Team:Imperial College London/Software Tool
From 2010.igem.org
(11 intermediate revisions not shown) | |||
Line 21: | Line 21: | ||
det[6] = "This protease is produced by the ''leishmania'' parasites which cause leishmaniasis, an NTD. Diagnosis currently takes at least 20 minutes and requires microscopy. Our kit would allow rapid detection with very simple apparatus. "; | det[6] = "This protease is produced by the ''leishmania'' parasites which cause leishmaniasis, an NTD. Diagnosis currently takes at least 20 minutes and requires microscopy. Our kit would allow rapid detection with very simple apparatus. "; | ||
det[7] = "This cysteine protease is made by the Tobacco Etch Virus (TEV). It is often used as a molecular biology tool as it is very well characterised and has a high degree of activity and specificity."; | det[7] = "This cysteine protease is made by the Tobacco Etch Virus (TEV). It is often used as a molecular biology tool as it is very well characterised and has a high degree of activity and specificity."; | ||
+ | det[8] = "Caspases are used extensively in ''in vitro'' studies. They play a crucial role in apoptosis, including degrading genomic DNA and breaking down the cytoskeleton. Caspase 3 is an effector caspase and also plays a key role in the development of various human tissues."; | ||
+ | det[9] = "Caspase 5 is an inflammatory caspase and is involved in cytokine maturation."; | ||
+ | det[10] = "Caspase 9 is an initiator caspase and cleaves inactive pro-forms of effector caspases, thereby activating them"; | ||
var prefix = "GAATTCGCGGCCGCTTCTAG"; | var prefix = "GAATTCGCGGCCGCTTCTAG"; | ||
var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGT"; | var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGT"; | ||
Line 35: | Line 38: | ||
cleavage[6] = "CTGATTGCGTATCTGAAAAAAGCGACC"; | cleavage[6] = "CTGATTGCGTATCTGAAAAAAGCGACC"; | ||
cleavage[7] = "GAAAACTTATACTTCCAAGGA"; | cleavage[7] = "GAAAACTTATACTTCCAAGGA"; | ||
+ | cleavage[8] = "GACATGCAAGACGGA"; | ||
+ | cleavage[9] = "TTAGAACATGACGGA"; | ||
+ | cleavage[10] = "TTAGAACATGACGGA"; | ||
var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | ||
var terminator = "TAATAA"; | var terminator = "TAATAA"; | ||
Line 83: | Line 89: | ||
<option value="6">Leishmanolysin</option> | <option value="6">Leishmanolysin</option> | ||
<option value="7">TEV</option> | <option value="7">TEV</option> | ||
+ | <option value="8">Caspase 3</option> | ||
+ | <option value="9">Caspase 5</option> | ||
+ | <option value="10">Caspase 9</option> | ||
</select> | </select> | ||
</html> | </html> | ||
Line 111: | Line 120: | ||
</html>''' | </html>''' | ||
|- | |- | ||
- | + | | | |
'''<span style="color:#F6CF39">Yellow</span> - Biobrick Prefix/Suffix''' | '''<span style="color:#F6CF39">Yellow</span> - Biobrick Prefix/Suffix''' | ||
Line 129: | Line 138: | ||
'''<span style="color:#9DB742">Light Green</span> - Terminator''' | '''<span style="color:#9DB742">Light Green</span> - Terminator''' | ||
+ | |[[Image:ICswticon.png|500px]] | ||
+ | |} | ||
+ | {| style="width:900px;background:#f5f5f5;text-align:justify;font-family: helvetica, arial, sans-serif;color:#555555;margin-top:5px;" cellspacing="20" | ||
+ | |style="font-family: helvetica, arial, sans-serif;font-size:2em;color:#ea8828;"|What else could we attach to a cell wall binding domain? | ||
+ | |- | ||
+ | | | ||
+ | '''Attaching enzymes to the surface of ''B. subtilis'':''' | ||
+ | |||
+ | This could be used for a variety of applications including biofuel production. In order for ''B. subtilis'' to absorb lignocellulose material, and use it to produce biofuels, this material first needs to be broken down into monosaccharides. Lignocellulose breakdown enzymes, such as cellulase, hemicellulase, and ligninase. could therefore be attached to the surface of ''B. subtilis''. | ||
+ | |||
+ | |||
+ | '''Flagellin: A Pathogen-associated molecular pattern (PAMP):''' | ||
+ | |||
+ | PAMPs are sensed by our innate immune system, specifically by pattern-recognition receptors (PRRs). PAMPs are often shared between many different classes of microbes, so they work well as a generic target for the immune system early on in an infection. | ||
+ | |||
+ | Flagellin is one such PAMP and is recognised by a PRR called Toll-like receptor 5 (TLR-5). Flagellin monomers make up flagella of many bacteria, giving them motility which often confers pathogenicity. | ||
+ | |||
+ | Engineering a flagellin monomer to be bound to the exterior of our organism could initiate an immune response, such as the production of the cytokine TNF (tumor necrosis factor) which could help inhibit viral replication in the body. | ||
+ | |||
+ | |||
+ | '''Antigen presentation:''' | ||
+ | |||
+ | Antigen presentation is vital when initiating the adaptive immune response. There are many different proteins that we could engineer to be on the surface of our organism, in order for the organism to be phagocytosed by antigen presenting cells (APCs). These APCs would then display the antigen on their surface, held in place by a majorhistocompatability complex (MHC) Class II molecule. | ||
+ | |||
+ | Using this system one could initiate long-term immunity to a variety of pathogens. | ||
+ | |||
+ | |||
+ | |||
+ | '''DNA binding proteins:''' | ||
+ | |||
+ | This could be a very useful application for our system because it could be used to bind DNA in the extracellular environment. We could use DNA-binding domains (DBDs) from proteins like transcription factors to bind a specific DNA sequence. | ||
+ | |||
+ | |||
+ | |||
+ | '''Gene expression libraries:''' | ||
+ | |||
+ | By attaching each member of a protein library to the surface of a cell, it would be possible to screen for ligands to the proteins. This could be applied to the testing of ligand-binding of proteins after site-directed mutagenesis, allowing the identification of key amino acid residues for ligand binding. | ||
|} | |} |
Latest revision as of 03:57, 28 October 2010
Software Tool |
We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct. |
What else could we attach to a cell wall binding domain? |
Attaching enzymes to the surface of B. subtilis: This could be used for a variety of applications including biofuel production. In order for B. subtilis to absorb lignocellulose material, and use it to produce biofuels, this material first needs to be broken down into monosaccharides. Lignocellulose breakdown enzymes, such as cellulase, hemicellulase, and ligninase. could therefore be attached to the surface of B. subtilis.
PAMPs are sensed by our innate immune system, specifically by pattern-recognition receptors (PRRs). PAMPs are often shared between many different classes of microbes, so they work well as a generic target for the immune system early on in an infection. Flagellin is one such PAMP and is recognised by a PRR called Toll-like receptor 5 (TLR-5). Flagellin monomers make up flagella of many bacteria, giving them motility which often confers pathogenicity. Engineering a flagellin monomer to be bound to the exterior of our organism could initiate an immune response, such as the production of the cytokine TNF (tumor necrosis factor) which could help inhibit viral replication in the body.
Antigen presentation is vital when initiating the adaptive immune response. There are many different proteins that we could engineer to be on the surface of our organism, in order for the organism to be phagocytosed by antigen presenting cells (APCs). These APCs would then display the antigen on their surface, held in place by a majorhistocompatability complex (MHC) Class II molecule. Using this system one could initiate long-term immunity to a variety of pathogens.
DNA binding proteins: This could be a very useful application for our system because it could be used to bind DNA in the extracellular environment. We could use DNA-binding domains (DBDs) from proteins like transcription factors to bind a specific DNA sequence.
Gene expression libraries: By attaching each member of a protein library to the surface of a cell, it would be possible to screen for ligands to the proteins. This could be applied to the testing of ligand-binding of proteins after site-directed mutagenesis, allowing the identification of key amino acid residues for ligand binding. |