface with the ability to bend in an angel θi and generate a force Fi. The forces generated by a screw may influence the angel of other screws and the effect the entire system witch in term affects the first screw. When the physics of the system is determined we hope to model variations of θi with the force Fi. <br>
+
* Started implementing our model.  
-
--Toand 19:06, 5 July 2010 (UTC)
+
-
<br>
+
-
''''' July 8th '''''
+
-
<br>
+
-
''Progress report:'' We have almost finished with the equation jumbling. We have been able to create some equations which we feel will describe the system accurately. Next we will try to implement these on a computer. When we fee sure about the system the equations and a sketch of the system will be put in the progress report.<br><br>
+
-
''Working hypothesises:'' No changes <br><br>
+
-
''''' July 9th '''''
+
<br><br>
<br><br>
-
''Progress report:'' We have started implementing our model. We are discussing which forces are actually effecting the system. Besides the forces produced by the flagellas, we are discussing whether the flagellas have a favored position that it would be pushed towards, when not effected by outer forces. We are also discussing whether thermal forces should be included.<br><br>
+
 
-
''Working Hypothesis:'' No Change. <br><br>
+
= Week 29 =
= Week 29 =
<br>
<br>
== Flagella ==
== Flagella ==
-
* Made FlhDCmut <br>
+
* Made the mutation the silent in the FlhDC operon <br>
== Retinal ==
== Retinal ==
Line 321: Line 101:
* pSB3C5-J04450 and pSB3T5-J04450 were transformed into ''E.coli'' TOP10 cells <br>
* pSB3C5-J04450 and pSB3T5-J04450 were transformed into ''E.coli'' TOP10 cells <br>
* pSB1A2-R0011 was transformed into ''E.coli'' TOP10 cells <br><br>
* pSB1A2-R0011 was transformed into ''E.coli'' TOP10 cells <br><br>
 +
 +
= Week 30 =
 +
* Ligated J13002 into pSB3T5 <br>
 +
= Week 31 =
 +
== Flagella ==
 +
* Showing prescence of pst1 site in native FlhDC and absence of pst1 site in mutated FlhDC
 +
= Week 32 =
 +
== Retinal==
 +
* Showing, by uV-VIS absorbance spectre, that TOP10- and MG1655-cells containing the K274210 biobrick(camebridge part)show grater absorbance than the wild types.
 +
= Week 33 =
 +
No Progress Report
 +
 +
= Week 34 =
 +
== Photosensor ==
 +
*Transformed B0015 into pSB3T5
= Week 35 =
= Week 35 =
Line 330: Line 125:
<br>
<br>
== Flagella ==
== Flagella ==
-
* flhD/Cmut was made using new mutaion primers
+
* FlhD/Cmut was made using new mutaion primers
-
* flhD/Cmut was ligated into pSB1C3 and plasmid was transformed into ''E.coli'' TOP10 cells.
+
* FlhD/Cmut was ligated into pSB1C3 and the plasmid was transformed into ''E.coli'' TOP10 cells.
<br>
<br>
== Photosensor ==
== Photosensor ==
Line 340: Line 135:
<br>
<br>
== Flagella ==
== Flagella ==
-
* FlhD/Cmut coding sequence (K343000)  was assembled with the double terminator (B0015) in pSB1AK3-B0015 and plasmid was transformed into ''E.coli'' TOP10 cells.
+
* FlhD/Cmut coding sequence (K343000)  was assembled with the double terminator (B0015) in pSB1AK3 and the plasmid was transformed into ''E.coli'' TOP10 cells.
<br>
<br>
== Photosensor ==
== Photosensor ==
Line 351: Line 146:
<br>
<br>
== Photosensor ==
== Photosensor ==
-
* Results from sequencing of NpSopII-NpHtrII-StTar coding sequence (K343003) in pSB1C3 and NpSopII-NpHtrII-StTar coding sequence (K343003) + Promoter + RBS (J13002) in pSB1AK3 was OK
+
* Results from sequencing of NpSopII-NpHtrII-StTar coding sequence (K343003) in pSB1C3 and NpSopII-NpHtrII-StTar coding sequence (K343003) + Promoter + RBS (J13002) in pSB1AK3 was OK.
<br><br>
<br><br>
= Week 39 =
= Week 39 =
<br>
<br>
== Retinal ==
== Retinal ==
-
* NinaB coding sequence + Promoter + RBS (K343005) was assembled with the double terminator (B0015) in pSB1AK3-B0015 and plasmid was transformed into ''E.coli'' TOP10 cells.
+
* NinaB coding sequence + Promoter + RBS (K343005) was assembled with the double terminator (B0015) in pSB1AK3 and the plasmid was transformed into ''E.coli'' TOP10 cells.
* pSB1C3-K343005 and pSB1A2-K274210 (CrtEBIY under constitutive promoter) was transformed into ''E.coli'' TOP10 and MG1655 cells
* pSB1C3-K343005 and pSB1A2-K274210 (CrtEBIY under constitutive promoter) was transformed into ''E.coli'' TOP10 and MG1655 cells
<br><br>
<br><br>
Line 362: Line 157:
<br>
<br>
== Retinal ==
== Retinal ==
-
* NinaB coding sequence + Promoter + RBS (K343005) was assembled with the double terminator (B0015) in pSB1AK3-B0015 and transformed into ''E.coli'' TOP10 and MG1655 cells
+
* NinaB coding sequence + Promoter + RBS (K343005) was assembled with the double terminator (B0015) in pSB1AK3 and transformed into ''E.coli'' TOP10 and MG1655 cells
<br><br>  
<br><br>  
= Week 41 =
= Week 41 =
<br>
<br>
== Flagella ==
== Flagella ==
-
* flhD/Cmut composite part (K343004) was ligated into pSB1C3 and pSB3K3 and plasmids were transformed into ''E.coli'' TOP10 and MG1655 cells.
+
* FlhD/Cmut composite part (K343004) was ligated into pSB1C3 and pSB3K3 and plasmids were transformed into ''E.coli'' TOP10 and MG1655 cells.
<br>
<br>
== Retinal ==
== Retinal ==
Line 375: Line 170:
<br>
<br>
== Flagella ==
== Flagella ==
-
* Results of sequencing of flhD/Cmut composite part (K343004) in pSB1C3 was OK
+
* Results of sequencing of flhD/Cmut composite part (K343004) in pSB1C3 was OK. Motility plates, flagella staining and phase microscopy was made.
<br>
<br>
== Photosensor ==
== Photosensor ==
-
* MG1655/pSB3T5-K343007 (NpSopII-NpHtrII-StTar composite part) was sequenced on THOR from [http://www.unisensor.dk/ Unisensor]
+
* MG1655/pSB3T5-K343007 (NpSopII-NpHtrII-StTar composite part) was examined on THOR from [http://www.unisensor.dk/ Unisensor]
</div>
</div>
<div id="rightcolumn">
<div id="rightcolumn">
 +
[[Image:Team SDU-Denmark-pearl logo.JPG |150px]]
 +
<br><p style="text-align: left;">
 +
The iGEM team had a fun afternoon playing kindergarteners with the Students' Association and Louise made this lovely iGEM DENMARK logo out of plastic pearls. She didn't realize she had written 21010 instead of 2010 until the pearls were melted together though... rookie mistake. </p><br>
__TOC__
__TOC__
-
<br>
 
-
[[Image:Team SDU-Denmark-pearl logo.JPG |150px]]
 
-
<br>
 
-
The iGEM team had a fun afternoon with many other students when it was "kindergarden day" at the students assiciation on the BMB institute. There were cake, popcorn and juice. You could play different games, like Mario Cart on Nintendo 64 and Kalaha, some painted their own coffee mug and Louise made a plastic pearl iGEM DENMARK logo. She didn't realize she had written 21010 instead of 2010 untill she had melted the pearls together though...rookie mistake <br>
 
-
{{ #calendar: title=SDU-Denmark |year=2010 | month=06 }}<br><br>
 
-
{{ #calendar: title=SDU-Denmark |year=2010 | month=07 }}
 
</div>
</div>
</div>
</div>
 +
{{:Team:SDU-Denmark/css2}}
 +
{{:Team:SDU-Denmark/navi2}}
 +
<div id="subnavi">
 +
<div id="leftcolumn">

Latest revision as of 02:11, 28 October 2010

Retrieved from "http://2010.igem.org/Team:SDU-Denmark/notebook"