|
|
(11 intermediate revisions not shown) |
Line 10: |
Line 10: |
| |colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4''' | | |colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4''' |
| |- style="background:#f2f2f2; color:#78b41e" | | |- style="background:#f2f2f2; color:#78b41e" |
- | |'''5'''||'''6'''||'''7'''||'''8'''||'''9'''||'''10'''||'''11''' | + | |'''[https://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#05.2F07.2F2010 5]'''||'''6'''||'''7'''||'''8'''||'''9'''||'''10'''||'''11''' |
| |- style="background:#f2f2f2; color:#78b41e" | | |- style="background:#f2f2f2; color:#78b41e" |
- | |'''12'''||'''13'''||'''14'''||'''15'''||'''16'''||'''17'''||'''18''' | + | |'''[https://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#12.2F07.2F2010 12]'''||'''13'''||'''14'''||'''15'''||'''16'''||'''17'''||'''18''' |
| |- style="background:#f2f2f2; color:#78b41e" | | |- style="background:#f2f2f2; color:#78b41e" |
- | |'''19'''||'''20'''||'''21'''||'''22'''||'''23'''||'''24'''||'''25''' | + | |'''19'''||'''20'''||'''21'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#23.2F07.2F2010 23]'''||'''24'''||'''25''' |
| |- style="background:#f2f2f2; color:#78b41e" | | |- style="background:#f2f2f2; color:#78b41e" |
- | |'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''||colspan="1"| | + | |'''[https://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#27.2F07.2F2010 27]'''||'''28'''||'''29'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#31.2F07.2F20103 1]'''||colspan="1"| |
| |- style="background:#f2f2f2; color:#78b41e" | | |- style="background:#f2f2f2; color:#78b41e" |
| |colspan="7"| | | |colspan="7"| |
Line 84: |
Line 84: |
| <span style="color:#ffffff">-</span> | | <span style="color:#ffffff">-</span> |
| |} | | |} |
- |
| |
- | [[Image:Example.jpg|center|250px]]
| |
| | | |
| {{:Team:Heidelberg/Side_Bottom}} | | {{:Team:Heidelberg/Side_Bottom}} |
Line 91: |
Line 89: |
| =miMeasure= | | =miMeasure= |
| | | |
- | ===Analysis of binding sites against synthetic miRNA miRsAg===
| + | miMeasure allows to quantitatively detect endogenous miRNA in different cells. To detect miRNA one should clone binding site for it into 3' UTR of GFP gene. To ensure that transfection efficiency or amount of cells do not affect result we decided to include reference fluorescence protein, BFP to allow normalisation. |
| | | |
- | 5000 Hela cells were seeded on day one in each well of the 96 well plate. Transfection of the constructs (M12-M22) with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 5 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.
| |
| | | |
- | Condition a: cotransfection with stuffer (salmon sperm DNA)
| + | [[Image:MiMeasure.png|500px|left|miMeasure plasmid]] |
| | | |
- | Condition b: cotransfection with synthetic RNA miRsAg
| |
- |
| |
- | Condition c: cotransfection with empty pcDNA5
| |
- |
| |
- | Condition d: cotransfection with synthetic shRNA3
| |
- |
| |
- | A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d.
| |
- |
| |
- | The cells were used for measurements on day three.
| |
- |
| |
- |
| |
- | [[Image:M12-M22_HeLa_daten.jpg|thumb|600px|left|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs (M12-22) including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]
| |
- |
| |
- | ====Table1====
| |
- |
| |
- |
| |
- | {| class="wikitable sortable" border="0" style="text-align: left"
| |
- | |-bgcolor=#cccccc
| |
- | |+ align="top, left"|'''table 1''': used binding sites and their features
| |
- | |sequence||binding site feature||Name/number||
| |
- | |-
| |
- | |ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||M12
| |
- | |-
| |
- | |ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12||M13
| |
- | |-
| |
- | |ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 10-12||M14
| |
- | |-
| |
- | |ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||M15
| |
- | |-
| |
- | |ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||M16
| |
- | |-
| |
- | |ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||M17
| |
- | |-
| |
- | |ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||M18
| |
- | |-
| |
- | |ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 9||M20
| |
- | |-
| |
- | |ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 9||M22
| |
- | |-
| |
- | |-||miMeasure without any binding site||NC (negative control)
| |
- | |-
| |
- | |}
| |
- |
| |
- |
| |
- |
| |
- | ==== miraPCR: analysis of endogenous miRNA====
| |
- |
| |
- | Hela and Huh7 cells were transfected with the constructs miM-r12, miM-r22, miM-1.3-7 and miM-3.1-8 (see table2). These constructs contain binding sites against miR-122. Since Huh7 cells express miR-122, the constructs will be affected in the Huh7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the Hela cells.
| |
- | The transfection is done with lipofectamin. 70ng of total DNA is used and for Hela cells the miRNA to miMeasure construct ratio was 2:1. The cells were imaged one day after trasnfection with the Leica confocal microspe. The result shows the ratio between GFP and BFP normalized to the negative control, where miMeasure constructs without binding sites are transfected. The miMeasure construct with one perfect binding site is also transfected.
| |
- |
| |
- |
| |
- |
| |
- |
| |
- | <center>
| |
- | ====Table2====
| |
- |
| |
- |
| |
- | {| class="wikitable sortable" border="0" style="text-align: left"
| |
- | |-bgcolor=#cccccc
| |
- | |+ align="top, left"|'''table 2''': raPCR designed binding sites and their features
| |
- | |binding site feature||Name/number
| |
- | |-
| |
- | |miMeasure with 3 aligned perfect binding sites||miM-1.3-7
| |
- | |-
| |
- | |miMeasure with two imperfect binding sites||miM-3.1-8
| |
- | |-
| |
- | |miMeasure with randomised nucleotides 9-12||miM-r12
| |
- | |-
| |
- | |miMeasure with randomised nucleotides 9-22||miM-r22
| |
- | |-
| |
- | |}
| |
- | </center>
| |
| | | |
| {{:Team:Heidelberg/Single_Bottom}} | | {{:Team:Heidelberg/Single_Bottom}} |
miMeasure
miMeasure allows to quantitatively detect endogenous miRNA in different cells. To detect miRNA one should clone binding site for it into 3' UTR of GFP gene. To ensure that transfection efficiency or amount of cells do not affect result we decided to include reference fluorescence protein, BFP to allow normalisation.
|