Team:Imperial College London/Software Tool

From 2010.igem.org

(Difference between revisions)

Latest revision as of 03:57, 28 October 2010

Department of Bioengineering

Division of Molecular Biosciences

Software Tool

We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct.

Select Protease	Description
	This was our primary target. Read our wiki to find out more!

Awaiting sequence generation...
Yellow - Biobrick Prefix/Suffix Orange - Promoter Red - Ribosome Binding Site Violet - Scar Purple - Cell Wall Binding Domain Dark Blue - Adjustable Linker Light Blue - Protease Cleavage Site Dark Green - Autoinducing Peptide Light Green - Terminator

What else could we attach to a cell wall binding domain?

Attaching enzymes to the surface of B. subtilis:

This could be used for a variety of applications including biofuel production. In order for B. subtilis to absorb lignocellulose material, and use it to produce biofuels, this material first needs to be broken down into monosaccharides. Lignocellulose breakdown enzymes, such as cellulase, hemicellulase, and ligninase. could therefore be attached to the surface of B. subtilis.

Flagellin: A Pathogen-associated molecular pattern (PAMP):

PAMPs are sensed by our innate immune system, specifically by pattern-recognition receptors (PRRs). PAMPs are often shared between many different classes of microbes, so they work well as a generic target for the immune system early on in an infection.

Flagellin is one such PAMP and is recognised by a PRR called Toll-like receptor 5 (TLR-5). Flagellin monomers make up flagella of many bacteria, giving them motility which often confers pathogenicity.

Engineering a flagellin monomer to be bound to the exterior of our organism could initiate an immune response, such as the production of the cytokine TNF (tumor necrosis factor) which could help inhibit viral replication in the body.

Antigen presentation:

Antigen presentation is vital when initiating the adaptive immune response. There are many different proteins that we could engineer to be on the surface of our organism, in order for the organism to be phagocytosed by antigen presenting cells (APCs). These APCs would then display the antigen on their surface, held in place by a majorhistocompatability complex (MHC) Class II molecule.

Using this system one could initiate long-term immunity to a variety of pathogens.

DNA binding proteins:

This could be a very useful application for our system because it could be used to bind DNA in the extracellular environment. We could use DNA-binding domains (DBDs) from proteins like transcription factors to bind a specific DNA sequence.

Gene expression libraries:

By attaching each member of a protein library to the surface of a cell, it would be possible to screen for ligands to the proteins. This could be applied to the testing of ligand-binding of proteins after site-directed mutagenesis, allowing the identification of key amino acid residues for ligand binding.

@@ Line 7: / Line 7: @@
 {| style="width:900px;background:#f5f5f5;text-align:justify;font-family: helvetica, arial, sans-serif;color:#555555;margin-top:5px;" cellspacing="20"
 |style="font-family: helvetica, arial, sans-serif;font-size:2em;color:#ea8828;width:300px;"|Select Protease
-|style="width:120px;"|
 |style="font-family: helvetica, arial, sans-serif;font-size:2em;color:#ea8828;"|Description
 |-
@@ Line 20: / Line 19: @@
    det[4] = "Detecting this coagulation factor could be a way of determining if patients should be given warfarin or a low molecular weight heparin (LMWH) if they are displaying atrial fibrilation following a stroke. Factor X is the first member of the thrombin pathway which essentially leads to blood clotting.";
    det[5] = "The complement system is part of the innate immune response to an acute infection. Detecting C3 convertase could give medical professionals a rapid method of seeing if a patient is fighting an acute infection.";
+  det[6] = "This protease is produced by the ''leishmania'' parasites which cause leishmaniasis, an NTD. Diagnosis currently takes at least 20 minutes and requires microscopy. Our kit would allow rapid detection with very simple apparatus. ";
+  det[7] = "This cysteine protease is made by the Tobacco Etch Virus (TEV). It is often used as a molecular biology tool as it is very well characterised and has a high degree of activity and specificity.";
+ det[8] = "Caspases are used extensively in ''in vitro'' studies. They play a crucial role in apoptosis, including degrading genomic DNA and breaking down the cytoskeleton. Caspase 3 is an effector caspase and also plays a key role in the development of various human tissues.";
+ det[9] = "Caspase 5 is an inflammatory caspase and is involved in cytokine maturation.";
+ det[10] = "Caspase 9 is an initiator caspase and cleaves inactive pro-forms of effector caspases, thereby activating them";
    var prefix = "GAATTCGCGGCCGCTTCTAG";
    var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGT";
@@ Line 32: / Line 36: @@
    cleavage[4] = "ATCGACGGACGT";
    cleavage[5] = "TTATTATCTCGTTCTGAAGAAGAC";
+  cleavage[6] = "CTGATTGCGTATCTGAAAAAAGCGACC";
+  cleavage[7] = "GAAAACTTATACTTCCAAGGA";
+  cleavage[8] = "GACATGCAAGACGGA";
+  cleavage[9] = "TTAGAACATGACGGA";
+  cleavage[10] = "TTAGAACATGACGGA";
    var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA";
    var terminator = "TAATAA";
@@ Line 67: / Line 76: @@
   #paraselect {
    width:300px;
-   height:25px;
+   height:28px;
    font-size:1.5em;
    color:#555555;
@@ Line 78: / Line 87: @@
    <option value="4">Factor Xa</option>
    <option value="5">C3 Convertase</option>
+  <option value="6">Leishmanolysin</option>
+  <option value="7">TEV</option>
+  <option value="8">Caspase 3</option>
+  <option value="9">Caspase 5</option>
+  <option value="10">Caspase 9</option>
 </select>
 </html>
-|<html>
+|'''<html>
+<p id="parades">This was our primary target. Read our wiki to find out more!</p>
+</html>'''
+|-
+|align="center"|<html>
 <style type="text/css">
 #parago {
    width:120px;
-   height:25px;
+   height:28px;
    font-size:1.5em;
    color:#555555;
@@ Line 91: / Line 109: @@
 <button type="button" id="parago">Generate!</button>
 </html>
-|'''<html>
+|
-<p id="parades">This was our primary target. Read our wiki to find out more!</p>
-</html>'''
 |-
 |style="width:860px;background:#d5d5d5;border: solid 20px #d5d5d5;" colspan="3"|'''<html>
@@ Line 104: / Line 120: @@
 </html>'''
 |-
-|colspan="3"|
+|
 '''<span style="color:#F6CF39">Yellow</span> - Biobrick Prefix/Suffix'''
@@ Line 122: / Line 138: @@
 '''<span style="color:#9DB742">Light Green</span> - Terminator'''
+|[[Image:ICswticon.png|500px]]
+|}
+{| style="width:900px;background:#f5f5f5;text-align:justify;font-family: helvetica, arial, sans-serif;color:#555555;margin-top:5px;" cellspacing="20"
+|style="font-family: helvetica, arial, sans-serif;font-size:2em;color:#ea8828;"|What else could we attach to a cell wall binding domain?
+|-
+|
+'''Attaching enzymes to the surface of ''B. subtilis'':'''
+This could be used for a variety of applications including biofuel production. In order for ''B. subtilis'' to absorb lignocellulose material, and use it to produce biofuels, this material first needs to be broken down into monosaccharides. Lignocellulose breakdown enzymes, such as cellulase, hemicellulase, and ligninase. could therefore be attached to the surface of ''B. subtilis''.
+'''Flagellin: A Pathogen-associated molecular pattern (PAMP):'''
+PAMPs are sensed by our innate immune system, specifically by pattern-recognition receptors (PRRs). PAMPs are often shared between many different classes of microbes, so they work well as a generic target for the immune system early on in an infection.
+Flagellin is one such PAMP and is recognised by a PRR called Toll-like receptor 5 (TLR-5). Flagellin monomers make up flagella of many bacteria, giving them motility which often confers pathogenicity.
+Engineering a flagellin monomer to be bound to the exterior of our organism could initiate an immune response, such as the production of the cytokine TNF (tumor necrosis factor) which could help inhibit viral replication in the body.
+'''Antigen presentation:'''
+Antigen presentation is vital when initiating the adaptive immune response. There are many different proteins that we could engineer to be on the surface of our organism, in order for the organism to be phagocytosed by antigen presenting cells (APCs). These APCs would then display the antigen on their surface, held in place by a majorhistocompatability complex (MHC) Class II molecule.
+Using this system one could initiate long-term immunity to a variety of pathogens.
+'''DNA binding proteins:'''
+This could be a very useful application for our system because it could be used to bind DNA in the extracellular environment. We could use DNA-binding domains (DBDs) from proteins like transcription factors to bind a specific DNA sequence.
+'''Gene expression libraries:'''
+By attaching each member of a protein library to the surface of a cell, it would be possible to screen for ligands to the proteins. This could be applied to the testing of ligand-binding of proteins after site-directed mutagenesis, allowing the identification of key amino acid residues for ligand binding.
 |}